commit: a2df729d9eae2e016883572c2fbfe941184f421d Author: Martin Mokrejš <mmokrejs <AT> fold <DOT> natur <DOT> cuni <DOT> cz> AuthorDate: Tue Jan 31 16:44:12 2017 +0000 Commit: Martin Mokrejs <mmokrejs <AT> fold <DOT> natur <DOT> cuni <DOT> cz> CommitDate: Tue Jan 31 16:44:12 2017 +0000 URL: https://gitweb.gentoo.org/proj/sci.git/commit/?id=a2df729d
sci-biology/trf-bin: renamed to reflect it is an upstream's binary A lot of fixes in the ebuild as well: - install snapshot copies of HTML docs to prevent checksum errors - properly set MY_PV version number - fix install location - distinguish between 32 and 64bit binaries Package-Manager: Portage-2.3.3, Repoman-2.3.1 sci-biology/trf-bin/files/trf.definitions.txt | 159 +++++++++++++++++ sci-biology/trf-bin/files/trf.txt | 176 +++++++++++++++++++ sci-biology/trf-bin/files/trf.whatsnew.txt | 243 ++++++++++++++++++++++++++ sci-biology/trf-bin/metadata.xml | 8 + sci-biology/trf-bin/trf-bin-4.09.ebuild | 53 ++++++ 5 files changed, 639 insertions(+) diff --git a/sci-biology/trf-bin/files/trf.definitions.txt b/sci-biology/trf-bin/files/trf.definitions.txt new file mode 100644 index 0000000..ddedf76 --- /dev/null +++ b/sci-biology/trf-bin/files/trf.definitions.txt @@ -0,0 +1,159 @@ + [1][trflogo.png] + + + +FASTA Format: + + The FASTA format is a plain text format which looks something like + this: + + >myseq + AGTCGTCGCT AGCTAGCTAG CATCGAGTCT TTTCGATCGA GGACTAGACT TCTAGCTAGC + TAGCATAGCA TACGAGCATA TCGGTCATGA GACTGATTGG GCTTTAGCTA GCTAGCATAG + CATACGAGCA TATCGGTAGA CTGATTGGGT TTAGGTTACC + + The first line starts with a greater than sign ">" and contains a name + or other identifier for the sequence. This is the sequence header and + must be in a single line. The remaining lines contain the sequence + data. The sequence can be in upper or lower case letters. Anything + other than letters (numbers for example) is ignored. Multiple sequences + can be present in the same file as long as each sequence has its own + header. + +Table Explanation: + + The summary table includes the following information: + 1. Indices of the repeat relative to the start of the sequence. + 2. Period size of the repeat. + 3. Number of copies aligned with the consensus pattern. + 4. Size of consensus pattern (may differ slightly from the period + size). + 5. Percent of matches between adjacent copies overall. + 6. Percent of indels between adjacent copies overall. + 7. Alignment score. + 8. Percent composition for each of the four nucleotides. + 9. Entropy measure based on percent composition. + + If the output contains more than 120 repeats, multiple linked tables + are produced. The links to the other tables appear at the top and + bottom of each table. + + Note: If you save multiple linked summary table files, use the default + names supplied by your browser to preserve the automatic linking. + +Alignment Explanation: + + The alignment is presented as follows: + 1. In each pair of lines, the actual sequence is on the top and a + consensus sequence for all the copies is on the bottom. + 2. Each pair of lines is one period except for very small patterns. + 3. The 10 sequence characters before and after a repeat are shown. + 4. Symbol * indicates a mismatch. + 5. Symbol - indicates an insertion or deletion. + 6. Statistics refers to the matches, mismatches and indels overall + between adjacent copies in the sequence, not between the sequence + and the consensus pattern. + 7. Distances between matching characters at corresponding positions + are listed as distance, number at that distance, percentage of all + matches. + 8. ACGTcount is percentage of each nucleotide in the repeat sequence. + 9. Consensus sequence is shown by itself. + 10. If chosen as an option, 500 characters of flanking sequence on each + side of the repeat are shown. + + Note: If you save the alignment file, use the default name supplied by + your browser to preserve the automatic cross-referencing with the + summary table. + +Program Parameters: + + Input to the program consists of a sequence file and the following + parameters: + 1. Alignment Parameters. Weights for match, mismatch and indels. These + parameters are for Smith-Waterman style local alignment using + wraparound dynamic programming. Lower weights allow alignments with + more mismatches and indels. Match weight is +2 in all options here. + Mismatch and indel weights (interpreted as negative numbers) are + either 3, 5, or 7. A 3 is more permissive and a 7 less permissive + of these types of alignments choices. + 2. Minimum Alignment Score. The alignment score must meet