Hi Lei, A quick search of NCBI's Blast page turned up your issue. On their blast page (http://blast.ncbi.nlm.nih.gov/Blast.cgi) click the nucleotide blast <http://blast.ncbi.nlm.nih.gov/Blast.cgi?PROGRAM=blastn&BLAST_PROGRAMS=megaBlast&PAGE_TYPE=BlastSearch&SHOW_DEFAULTS=on&LINK_LOC=blasthome> link. Then where it says "Choose Search Set: Database", by default it is set to "Human genomic plus transcript." If you change it to "NCBI Genomes (chromosome)" and re-do the search, it comes up with the same coordinates as us and Ensembl.
If you have any additional questions, please direct them to NCBI: [email protected] Thanks, - Greg Roe UCSC Genome Bioinformatics Group On 10/17/11 12:26 PM, Gu, Lei wrote: > Dear NCBI-BLAST, UCSC genome browser and ensemble, > > I have a following question: > In UCSC genome browser, I used BLAT to search a sequense with assembly > hg19/GRCh37 and got the following genomic position: chr14 + 75740009 > 75740308. > And in ensembl, I used blast to search the same sequence with the same > assembly, got the same genomic position: chr14 + 75740009 75740308 . > But in NCBI-BLAST, I used the genome(reference only) database for searching, > got the genomic position: chr14 + 56740009 56740308. > So would you please tell me why I got different results? > Thank you very much! > The sequence for blast is: >> FOSBS-14 > AAGGTCATGGATGACATGGTGTGACCTCTGCTGAAGATGTCTTAACACCTCGAATCGCGTCATGTGGCAGCTTCTTCTAGCCACCCCTGGCCCTGCACATGGTGATTATGAGATTTTTCTCATTGGATGGGAGCCCTGGAATTGAGGTTTCTTGGGGTGTGTTTTTGTCCTGTAGGTTTAGTGACGTCGACGGGGTTCCTTTGGAATTTCAGCAGCTAAGTCCGCCGGAGCTGCAGAAGGTCAGCTCAGGACATCGGAGGAGCTGACAGCCTGGAGAAGCTGTGCTTGTCTGCTGGTAGG > > Best, > Lei > > _______________________________________________ > Genome maillist - [email protected] > https://lists.soe.ucsc.edu/mailman/listinfo/genome _______________________________________________ Genome maillist - [email protected] https://lists.soe.ucsc.edu/mailman/listinfo/genome
