Thank you, Mary, that's exactly what I was looking for. --Ivan
On Friday 13 August 2010 12:40:48 pm Mary Goldman wrote: > Hi Ivan, > > Information on how the FASTA files for the conservation track are > formatted can be found here: > http://genome.ucsc.edu/goldenPath/help/hgTablesHelp.html#FASTA, under > "Explanation of CDS FASTA header format". > > I hope this information is helpful. Please feel free to contact the > mail list again if you require further assistance. > > Best, > Mary > ------------------ > Mary Goldman > UCSC Bioinformatics Group > > On 8/12/10 3:31 PM, Ivan Adzhubey wrote: > > Hello, > > > > Could someone point me to a description of defline format for the > > multiz46way > > > > FASTA files? For instance: > >> uc010nxq.1_hg19_1_3 38 0 2 chr1:12190-12227+ > > > > ATGAGTGAGAGCATCAACTTCTCTCACAACCTAGGCCA > > > >> uc010nxq.1_panTro2_1_3 38 0 2 chr15:100048575-100048624- > > > > ATGAGTGAGAGGATCAACTTCTCTGACAGCCTAGGCCA > > > >> uc010nxq.1_gorGor1_1_3 38 0 2 > > > > What is the meaning of the numbers following (obviously) the knownGene > > and assembly version id's? > > > > Thanks, > > Ivan > > _______________________________________________ > > Genome maillist - [email protected] > > https://lists.soe.ucsc.edu/mailman/listinfo/genome > > _______________________________________________ > Genome maillist - [email protected] > https://lists.soe.ucsc.edu/mailman/listinfo/genome The information in this e-mail is intended only for the person to whom it is addressed. If you believe this e-mail was sent to you in error and the e-mail contains patient information, please contact the Partners Compliance HelpLine at http://www.partners.org/complianceline . If the e-mail was sent to you in error but does not contain patient information, please contact the sender and properly dispose of the e-mail. _______________________________________________ Genome maillist - [email protected] https://lists.soe.ucsc.edu/mailman/listinfo/genome