or exceed + this value for the repeat to be reported. + 3. Maximum Period Size. The period size must be no larger than this + value for the repeat to be reported. Period size is the programs + best guess at the pattern size of the tandem repeat. The program + will find all repeats with period size between 1 and 2000. + 4. Maximum TR array size. Specifies the longest TR array (the complete + repeating sequence) expected to be found in the input, in millions + of base pairs. Some sequences have very long TR arrays, such as + chromosome 18 in HG38 which has an array measuring over 5.3 million + base pairs. + 5. Detection Parameters. Matching probability Pm and indel probability + Pi. Pm = .80 and Pi = .10 by default and cannot be modified in this + version of the program. + +Options: + + 1. Flanking sequence. Flanking sequence consists of the 500 + nucleotides on each side of a repeat. Flanking sequence is recorded + in the alignment file. This may be useful for PCR primer + determination. + 2. Masked Sequence File. The masked sequence file is a [2]FASTA format + file containing a copy of the sequence with every character that + occurred in a tandem repeat changed to the letter 'N'. The word + "masked" is added to the sequence description line just after the + '>' character. + 3. Data File. The data file is a text file which contains the same + information, in the same order, as the repeat [3]table file, plus + consensus and repeat sequences. This file contains no labeling and + is suitable for additional processing, for example with a perl + script, outside of the program. + + + + [4][USEMAP:buttonarrow.png] [5]Home + + [6][USEMAP:buttonarrow.png] [7]What's New + + [8][USEMAP:buttonarrow.png] [9]Submit Page + + [10][USEMAP:buttonarrow.png] [11]Downloads + + + + __________________________________________________________________ + + [12][bu.gif] Last revised February 22, 2016 + Send any questions or comments to: + [13]Yozen Hernandez + +References + + 1. http://tandem.bu.edu/trf/trf.html + 2. http://tandem.bu.edu/trf/trf.definitions.html#fasta + 3. http://tandem.bu.edu/trf/trf.definitions.html#table + 4. LYNXIMGMAP:http://tandem.bu.edu/trf/trf.definitions.html#FPMap0 + 5. http://tandem.bu.edu/trf/trf.html + 6. LYNXIMGMAP:http://tandem.bu.edu/trf/trf.definitions.html#FPMap3 + 7. http://tandem.bu.edu/trf/trf.whatnew.html + 8. LYNXIMGMAP:http://tandem.bu.edu/trf/trf.definitions.html#FPMap1 + 9. http://tandem.bu.edu/trf/trf.submit.options.html + 10. LYNXIMGMAP:http://tandem.bu.edu/trf/trf.definitions.html#FPMap2 + 11. http://tandem.bu.edu/trf/trf.download.html + 12. http://www.bu.edu/ + 13. javascript:spamGuard('yhernand','bu.edu') + +[USEMAP] +http://tandem.bu.edu/trf/trf.definitions.html#FPMap2 + 1. http://tandem.bu.edu/trf/trf.download.html + +[USEMAP] +http://tandem.bu.edu/trf/trf.definitions.html#FPMap1 + 1. http://tandem.bu.edu/trf/trf.submit.options.html + +[USEMAP] +http://tandem.bu.edu/trf/trf.definitions.html#FPMap3 + 1. http://tandem.bu.edu/trf/trf.whatnew.html + +[USEMAP] +http://tandem.bu.edu/trf/trf.definitions.html#FPMap0 + 1. http://tandem.bu.edu/trf/trf.html diff --git a/sci-biology/trf-bin/files/trf.txt b/sci-biology/trf-bin/files/trf.txt new file mode 100644 index 0000000..f75ec5f --- /dev/null +++ b/sci-biology/trf-bin/files/trf.txt @@ -0,0 +1,176 @@ + [1][trflogo.png] + + +Using Command Line Version of Tandem Repeats Finder + + Once the program is installed you can run it with no parameters to + obtain information on proper usage syntax. + + If you installed the program as trf then by typing trf at the command + line you will see the following output: + +Please use: trf File Match Mismatch Delta PM PI Minscore MaxPeriod [options] + +Where: (all weights, penalties, and scores are positive) + File = sequences input file + Match = matching weight + Mismatch = mismatching penalty + Delta = indel penalty + PM = match probability (whole number) + PI = indel probability (whole number) + Minscore = minimum alignment score to report + MaxPeriod = maximum period size to report + [options] = one or more of the following: + -m masked sequence file + -f flanking sequence + -d data file + -h suppress html output + -r no redundancy elimination + -l <n> maximum TR length expected (in millions) (eg, -l 3 or -l=3 for + 3 million) + +Note the sequence file should be in FASTA format: + +>Name of sequence +aggaaacctgccatggcctcctggtgagctgtcctcatccactgctcgctgcctctccag +atactctgacccatggatcccctgggtgcagccaagccacaatggccatggcgccgctgt +actcccacccgccccaccctcctgatcctgctatggacatggcctttccacatccctgtg + + + The program accepts