Hello,
You can use the tool "Fetch Sequences -> Extract Genomic DNA" with a GTF
file and a custom reference genome to get the fasta sequence.
Instructions are here for Custom Genomes in general and "Tools on the
Main Server" covers this tool:
http://wiki.galaxyproject.org/Support#Custom_reference_genome
The tool "EMBOSS -> geecee" can be used to perform the calculation on
the resulting fasta sequences.
Best,
Jen
Galaxy team
On 9/10/13 11:14 PM, 师云 wrote:
Hi everyone,
I want to calculate GC content of transcripts in the gtf file like this:
chr1 Cufflinks transcript 3 22 1000 + . gene_id "CUFF.23955";
transcript_id "CUFF.23955.1";
chr1 Cufflinks exon 3 10 1000 + . gene_id "CUFF.23955"; transcript_id
"CUFF.23955.1"; exon_number "1";
chr1 Cufflinks exon 13 18 1000 + . gene_id "CUFF.23955"; transcript_id
"CUFF.23955.1"; exon_number "2";
chr1 Cufflinks exon 20 22 1000 + . gene_id "CUFF.23955"; transcript_id
"CUFF.23955.1"; exon_number "3";
and the genome sequence that transcript comes from is:
>chr1
GTAGCGTCTCCGACGCGGATATGACCGCACGCTGATGCTCCCAGGGATGAGAGGCGTGCG
I have to calculate GC content of the transcript after getting the
sequence of the transcript.
So how can I get the sequence of the transcript. In this case, it
would be AGCGTCTC + ACGCGG + TAT, meaning
the transcript sequence would be AGCGTCTCACGCGGTAT.
Is it possible in the Galaxy?
___________________________________________________________
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org. Please keep all replies on the list by
using "reply all" in your mail client. For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:
http://lists.bx.psu.edu/listinfo/galaxy-dev
To manage your subscriptions to this and other Galaxy lists,
please use the interface at:
http://lists.bx.psu.edu/
To search Galaxy mailing lists use the unified search at:
http://galaxyproject.org/search/mailinglists/
--
Jennifer Hillman-Jackson
http://galaxyproject.org
___________________________________________________________
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org. Please keep all replies on the list by
using "reply all" in your mail client. For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:
http://lists.bx.psu.edu/listinfo/galaxy-dev
To manage your subscriptions to this and other Galaxy lists,
please use the interface at:
http://lists.bx.psu.edu/
To search Galaxy mailing lists use the unified search at:
http://galaxyproject.org/search/mailinglists/