Hi Pauline,
Thanks a lot for the reply. It's very helpful.
I have a doubt in the starting sequence range for the two coordinates of the
same gene . Even though we have the same coordinates (Upstream sequence) in
BCL2 gene i.e for chr18:60790579-60986613 and chr18:60790579-60986657, the UCSC
genome browser is showing two different sequence for the same start regions.
Please have a look, It would be great if you please let me know the Discrepancy
or probably, may be i am interpreting in a wrong way. Kindly clarify.
I have crossed checked the same with NCBI, where it shows common gene starting
sequence for both co-ordinates.( NCBI Reference Sequence: NG_009361.1 )
Ø >hg19_knownGene_uc002lit.1 range=chr18:60790579-60986613 5'pad=0 3'pad=0
strand=- repeatMasking=none
TTTCTGTGAAGCAGAAGTCTGGGAATCGATCTGGAAATCCTCCTAATTTT
TACTCCCTCTCCCCGCGACTCCTGATTCATTGGGAAGTTTCAAATCAGCT
ATAACTGGAGAGTGCTGAAGATTGATGGGATCGTTGCCTTATGCATTTGT
TTTGGTTTTACAAAAAGGAAACTTGACAGAGGATCATGCTGTACTTAAAA
Ø >hg19_knownGene_uc002liu.1 range=chr18:60790579-60986657 5'pad=0 3'pad=0
strand=- repeatMasking=none
CTCGAGCTCTTGAGATCTCCGGTTGGGATTCCTGCGGATTGACATTTCTG
TGAAGCAGAAGTCTGGGAATCGATCTGGAAATCCTCCTAATTTTTACTCC
CTCTCCCCGCGACTCCTGATTCATTGGGAAGTTTCAAATCAGCTATAACT
GGAGAGTGCTGAAGATTGATGGGATCGTTGCCTTATGCATTTGTTTTGGT
TTTACAAAAAGGAAACTTGACAGAGGATCATGCTGTACTTAAAAAATACA
For your reference i am sending you few reference sequences (splice variants)
wherein its perfectly fine.
I. VEGFA (uc021yzu.1) at chr6:43737946-43754223 - Homo sapiens
vascular endothelial growth factor A (VEGFA), transcript variant 9, mRNA.
II. VEGFA (uc010jyx.3) at chr6:43737946-43754223 - Homo sapiens
vascular endothelial growth factor A (VEGFA), transcript variant 8, mRNA.
III. VEGFA (uc003owk.3) at chr6:43745460-43754223 - Homo sapiens
vascular endothelial growth factor A (VEGFA), transcript variant 6, mRNA.
IV. VEGFA (uc003owj.3) at chr6:43737946-43754223 - Homo sapiens
vascular endothelial growth factor A (VEGFA), transcript variant 6, mRNA.
V. VEGFA (uc003owi.3) at chr6:43737946-43754223 - Homo sapiens
vascular endothelial growth factor A (VEGFA), transcript variant 7, mRNA.
VI. VEGFA (uc003owh.3) at chr6:43737946-43754223 - Homo sapiens
vascular endothelial growth factor A (VEGFA), transcript variant 1, mRNA.
VII. VEGFA (uc003owg.3) at chr6:43737946-43754223 - Homo sapiens
vascular endothelial growth factor A (VEGFA), transcript variant 3, mRNA.
VIII. VEGFA (uc003owf.3) at chr6:43737946-43754223 - Homo sapiens
vascular endothelial growth factor A (VEGFA), transcript variant 2, mRNA.
IX. VEGFA (uc003owe.3) at chr6:43737946-43754223 - Homo sapiens
vascular endothelial growth factor A (VEGFA), transcript variant 4, mRNA.
X. VEGFA (uc003owd.3) at chr6:43737946-43754223 - Homo sapiens
vascular endothelial growth factor A (VEGFA), transcript variant 5, mRNA.
XI. VEGFA (uc003owb.3) at chr6:43737946-43745562 - Homo sapiens
vascular endothelial growth factor A (VEGFA), transcript variant 8, mRNA.
XII. VEGFB (uc001nyx.3) at chr11:64002056-64006736 - Homo sapiens
vascular endothelial growth factor B (VEGFB), transcript variant VEGFB-167,
mRNA.
XIII. VEGFB (uc001nyw.3) at chr11:64002056-64006736 - Homo sapiens
vascular endothelial growth factor B (VEGFB), transcript variant VEGFB-186,
mRNA.
XIV. PDCD10 (uc003fez.3) at chr3:167401695-167452651 - Homo sapiens
programmed cell death 10 (PDCD10), transcript variant 3, mRNA.
XV. PDCD10 (uc003fey.3) at chr3:167401695-167452651 - Homo sapiens
programmed cell death 10 (PDCD10), transcript variant 2, mRNA.
XVI. PDCD10 (uc003fex.3) at chr3:167401695-167452594 - Homo sapiens
programmed cell death 10 (PDCD10), transcript variant 1, mRNA.
