BLAT gaggaaacgttcaccctgtctacta on ucsc website gives me. ACTIONS QUERY SCORE START END QSIZE IDENTITY CHRO STRAND START END SPAN --------------------------------------------------------------------------------------------------- browser details YourSeq 25 1 25 25 100.0% 6 + 87859757 87859781 25
I run BLAT on command line. It gives me 25 0 0 0 0 0 0 0 + 486:557:1415670_at 25 0 25 chr6 149517037 87859756 87859781 1 25, 0, 87859756, gaggaaacgttcaccctgtctacta, gaggaaacgttcaccctgtctacta, The starts are off by 1. Could you please let me know why there is a difference? Here is the version of my command line BLAT blat - Standalone BLAT v. 34 fast sequence search command line tool -- Regards, Peng _______________________________________________ Genome maillist - [email protected] https://lists.soe.ucsc.edu/mailman/listinfo/genome
