Hi there,
I got a seuquence
TGAAAACTGGCACAAGACAAGGATGCC
located in chr1:247183338-247183364 strand-.
but when I blat it. I can not find that location for the sequence.
but I found it in other loci of chr1 and strand-:
browser details YourSeq 27 1 27 27 100.0% 1 -
219139486 219139512 27
browser details YourSeq 27 1 27 27 100.0% 1 -
192113590 192113616 27
browser details YourSeq 27 1 27 27 100.0% 1 -
189295101 189295127 27
browser details YourSeq 27 1 27 27 100.0% 1 -
156553131 156553157 27
browser details YourSeq 27 1 27 27 100.0% 1 -
156665481 156665507 27
can you please tell me why?
thanks
Yu
_______________________________________________
Genome maillist - [email protected]
http://www.soe.ucsc.edu/mailman/listinfo/genome
