Use pslReps or pslCDnaFilter -galt
On Jun 13, 2011, at 4:06 PM, Jinyan Huang <[email protected]> wrote: > Hiram, > > I only want to output the recode which have more that 90% overlap. > > Is it possible to config blat only output IDENTITY>90% and > QSIZE==SPAN? > > If do it chromsome by chromosome, it will let my output times 22. I > hope get less output. > > Thanks. > > On Mon, Jun 13, 2011 at 7:17 PM, Hiram Clawson <[email protected]> > wrote: >> >> I can't tell why you have a problem with memory. When I run your >> test here I can see the blat process reach a maximum size of just >> under 4 Gb as it operates. Can you indicate what source version >> you have or where you picked it up from ? >> >> The procedure you indicate where you operate one chromosome at a time >> is actually a more efficient procedure of running through a number >> of query sequences. You can also make it operate much faster with >> a pre-computed ooc file. Use the command: >> >> blat hg19.2bit /dev/null /dev/null -tileSize=11 - >> makeOoc=hg19.11.ooc -repMatch=1024 >> >> Then, in each of your per-chromosome mapping operations, use the - >> ooc flag: >> >> blat hg19.2bit:chr12 -ooc=hg19.11.ooc test.fa test.psl >> >> --Hiram >> >> ----- Original Message ----- >> From: "Jinyan Huang" <[email protected]> >> To: "Hiram Clawson" <[email protected]> >> Cc: [email protected] >> Sent: Monday, June 13, 2011 9:35:50 AM >> Subject: Re: [Genome] Blat problem >> >> If I do like this: >> >> blat ~/bin/blat/hg19.2bit:chr12 test.fa test.psl >> >> it works. But I really do not like it. I have lots of query. >> >> blat ~/bin/blat/hg19.2bit:chr12 test.fa test.psl >> Loaded 133851895 letters in 1 sequences >> Searched 243 bases in 1 sequences >> >> Thanks. >> >> On Mon, Jun 13, 2011 at 6:33 PM, Jinyan Huang >> <[email protected]> wrote: >>> Here is my test.fa >>> >>>> probe_set:HuEx-1_0-st-v2:2315101; Assembly=build-34/hg16; >>>> Seqname=chr1; Start=1788; Stop=2030; Strand=+; >>> TGTCTCTTAGCCCAGACTTCCCGTGTCCTTTCCACCGGGCCTTTGAGAGGTCACAGGGTC >>> TTGATGCTGTGGTCTTCATCTGCAGGTGTCTGACTTCCAGCAACTGCTGGCCTGTGCCAG >>> GGTGCAAGCTGAGCACTGGAGTGGAGTTTTCCTGTGGAGAGGAGCCATGCCTAGAGTGGG >>> ATGGGCCATTGTTCATCTTCTGGCCCCTGTTGTCTGCATGTAACTTAATACCACAACCAG >>> GCA >>> >>> On Mon, Jun 13, 2011 at 6:29 PM, Hiram Clawson >>> <[email protected]> wrote: >>>> Can you say anything about your query sequence in test.fa ? >>>> >>>> ----- Original Message ----- >>>> From: "Jinyan Huang" <[email protected]> >>>> To: [email protected] >>>> Sent: Monday, June 13, 2011 6:17:18 AM >>>> Subject: [Genome] Blat problem >>>> >>>> Dear list, >>>> >>>> When I run blat local. I always get this error. >>>> >>>>> blat ~/bin/blat/hg19.2bit test.fa test.psl >>>> >>>> Loaded 3137161264 letters in 93 sequences >>>> needHugeMen: Out of huge memory - request size 962165992 bytes >>>> >>>> In fact, my machine have 48G memory. I have set: >>>> >>> >> > > _______________________________________________ > Genome maillist - [email protected] > https://lists.soe.ucsc.edu/mailman/listinfo/genome _______________________________________________ Genome maillist - [email protected] https://lists.soe.ucsc.edu/mailman/listinfo/genome
