Hi Jen

That looks fantastic, thank you. Hopefully this solves my problem :)

Cheers,
Jon

On 07 Nov 2013, at 8:20 PM, "Jennifer Jackson" 
<j...@bx.psu.edu<mailto:j...@bx.psu.edu>> wrote:

Hello,

This is one of the files?
GSM803805_ZMR3_trimmed.txt.gz


ID = Unique sequences identified

ZMR3_raw = Abundance count (raw value)

ZMR3 = Abundance count (tags per million)


ID    ZMR3_raw    ZMR3

TCAAGATTGCATGTAGAAGAGGAAA    1    1

AAGATAGAAGTCAAACACGTT    1    1

AAGCAATTCGAAGGTCGT    1    1

CGAACGAAGATCGCTCACGATC    1    1

GACTGTTGTGGATGATTACTCTAG    1    1

GGAGATCGTGGCTAAGACTT    1    1

AAGCTAATGTGAACTCTGA    1    1

TGTGAGCATACCTGTCGGGACTCGTATG    1    1

Yes, you can create a FASTQ file from this. Tools under "Text or FASTA 
Manipulation" unless noted.

0 - Load the file(s)
1 - 'Add column' starting with 1 and choosing to increment. This assigns a 
unique identifier. Or add in any other type that you want - tools in this same 
tool group can help rearrange data.
2 - 'Cut' out the fourth and first column (result: identifier <tab> sequence).
3 - use 'Tabular-to-FASTA'
4 - Use the tool "'NGS: QC and manipulation: Combine FASTA and QUAL into 
FASTQ'. Do not choose a quality score file.
5 - Double check the datatype is ".fastqsanger" and reassign the "database" as 
needed.
6 - Optional: extract a workflow (History menu) from the method the first time 
through, save, and run on subsequent files.

Hopefully this helps,

Jen
Galaxy team

On 11/7/13 12:30 AM, Jonathan Glass wrote:
Hi There

Im trying to map RNA-seq data to a reference genome in Galaxy (Main instance) 
using both Bowtie 1 and Bowtie 2. Im currently using publicly available data 
(http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE28755) which is not 
available in FASTQ format - only the raw sequences with the read count. Is 
there a way to set the input data for bowtie to raw, as is possible using the 
terminal? Or is there a way to convert a raw sequence to FASTQ (not sure if 
this would work, but it might be possible if I assigned accession numbers to 
each sequence and made all the quality scores identical)?

Thanks very much
Jonathan Glass
Disclaimer - University of Cape Town This e-mail is subject to the UCT ICT 
policies and e-mail disclaimer published on our website at 
http://www.uct.ac.za/about/policies/emaildisclaimer/ or obtainable from +27 21 
650 9111. If this e-mail is not related to the business of UCT it is sent by 
the sender in the sender's individual capacity.


___________________________________________________________
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org<http://usegalaxy.org>.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

  http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

  http://lists.bx.psu.edu/

To search Galaxy mailing lists use the unified search at:

  http://galaxyproject.org/search/mailinglists/


--
Jennifer Hillman-Jackson
http://galaxyproject.org

Disclaimer - University of Cape Town This e-mail is subject to the UCT ICT 
policies and e-mail disclaimer published on our website at 
http://www.uct.ac.za/about/policies/emaildisclaimer/ or obtainable from +27 21 
650 9111. If this e-mail is not related to the business of UCT it is sent by 
the sender in the sender's individual capacity.
___________________________________________________________
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

  http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

  http://lists.bx.psu.edu/

To search Galaxy mailing lists use the unified search at:

  http://galaxyproject.org/search/mailinglists/

Reply via email to