Hi Gokhul,
The orf and orfStats programs are experimental programs. They were never
published and we don't recommend using them.
The program we use here at the UCSC is txCdsPredict. Here is the usage
statement, which you can see by typing the name of the program at the
command line without any arguments:
txCdsPredict - Somewhat simple-minded ORF predictor using a weighting
scheme.
usage:
txCdsPredict in.fa out.cds
Output is five columns:
mrna name, mrna size, cds start, cds end, score
options:
-nmd=in.bed - Use in.bed to look for evidence of nonsense mediated
decay.
-maf=in.maf - Look for conservation of orf in other species. Beware
each
species is considered independent evidence. Recommend
that you
use maf with just 3-5 well chosen species. For human
a good mix
is human/rhesus/dog/mouse. Use mafFrags and
mafSpeciesSubset to
generate this peculiar maf.
-anyStart - Allow ORFs that begin at first, second, or third bases
in seq as well
as atg
Please contact the mail list ([email protected]) again if you have any
further questions.
Katrina Learned
UCSC Genome Bioinformatics Group
On Tue Nov 15 09:09:37 2011, Kilaru, Gokhul (NIH/NIAID) [C] wrote:
>
> Hello,
>
> This is Gokhul from the National Institutes of Health.
>
> I have a series of sequences in fasta format (200MB file). The first
> two records are given below...
>
>>
>> chr1:11868-12227
>
> GTTAACTTGCCGTCAGCCTTTTCTTTGACCTCTTCTTTCTGTTCATGTGTATTTGCTGTCTCTTAGCCCAGACTTCCCGTGTCCTTTCCACCGGGCCTTTGAGAGGTCACAGGGTCTTGATGCTGTGGTCTTCATCTGCAGGTGTCTGACTTCCAGC
>>
>> chr1:12612-12721
>
> GTGTGTGGTGATGCCAGGCATGCCCTTCCCCAGCATCAGGTCTCCAGAGCTGCAGAAGACGACGGCCGACTTGGATCACACTCTTGTGAGTGTCCCCAGTGTTGCAGAG
>
> When I run the UCSC executables ORF and ORFSTATS, it simply displays
> the command usage instead of running the program.
>
> I am not sure about what the orf.stats and refSeq.cds files.
>
> Could you please help me with this issue?
>
> Thanks in advance.
>
> Regards
> ~Gokhul
>
>
>
> ---
>
> Gokhul K Kilaru,
>
> Computational Biologist,
>
> Integrative Immunobiology Unit, Laboratory of Immunology,
>
> Room No.11N254, Building No.10, 10 Center Drive,
>
> National Institute of Allergy and Infectious Diseases,
>
> National Institutes of Health,
>
> 9000 Rockville Pike,
>
> Bethesda, MD - 20892-1892
>
> Work: 301-451-3246
>
> Fax: 301-480-7352
>
> Mob: 703-944-8311
>
> Medical Science and Computing Inc.(C)
>
> ---
>
>
> The information in this e-mail and any of its attachments is
> confidential and may contain sensitive information. It should not be
> used by anyone who is not the original intended recipient. If you have
> received this e-mail in error please inform the sender and delete it
> from your mailbox or any other storage devices. National Institute of
> Allergy and Infectious Diseases shall not accept liability for any
> statements made that are sender's own and not expressly made on behalf
> of the NIAID by one of its representatives.
>
> _______________________________________________
> Genome maillist - [email protected]
> https://lists.soe.ucsc.edu/mailman/listinfo/genome
_______________________________________________
Genome maillist - [email protected]
https://lists.soe.ucsc.edu/mailman/listinfo/genome
