Hello! You did not say which of the many kinds of blat you used. Or which assembly you used for your database (aka target).
I will assume for now that you used hgBlat on genome.ucsc.edu with hg19. In this case what you see might be explained by the fact that our gfServers for protein have masking turned on out of necessity. Our nucleotide gfServers do not use masking. Even this run of "llllllll" looks repetitive. In general, not every query alignment will return exactly the same results between protein and nucleotide. For instance, protein blat is more sensitive and can compare more distantly related species than nucleotide blat. -Galt 6/29/2010 6:35 AM, Bekkari, Kavitha: > > Hi, > I am trying to understand the results that blat is outputting. I just > did a blat of human GCGR sequence, both mRNA and Protein > independently(NM_000160,NP_000151) to human genome, mRNA output came out > fine but the protein blat gives out no match for the first 19 amino > acids. If I take just 19 a.a along with 1 more a.a(just to make the > query 20 a.a long) next to it and blat it against human genome, it says > no matchs.But when I blat the nucleotide sequence of the 19 a.a +1 a.a , > blat do give out match. Really don't understand how is this possible. > Here is my first 19+ a.a of human GCGR >> test > mppcqpqrpllllllllacQ > > > below are the results from the nucleotide blat of the above a.a: > > Alignment of test and chr17:79766895-79766954 > Click on links in the frame to the left to navigate through the > alignment. Matching bases in cDNA and genomic sequences are colored blue > and capitalized. Light blue bases mark the boundaries of gaps in either > sequence (often splice sites). > ------------------------------------------------------------------------ > -------- > > cDNA test > > ATGCCCCCCT GCCAGCCACA GCGACCCCTG CTGCTGTTGC TGCTGCTGCT 50 > GGCCTGCCAG > > ------------------------------------------------------------------------ > -------- > > Genomic chr17 : > > actcagctgc cctcggagga gcgtacacac ccaccaggac tgcattgccc 79766844 > cagctgtgca gcccctgcca gatgtgggag gcagctagct gcccagaggc 79766894 > ATGCCCCCCT GCCAGCCACA GCGACCCCTG CTGCTGTTGC TGCTGCTGCT 79766944 > GGCCTGCCAG gtgaggactc acagcaccct cagcacccag gggccctcct 79766994 > gtgaggactg cacactgatg gctctctgtc tgcctgcctg cctgcctgcc 79767044 > tgtctgcctg > > ------------------------------------------------------------------------ > -------- > > Side by Side Alignment > > 00000001 atgcccccctgccagccacagcgacccctgctgctgttgctgctgctgct 00000050 >>>>>>>>> ||||||||||||||||||||||||||||||||||||||||||||||||||>>>>>>>> > 79766895 atgcccccctgccagccacagcgacccctgctgctgttgctgctgctgct 79766944 > > 00000051 ggcctgccag 00000060 >>>>>>>>> ||||||||||>>>>>>>> > 79766945 ggcctgccag 79766954 > > Notice: This e-mail message, together with any attachments, contains > information of Merck& Co., Inc. (One Merck Drive, Whitehouse Station, > New Jersey, USA 08889), and/or its affiliates Direct contact information > for affiliates is available at > http://www.merck.com/contact/contacts.html) that may be confidential, > proprietary copyrighted and/or legally privileged. It is intended solely > for the use of the individual or entity named on this message. If you are > not the intended recipient, and have received this message in error, > please notify us immediately by reply e-mail and then delete it from > your system. > > > _______________________________________________ > Genome maillist - [email protected] > https://lists.soe.ucsc.edu/mailman/listinfo/genome _______________________________________________ Genome maillist - [email protected] https://lists.soe.ucsc.edu/mailman/listinfo/genome
