Hi Rathi, One of our engineers recommended converting your output to BAM. In particular, please see the soap2sam.pl script at http://soap.genomics.org.cn/soapaligner.html
You will also need samtools to convert the SAM to BAM, and to sort and build an index for the BAM. http://samtools.sourceforge.net/ Our notes about using BAM are here: http://genome.ucsc.edu/goldenPath/help/bam.html I hope this information is helpful. Please feel free to contact the mail list again if you require further assistance. Best, Mary ------------------ Mary Goldman UCSC Bioinformatics Group On 5/17/11 7:35 AM, Rathi Thiagarajan wrote: > Hi there, > > I was given the following RNASeq paired-end data and looking for ways to > visualize it on the genome browser. The file is a processed SOAP aligned, > paired-end, Illumina, mapped to hg19. > > The file contains the following columns (tab delimited): > ID seqOne seqTwo chromosome oneStarts oneStops twoStarts twoStops > > Looking at this example of a paired-end junction: > > HWUSI-EAS474_21_30E9BAAXX:2:1:766:164 is the ID > GCACAGCAGAAGTGTTTTTCTTTTTTTAATGAACAA is the left end > GTCCCATGTTGACAATTTGTATGGTTTACTTTTTCA is the right end > chr12 is the chromosome > 14954338,14956285, are the starts for the left end, which aligns to a > junction 14954362,14956297, stops for the left end > 14954311, right end start > 14954346, right end stop > > Here is a snapshot of a few lines from the actual file: > > GA2:1:1:32:1827#0 AAATTAGACAACTGATGTCATGCTGTCTTGGTCTCC > GTGGAAACAAGTAATGGAACCAACGCCCTGTGTGTA chr11 16779120, 16779155, 16779542, > 16779577, > GA2:1:1:34:1274#0 TGGTGACCTTCAAGGAATCTTTGAGGGCCTGGAGCT > TCCAGGAGCAGCTCCAGGCCCTCAAAGAGTCCTTGA chr11 71726406, 71726441, 71726415, > 71726450, > > (and a junction read) : > GA2:1:1:105:706#0 TGGCAGTGCAAATATCCAAGAAGAGGAAGTTTGTCG > CCTGGTTGGTGTAACTCGCACCTCAACTCCAGAGTA chr11 75110593,75111737, > 75110621,75111745, 75111807, 75111842, > > > Would really appreciate your advice on how to prepare this file to > visualize it the UCSC GB especially with the multiple coordinates for the > junction tags. I was advised that BED file might work here however not > sure how to set-up the files based on the instructions that was provided > in FAQ Data File Formats > > Thanking you in advance. > > Cheers, > Rathi > _______________________________________________ Genome maillist - [email protected] https://lists.soe.ucsc.edu/mailman/listinfo/genome
