hgBlat does little filtering but it does require a minimum score of 20. It is meant for human consumption, so it tries to show you all alignments except really short ones. hgBlat is running against our dna instance of gfServer which is using -stepSize=5.
Typically, with batches of alignments and standalone BLAT, people employ various filtering utilities such as pslReps and pslCDnaFilter with settings appropriate to their work. Very often what you want are alignments of sufficient quality or coverage, and not just every possible alignment. -Galt On Tue, 17 Mar 2009, Mittal, Vinay K wrote: > Hi, > I was running local blat on my mac osx server for the following sequence: >> seq > TAGTAGTAGACTAATAACAATAGTAAGAAAAATATTGTTTAATGTATGTATACAATTTATATGGTTTCACAAATCTGTTTAGATGTGTGTTTCAGGCAATTTCTTATTAAAGTTTTTGCTACCTTA > > I used the same command line as mentioned on FAQ page to duplicate web BLAT. > >> From the local blat I got 86 hits on human genome while BLAT on UCSC genome >> website shows only 6 hits for the same. > Does web based BLAT (on UCSC website) filter out hits based on some criteria?? > > Thanks. > > Sincerely, > V. > > > -- > -------- > Vinay Kumar Mittal > MS,Bioinformatics > Georgia Institute of Technology > _______________________________________________ > Genome maillist - [email protected] > http://www.soe.ucsc.edu/mailman/listinfo/genome > _______________________________________________ Genome maillist - [email protected] http://www.soe.ucsc.edu/mailman/listinfo/genome
