I have the following sequence in the query.fasta file. I run the following commands (one with mask, one without mask) and I got the following results. The one without mask gives me five results (just as in the online blat). The one with mask gives me only one result, which is not in the five results of the other run. I looked at the genomic region around the five results, I found no repeatMasker marked region. Therefore, I don't understand why the masked run doesn't give the same results as the unmasked run. I know that -mask=lower means excluding lower cased part of the genome, but what those lower case regions mean? Could you help me understand the -mask option a little better?
>HWI-EAS11X_10097:4:1:1049:11109#0__1__3__41__3 GGGGAGCTCTGTGTGTGAGGCCAGCCTGGTCCGGGACAGCC ########################### blat -noHead -t=dna -q=dna -tileSize=11 -stepSize=5 -minScore=20 -out=psl mm9.2bit -mask=lower query.fasta mask.psl 22 1 0 0 0 0 0 0 - HWI-EAS11X_10097:4:1:1049:11109#0__1__3__41__3 41 9 32 chr5 152537259 135066875 135066898 1 23, 9, 135066875, ########################## ######################### blat -noHead -t=dna -q=dna -tileSize=11 -stepSize=5 -minScore=20 -ooc=mm9_11.ooc -out=psl mm9.2bit query.fasta mask.psl 22 1 0 0 0 0 0 0 + HWI-EAS11X_10097:4:1:1049:11109#0__1__3__41__3 41 8 31 chr6 149517037 83518525 83518548 1 23, 8, 83518525, 40 1 0 0 0 0 0 0 + HWI-EAS11X_10097:4:1:1049:11109#0__1__3__41__3 41 0 41 chr5 152537259 144157072 144157113 1 41, 0, 144157072, 27 1 0 0 0 0 1 6 + HWI-EAS11X_10097:4:1:1049:11109#0__1__3__41__3 41 13 41 chr12 121257530 52996615 52996649 2 6,22, 13,19, 52996615,52996627, 30 1 0 0 0 0 1 460 - HWI-EAS11X_10097:4:1:1049:11109#0__1__3__41__3 41 0 31 chr9 124076172 63135307 63135798 2 25,6, 10,35, 63135307,63135792, 20 0 0 0 0 0 0 0 - HWI-EAS11X_10097:4:1:1049:11109#0__1__3__41__3 41 9 29 chr11 121843856 101420081 101420101 1 20, 12, 101420081, ####################### -- Regards, Peng _______________________________________________ Genome maillist - [email protected] https://lists.soe.ucsc.edu/mailman/listinfo/genome
