Hi Nicholas,

I don't have any quick answers for you on how to decide whether the 
sequences in the multiz46way table represent truly orthologous regions 
in distant species.  I can point you to the documentation on how the 
table was created, though.  First look at the Conservation track 
description (hit "describe table schema" in the Table Browser or just 
follow this link: 
http://genome.ucsc.edu/cgi-bin/hgTrackUi?db=hg19&g=cons46way).  The 
multiple alignment (multiz46way) track is created from pairwise 
alignments, which are displayed in the Chain and Net tracks.  To see a 
description of those tracks, select one in the Table Browser and hit 
"describe table schema" or click here: 
http://genome.ucsc.edu/cgi-bin/hgTrackUi?db=hg19&g=primateChainNet.

The references section in both of the track descriptions have links to 
several applicable papers.  There's also this page on our genomewiki 
that has an informal discussion of chains and nets that you might find 
helpful:
http://genomewiki.ucsc.edu/index.php/Chains_Nets

To see why there are only 5 nucleotides for pteVam1 in your sample 
below, I recommend looking at your region in the Genome Browser and 
zooming out a bit.  You'll see that the 5 nucleotides are actually part 
of a longer alignment, and that the region you are interested in mostly 
contains a gap.

I hope this helps.  If you have further questions, please feel free to 
contact us again at [email protected].

--
Brooke Rhead
UCSC Genome Bioinformatics Group


On 01/09/11 17:03, Nicholas Price wrote:
> Hi
> 
> I am trying to identify orthologous pseudogenes using Human as the reference
> genome..I am using multiz46way..Given that pseudogenes are evolving
> neutrally, my question is at what evolutionary distance (0.05,0.1,0.2
> etc) can I be more sure that the sequences returned are orthologous...Have
> there been any tests done?...For example given the human
> pseudogene chr5:180378815-180378949 the following sequences are returned..
> The results include very distant species like the Flying fox: pteVam1. Why
> is a sequence of 5 nucleotides returned? Thank you very much ...Nicholas
> 
> 
>> pteVam1
> cagaa
>> loxAfr3
> aatgaactattgatacacaacacggatgaatctcaaaataattattccaagtcatagaagccagaccaggaaaaaaaaaaaaaaaagaata
>> otoGar1
> GAGAATATCCGGAAGATGCAGG
>> choHof1
> CAGCAGCTCCGCGTGCAGGAGGCAGTGGACTCCATGGTGAAGAGTCTGGAGAGAGAGAACATCCGGAAGATGCAGG
>> panTro2
> CAGCAGCTGTGGGTGCAGGAGGTGGTGGACTCCGTGGTGAAGAGTCTGGACAGAGAGAACATCCAGAAGATCCAGGTGAGCAGCCCGAGGCCCAGCCAAGGCGTGGCCAGGGTGAAAGACCAGAAAGGCGAAGGC
>> macEug1
> GCTGCGGGTGCAGGAGGCGGTGAACACCATGGTGAAAGGACTGGAGCGGGAGAACATCCGCAAGATGCAGGTAGCGGC
>> rheMac2
> CAGCTGTTGTGGGTGCAGGAGGTGGTGGACTCTGTGGTGAAGAGTCTGGACAGAGAGAATATCCAGAAGATCCAGGTGAGCAGCCTGAGGCCCAGCCAAGGCGTGGCCAAGGTGAAAGACCAGAAAGGCGAAGGT
>> eriEur1
> CAGCAGCACCGGGTGCAGGAGGCGGTGGACACCATGATGAAGAGTCTAGAGAAGGAGAACATCCGAAAGATGCAGGTAGCCCGGCTGGGGTCGGCCAGGGCACCGCCAAGGTGAAAGCCCGGATAGGCTAATGC
>> ponAbe2
> CAGCAGCTGTGGGTGCAGGAGGTGGTGGACTCCTTGGTGAAGAGTCTGGACAGAGAGAACATCCAGAAGATCCAGGTGAGCAGCCCGAGGCCCAGCCAAGGTGTGGCCAAGGTGAAAGACCAGAAAGGCAAAGCC
>> papHam1
> CAGCTGTTGTGGGTGCAGGAGGTGGTGGACTCTGTGGTGAAGAGTCTGGACAGAGAATACCCAGTAGATCCAGGTGAGCAGCCCGAGAGTCAGCCAAGGCGTGGCCAAGGTGAAAGACCAGAAAGGCAAAGGC
>> hg19
> CAGCAGCTGTGGGTGCAGAAGGTGGTGGATTCCATGGTGGAGAGTCTGGACAGAGAGAACATCCAGAAGATCCAGGTGAGCAGCCCGAGGCCCAGCCAAGGCGTGGCCAGGGTGAAAGACAAGAAAGGCGAAGGC
>> speTri1
> CAGCAGCTCCGGGTGCAGGAGGCGGTGGACTCCATGGTGAAGAGTGTGGAGAGGGAGAACATCCGGAAAATGCAGG
>> echTel1
> CAGCAGCTCCGCGTGCAGGAGGCAGTGGACTCCATGGTGAAGAGCCTGGAGAGGGAGAACATCCGGAAGATGCAGG
> 
> 
_______________________________________________
Genome maillist  -  [email protected]
https://lists.soe.ucsc.edu/mailman/listinfo/genome

Reply via email to