Good Evening Adrian: This probe sequence you mention appears to map perfectly to: chrX:106,956,991-106,957,015 on GRCh37. It is on scaffold: GL000169.1 and contig: AL590423.14
Did your BLAST result have coordinates on chrX or somewhere else ? --Hiram Adrian Johnson wrote: > Dear UCSC GenomeBrowser staff: > > I wanted to map probe sequences from U133plus2 chip to human genome. > > I downloaded all chromosomes in FASTA format from ncbi FTP site: > > For example: > hs_ref_GRCh37_chrX.fa.gz > > I used BLAST to map the probe sequence to fasta file mentioned above. > I used strict conditions that I wanted only 100% identical hit. > > One such probe hit: > probe:HG-U133_Plus_2:208763_s_at:318:797 Homo sapiens chromosome > X genomic contig, GRCh37 reference primary assembly 25 25 1 > 30253299 30253323 > > > when I try to find chrX:30253299-30253323, the position does not map > to the location it should have pointed. > the desired position is : > > 000000001 gggagtattgactggtcccttacct 000000025 > <<<<<<<<< ||||||||||||||||||||||||| <<<<<<<<< > 106957015 gggagtattgactggtcccttacct 106956991 > > > My question: > Although NCBI and UCSC are same reference genomes, why am I having > different position. Is this because I am searching against a contig as > opposed to a full chromosome. > > Please help me. > thanks > Adrian > _______________________________________________ > Genome maillist - [email protected] > https://lists.soe.ucsc.edu/mailman/listinfo/genome > _______________________________________________ Genome maillist - [email protected] https://lists.soe.ucsc.edu/mailman/listinfo/genome
