Hi Peng, This is the similar issue that you encountered with the command line version of blat (https://lists.soe.ucsc.edu/pipermail/genome/2010-June/022666.html). The reason why it is not mappable to the mouse genome by blat is due to repeats.
Here are the settings for the web based version of BLAT: http://genome.ucsc.edu/FAQ/FAQblat#blat5 This has to so with the soft masking (lower-case means repeat-masked) setting that is used with faToTwoBit for our web based version of BLAT. Hope this clarifies things for you. If you have further questions, please contact the mailing list: [email protected]. Vanessa Kirkup Swing UCSC Genome Bioinformatics Group ---------- Forwarded message ---------- From: Peng Yu <[email protected]> Date: Thu, Sep 29, 2011 at 9:04 AM Subject: [Genome] Why TACCTTGGCTGTGTTTCCGATATTCTTGGAGGTTGT is not mappable to mouse genome by blat? To: [email protected] Hi, TACCTTGGCTGTGTTTCCGATATTCTTGGAGGTTGT is not mappable to mouse genome (allowing 2 mismatch) in blat @ the browser website. It should map to the address starting by chr1:43736676 (+ strand). Could anybody let me understand why it is not mappable in blat? -- Regards, Peng _______________________________________________ Genome maillist - [email protected] https://lists.soe.ucsc.edu/mailman/listinfo/genome _______________________________________________ Genome maillist - [email protected] https://lists.soe.ucsc.edu/mailman/listinfo/genome
