Hello Melissa, It is very likely that your sequence is simply too short (20 bases) to find a match. If possible, try bounding the region with additional sequence in order to find a BLAT match.
I tried using the zoom out 1.5x button on the main browser page for hg18 (top of page) starting with your region chr21:46881236-46881255, extracted the DNA (DNA link top blue bar) for the new region chr21:46,881,231-46,881,260, and ran a web BLAT with this sequence (below, 30 bases). It was enough extra sequence to find two 100% identity matches. One covered the full 30 bases (chr21 - original location), the other a 21 base fragment (chr13 - alternate location). 30 base query used vs hg18, web BLAT chr21:46,881,231-46,881,260 >AGTAGAAATGGAAAAGAAAATGAAATAAAT Please try this and see if you can duplicate. The types of sequences BLAT will find matches for is defined on this BLAT page (scroll down): http://genome.ucsc.edu/cgi-bin/hgBlat Specifically: BLAT on DNA is designed to quickly find sequences of 95% and greater similarity of length 25 bases or more. It may miss more divergent or shorter sequence alignments. It will find perfect sequence matches of 25 bases, and sometimes find them down to 20 bases. BLAT on proteins finds sequences of 80% and greater similarity of length 20 amino acids or more. In practice DNA BLAT works well on primates, and protein blat on land vertebrates. Hopefully this helps to explain how BLAT functions, Jennifer --------------------------------- Jennifer Jackson UCSC Genome Informatics Group http://genome.ucsc.edu/ On 5/21/10 4:57 PM, Melissa Cline wrote: > Hi folks, > > I'm observing strange behavior, with exactly these steps as follows: > 1. Go into the round robin browser for hg18 and go to the coordinates > chr21:46,881,236-46,881,255 > 2. Extract a copy-able version of the reference genome sequence at > these coordinates by clicking on the DNA link. That yields this: >> hg18_dna range=chr21:46881236-46881255 5'pad=0 3'pad=0 strand=+ >> repeatMasking=none > AAATGGAAAAGAAAATGAAA > 3. Go to BLAT, select hg18, enter this sequence in the search window, > and click Submit. > > This yields the message: > > Sorry, no matches found > > Why can't it find this sequence? What am I missing? > > Thanks! > > Melissa > _______________________________________________ > Genome maillist - [email protected] > https://lists.soe.ucsc.edu/mailman/listinfo/genome _______________________________________________ Genome maillist - [email protected] https://lists.soe.ucsc.edu/mailman/listinfo/genome
