Hi Greg, Thank you for your response. By looking at your suggestion, I think I have found the reason though I have not tested it yet. I had already used the -minMatch switch, but for some reason instead of 0.1 it was set to 01. I had a typo in the file where this command was stored for later use and I had copy/paste it. I apologize also for not explicitly writing the full command that I had used.
I will test it soon and if there are still any problem with let you know. Thanks again for helping with this. perdeep Perdeep K. Mehta, PhD Research Informatics, Information Sciences Division St. Jude Children's Research Hospital 262 Danny Thomas Place Memphis, TN 38105 -----Original Message----- From: Greg Roe [mailto:[email protected]] Sent: Monday, April 11, 2011 4:17 PM To: Mehta, Perdeep Cc: '[email protected]' Subject: Re: [Genome] lifting over Dog genomic coordinates to Human genome Hi Perdeep, Sorry for the delayed reply. "Partially deleted is new" means that the sequence intersects with only part of a single alignment chain in the region. I suspect you have the "Minimum ratio of bases that must remap/Minmatch" setting too high. The online version of liftOver defaults minmatch to .95 for within species liftovers and 0.1 for liftOvers between different species. The command line liftOver application always defaults to 0.95. Thus you may get different results between the two if you don't make sure nimMatch is set the same. Try running the liftOver again at the command line and setting -minMatch=0.1 You can see all liftOver options at the command line by just typing "liftOver". Let us know if you have any additional questions: [email protected] - Greg Roe UCSC Genome Bioinformatics Group On 4/4/11 2:58 PM, Mehta, Perdeep wrote: > Hi, > > I have a couple of files containing several Dog genomic coordinates that I > want to lift over to the Human genome. I have down loaded the > canFam2ToHg19.over.chain files from UCSC website and using it with previously > installed UCSC "liftOver" program to do this. > > For a test, I used just two Dog genome coordinates, as listed below (in file) > chr20 58241270 58241311 contig_1 42 + > chr6 54123651 54123725 contig_2 75 + > > When I use the liftOver program with canFam2ToHg19.over.chain, I get one > mapped to Human genome and second one goes to unmapped output. For example, > This one gets mapped to Human genome (out file 1) > chr1 99175258 99175341 contig_2 1 - > > And the other one remains unmapped (out file 2) > #Partially deleted in new > chr20 58241270 58241311 contig_1 42 + > > When I tested this by using their original sequences the both Dog contigs > actually show corresponding interonic regions of Human genome. First one > mapping to SH3GL2 gene and second to SNX7 gene (this is correctly identified > by liftOver program). > > I do not also understand what "#Partially deleted in new" means? Why is it > not able to lift over the coordinates of the first contig? > > Here are the two sequences used; >> contig_1 > GGCCAGCTCCTGAGTCTGCTGCCCTCTTAGAGCGTAGCCACA >> contig_2 > GGCAGGTCTGGATCTGAATTGAAGCTCTTAATAGCCTAGGAACTAATGTAAAAAGTGGGATGGGATCAGGTATAA > > I will appreciate any help. > > Thanks, > perdeep > > Perdeep K. Mehta, PhD > Research Scientist, Bioinformatics > Research Informatics, Information Sciences Division > St. Jude Children's Research Hospital > > > > ________________________________ > Email Disclaimer: www.stjude.org/emaildisclaimer > _______________________________________________ > Genome maillist - [email protected] > https://lists.soe.ucsc.edu/mailman/listinfo/genome _______________________________________________ Genome maillist - [email protected] https://lists.soe.ucsc.edu/mailman/listinfo/genome
