Sorry, I have found the answer to my question:

http://www.soe.ucsc.edu/pipermail/genome/2006-August/011546.html

 

I should have searched further before emailing you. My apologies.

 

 

 

From: Cooney, Patrick 
Sent: Tuesday, March 31, 2009 10:45 AM
To: '[email protected]'
Subject: dbSNPs show up in Genome Browser but not in extended DNA Output

 

Hello,

 

In the Genome Browser, dbSNPs rs6143696 and rs34420566 are part of
builds 129, 128 and 126, but when I get the extended DNA output for the
RYR2 gene, choosing SNPs for those builds to be red, lower case and
unlderlined, they are not marked.

 

When I BLAT the sequence:

GAATGGAGACATGTTTTCAGTGTACGTTAAC

 

And go to the browser for the one return, those two SNPs appear under
dbSNP Build 129, 128 and 126.

 

But when I get the extended DNA ouput for RYR2, they are not marked as I
chose for SNPs from those builds.

 

Sorry to take your time, but I just wanted to be sure I am not missing
something.

 

Thanks,

Patrick

_______________________________________________
Genome maillist  -  [email protected]
http://www.soe.ucsc.edu/mailman/listinfo/genome

Reply via email to