Hi, Louis!

Problem #2 is a coordinate bug in webBlat that will be fixed soon
hopefully. I have notified Jim Kent the author of BLAT about it.

Problem #1 about the differing join threshold of 8 hgBlat versus 20 
webBlat is something that I can also raise with Jim in the interests
of consistency.

Thanks for reporting these issues.

In future, please direct questions about BLAT to the main mailing list 
"genome" instead of "genome-mirror".

-Galt


On Mon, 22 Dec 2008, louis wrote:

> Hi,
>
> I try to replicate a UCSC blat service on my own machine.
> I start gfServer with the following parameter, as specified in the Blat
> FAQ (http://genome.ucsc.edu/FAQ/FAQblat):
>
>   gfServer start blatMachine portX -stepSize=5 -log=untrans.log
> database.2bit
>
>
> And I access gfServer with webBlat CGI.
>
> However, there are two problems:
> 1. BLAT Search Results from my own blat service are not always exactly
> the same as that from the UCSC blat service.
>
>   * My blat result:
>
>   query             800     1   800   800 100.0%
> gi|89161185|ref|NC_000001.9|NC_000001   +  101997551 101998350    800
>   query             30    330   361   800  96.9%
> gi|89161210|ref|NC_000006.10|NC_000006   +   51189132  51189163     32
>   query             28    332   359   800 100.0%
> gi|89161216|ref|NC_000009.10|NC_000009   -  124137815 124137842     28
>   query             27    625   669   800  93.6%
> gi|51511721|ref|NC_000005.8|NC_000005   +   14649289  14649656     368
>   query             27    334   360   800 100.0%
> gi|89161213|ref|NC_000007.12|NC_000007   +   85422415  85422441     27
>
>
>   * UCSC blat Result:
>
>   browser  details  YourSeq          800     1   800   800 100.0%
> 1   +  101997551 101998350    800
>   browser  details  YourSeq           33   325   358   800 100.0%
> 13   -   59690766  59690802     37
>   browser  details  YourSeq           30   330   361   800  96.9%
> 6   +   51189132  51189163     32
>   browser  details  YourSeq           28   332   359   800 100.0%
> 9   -  124137815 124137842     28
>   browser  details  YourSeq           27   334   360   800 100.0%
> 7   +   85422415  85422441     27
>
>
> My Blat instance generated an extra record:
>
>   query             27   625   669   800  93.6%  
> gi|51511721|ref|NC_000005.8|NC_000005   +   14649289  14649656    368
>
>
> I assume it's something relevant to the gap-merging issue since that
> extra record has gaps with the size between 8 and 20 bases, and my Blat
> instance shows "//Aligned Blocks with gaps <= 20 bases are merged for
> this display" ; //while what of UCSC Blat shows "/Aligned Blocks with
> gaps <= 8 bases are merged for this display /"  However, I can't find
> out how to adjust this parameter.
>
>
> 2. for the details of each Blat result listed in the Blat Search Result,
> the start and end position  are offset by 20 bases:
>
>   * the start and end shown in the Blat Search Result:  101997551 -
> 101998350
>
>   query            800     1   800   800 100.0%  
> gi|89161185|ref|NC_000001.9|NC_000001   +  101997551 101998350    800
>
>
>
>   * That shown in the corresponding details is: 101997671 - 101998470
>
>   000000001
> tgttactgatagtaaattcttaaatatattctgtgctggtttactggttcattatttgaa 000000060
>   >>>>>>>>>
> |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| >>>>>>>>>
>   101997671
> tgttactgatagtaaattcttaaatatattctgtgctggtttactggttcattatttgaa 101997730
>   ......
>   000000781 tcatcatcctcaaatgatta 000000800
>   >>>>>>>>> |||||||||||||||||||| >>>>>>>>>
>   101998451 tcatcatcctcaaatgatta 101998470
>
> The spec to produced this result is as follows:
>
>   * OS: CentOS kernel 2.6.18
>   * gfServer/webBlat : blatSuite v34
>   * Apache 2
>   * Human Genome assembly build 36.1
>   * Query sequence:
>
>   tgttactgatagtaaattcttaaatatattctgtgctggtttactggttc
>   attatttgaattcttcttgattggtttatttgtgaaaatatatttatttc
>   gcctacatttttgaaggctattttatatgagtataggaatgtaagttggc
>   agttacttctcttagtacgttaaagattttgttccatttttggttggatt
>   ctgttattctcttgagaaatcagttgtaaaattaatttttgttactttga
>   gtaatgtgccttttaaaattttattccctgtttccagattctctcctttt
>   gtatgagattttcttctgtaatgtgattaggtgtgtttttgttgttgttg
>   ttattgtttttattgcatttaaattttccagtgcctcttgaatatgtgga
>   ttgttgtctttcctgagttctggattctcccctgtcttctcttcagattt
>   tgcttctgcttcatttcctttctGATTTGTGTTTGTGTTTGGGGCTATAT
>   CTACATTTATGTCAGATATTTGACTGTGTTACACACAGCTCCTTTTTTTT
>   CAACTTTCCACTTTTTTAGATGTGCTTTTGTTTACATATTTTGACTATCT
>   GCTATTAAATTGTTTAAATTCTCAACACTCCTTTTTTTTCATGATATTTT
>   TCTTTTGGGATAATTTTTTCCCTGACAATAAAAATAAAAAGtttcctgaa
>   acattaaaaaatacatttagtgagggtttttttaaatgattaaacactta
>   cagtttgtatttctacatatttaaaacttatcatcatcctcaaatgatta
>
>
>
>
> Cheers,
>
> Louis
>
>
>
>
>
> _______________________________________________
> Genome-mirror mailing list
> [email protected]
> http://www.soe.ucsc.edu/mailman/listinfo/genome-mirror
>
_______________________________________________
Genome maillist  -  [email protected]
http://www.soe.ucsc.edu/mailman/listinfo/genome

Reply via email to