Thanks and Regards,
Ateeq M Khaliq
Bioinformatics Division,
Jubilant Biosys Pvt Ltd,
#96, Industrial Suburb, 2nd Stage
Yeshwantpur, Bangalore 560 022
Ph No : +91-80-66628798
From: Ateeq Muhammed Khaliq
Sent: 08 May 2012 PM 04:12
To: '[email protected]'; '[email protected]'
Subject: RE: discrepancy in gene co-ordinates
Hello all,
This is Ateeq, Sr research Associate, from Jubilant Biosys Ltd, Bangalore
India. I have a doubt regarding amplicon design. While designing an amplicon
for certain gene co-ordinate region, I have noticed a discrepancy, which is as
follows
http://genome.ucsc.edu/cgi-bin/hgTracks?hgHubConnect.destUrl=..%2Fcgi-bin%2FhgTracks&clade=mammal&org=Human&db=hg19&position=chr18%3A60790579-60986613&hgt.suggest=BCL2&hgt.suggestTrack=knownGene&Submit=submit&hgsid=262656015&knownGene=pack
Ø For BCL2 gene I got two different nucleotide sequences for the same start
position in UCSC
· For chr18:60790579-60986657 the start sequence obtained was-->
CTCGAGCTCTTGAGATCTCCGGTTGGGATTCCTGCGGATTGACATTTCTG
TGAAGCAGAAGTCTGGGAATCGATCTGGAAATCCTCCTAATTTTTACTCC
http://genome.ucsc.edu/cgi-bin/hgc?hgsid=262656015&g=htcDnaNearGene&i=uc002lit.1&c=chr18&l=60790578&r=60986613&o=knownGene&boolshad.hgSeq.promoter=0&hgSeq.promoterSize=1000&hgSeq.utrExon5=on&boolshad.hgSeq.utrExon5=0&hgSeq.cdsExon=on&boolshad.hgSeq.cdsExon=0&hgSeq.utrExon3=on&boolshad.hgSeq.utrExon3=0&hgSeq.intron=on&boolshad.hgSeq.intron=0&boolshad.hgSeq.downstream=0&hgSeq.downstreamSize=1000&hgSeq.granularity=gene&hgSeq.padding5=0&hgSeq.padding3=0&boolshad.hgSeq.splitCDSUTR=0&hgSeq.casing=exon&boolshad.hgSeq.maskRepeats=0&hgSeq.repMasking=lower&submit=submit
And
· For chr18:60790579-60986613 the start sequence obtained was
TTTCTGTGAAGCAGAAGTCTGGGAATCGATCTGGAAATCCTCCTAATTTT
TACTCCCTCTCCCCGCGACTCCTGATTCATTGGGAAGTTTCAAATCAGCT
http://genome.ucsc.edu/cgi-bin/hgc?hgsid=262656015&g=htcDnaNearGene&i=uc002liu.1&c=chr18&l=60790578&r=60986657&o=knownGene&boolshad.hgSeq.promoter=0&hgSeq.promoterSize=1000&hgSeq.utrExon5=on&boolshad.hgSeq.utrExon5=0&hgSeq.cdsExon=on&boolshad.hgSeq.cdsExon=0&hgSeq.utrExon3=on&boolshad.hgSeq.utrExon3=0&hgSeq.intron=on&boolshad.hgSeq.intron=0&boolshad.hgSeq.downstream=0&hgSeq.downstreamSize=1000&hgSeq.granularity=gene&hgSeq.padding5=0&hgSeq.padding3=0&boolshad.hgSeq.splitCDSUTR=0&hgSeq.casing=exon&boolshad.hgSeq.maskRepeats=0&hgSeq.repMasking=lower&submit=submit
Can you please explain the reason for the same? Is it an error or I am I
interpreting in other ways? Kindly let me know about this.
Thanks and Regards,
Ateeq M Khaliq
Bioinformatics Division,
Jubilant Biosys Pvt Ltd,
#96, Industrial Suburb, 2nd Stage
Yeshwantpur, Bangalore 560 022
Ph No : +91-80-66628798
The information contained in this electronic message and in any attachments to
this message is confidential, legally privileged and intended only for use by
the person or entity to which this electronic message is addressed. If you are
not the intended recipient, and have received this message in error, please
notify the sender and system manager by return email and delete the message and
its attachments and also you are hereby notified that any distribution,
copying, review, retransmission, dissemination or other use of this electronic
transmission or the information contained in it is strictly prohibited. Please
note that any views or opinions presented in this email are solely those of the
author and may not represent those of the Company or bind the Company. Any
commitments made over e-mail are not financially binding on the company unless
accompanied or followed by a valid purchase order. This message has been
scanned for viruses and dangerous content by Mail Scanner, and is believed to
be clean. The Company accepts no liability for any damage caused by any virus
transmitted by this email.
www.jubl.com
_______________________________________________
Genome maillist - [email protected]
https://lists.soe.ucsc.edu/mailman/listinfo/genome
