Hi,
"Summary Statistics" is ok, but before you need to use the tool 'Compute
sequence length'.
Ciao,
Bjoern
Am 23.05.2014 13:29, schrieb Dominique Cowart:
Hello,
I am attempting to use Galaxy to calculate the mean sequence read
length and identify the range of read lengths for my 454 data. The
data has already been divided into columns:
>HD4AU5D01BHBCQC TCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC
>HD4AU5D01A093MC TCTGTCGCTCTGTCTCTCTTCTCTCTCTCTCTCTCT
I have attempted to use the "Summary Statistics" button, however it
appears to only be for numerical data and not sequence data. Is this
tool/task available
via Galaxy?
Thank you in advance,
Dominique Cowart
___________________________________________________________
The Galaxy User List is being replaced by the Galaxy Biostar
User Support Forum at https://biostar.usegalaxy.org/
Posts to this list will be disabled in May 2014. In the
meantime, you are encouraged to post all new questions to
Galaxy Biostar.
For discussion of local Galaxy instances and the Galaxy
source code, please use the Galaxy Development list:
http://lists.bx.psu.edu/listinfo/galaxy-dev
To manage your subscriptions to this and other Galaxy lists,
please use the interface at:
http://lists.bx.psu.edu/
To search Galaxy mailing lists use the unified search at:
http://galaxyproject.org/search/mailinglists/
___________________________________________________________
The Galaxy User List is being replaced by the Galaxy Biostar
User Support Forum at https://biostar.usegalaxy.org/
Posts to this list will be disabled in May 2014. In the
meantime, you are encouraged to post all new questions to
Galaxy Biostar.
For discussion of local Galaxy instances and the Galaxy
source code, please use the Galaxy Development list:
http://lists.bx.psu.edu/listinfo/galaxy-dev
To manage your subscriptions to this and other Galaxy lists,
please use the interface at:
http://lists.bx.psu.edu/
To search Galaxy mailing lists use the unified search at:
http://galaxyproject.org/search/mailinglists/
