Hi, I downloaded 'snp128' table for 'mm9' (the first two lines shown below). Where is the base position for the SNP?
#bin chrom chromStart chromEnd name score strand refNCBI refUCSC observed molType class valid avHet avHetSE func locType weight 1 chr1 25165766 25165835 rs32449302 0 + AAAACAAAACAAAGCAAAACAAAAGAGACAAACAAACAACAACCCCAAATTATGTTGGTGTGTAAAAAA AAAACAAAACAAAGCAAAACAAAAGAGACAAACAAACAACAACCCCAAATTATGTTGGTGTGTAAAAAA A/G genomic single unknown 0 0 intron rangeSubstitution 1 Thanks, Xinxia _______________________________________________ Genome maillist - [email protected] https://lists.soe.ucsc.edu/mailman/listinfo/genome