a minimum of eight parameters. Options can be + specified to generate additional files. + + The following is a more detailed description of the parameters: + * File: The sequence file to be analyzed in FASTA format( [2]see for + details). Multiple sequence in the same file are allowed. + * Match, Mismatch, and Delta: Weights for match, mismatch and indels. + These parameters are for Smith-Waterman style local alignment using + wraparound dynamic programming. Lower weights allow alignments with + more mismatches and indels. A match weight of 2 has proven + effective with mismatch and indel penalties in the range of 3 to 7. + Mismatch and indel weights are interpreted as negative numbers. A 3 + is more permissive and a 7 less permissive. The recomended values + for Match Mismatch and Delta are 2, 7, and 7 respectively. + * PM and PI: Probabilistic data is available for PM values of 80 and + 75 and PI values of 10 and 20. The best performance can be achieved + with values of PM=80 and PI=10. Values of PM=75 and PI=20 give + results which are very similar, but often require as much as ten + times the processing time when compared with values of PM=80 and + PI=10. + * Minscore: The alignment of a tandem repeat must meet or exceed this + alignment score to be reported. For example, if we set the matching + weight to 2 and the minimun score to 50, assuming perfect + alignment, we will need to align at least 25 characters to meet the + minimum score (for example 5 copies with a period of size 5). + * Maxperiod: Period size is the program's best guess at the pattern + size of the tandem repeat. The program will find all repeats with + period size between 1 and 2000, but the output can be limited to a + smaller range. + * -m: This is an optional parameter and when present instructs the + program to generate a masked sequence file. The masked sequence + file is a FASTA format file containing a copy of the sequence with + every location that occurred in a tandem repeat changed to the + letter 'N'. The word "masked" is added to the sequence description + line just after the '>' character. + * -f: If this option is present, flanking sequence around each repeat + is recorded in the alignment file. This may be useful for PCR + primer determination. Flanking sequence consists of the 500 + nucleotides on each side of a repeat. + * -d: A data file is produced if this option is present. This file is + a text file which contains the same information, in the same order, + as the summary table file, plus consensus pattern and repeat + sequences. This file contains no labeling and is suitable for + additional processing, for example with a perl script, outside of + the program. + * -h: suppress HTML output (this automatically switches -d to ON) + * -l <n>: Specifies that the longest TR array expected in the input + is at most n million bp long. The default is 2 (for 2 million). + Setting this option too high may result in an error message if you + did not have enough availablememory. We have only tested this + option uo to value 29. + * -u: Prints the help/usage message above + * -v: Prints the version information + * -ngs: More compact .dat output on multisequence files, returns 0 on + success. You may pipe input in with this option using - for file + name. Short 50 flanks are appended to .dat output. .dat output + actually goes to stdout instead of file. Sequence headers are + displayed in output as @header. Only headers containing repeats are + shown. + + Using recommended parameters the command line will look something like: + trf yoursequence.txt 2 7 7 80 10 50 500 -f -d -m + + Once the program starts running it will print update messages to the + screen. The word "Done" will be printed when the program finishes. + + For single sequence input files there will be at least two HTML format + output files, a repeat table file and an alignment file. If the number + of repeats found is greater than 120, multiple linked repeat tables are + produced. The links to the other tables appear at the top and the + bottom of each table. To view the results start by opening the first + repeat table file with your web browser. This file has the extension + ".1.html". Alignment files can be accessed from the repeat table files. + Alignment files end with the ".txt.html" extension. + + For input files containing multiple sequences a summary page is + produced that links to the output of individual sequences. This file + has the extension "summary.html". You should start by opening this file + if your input had multiple sequences in the same file. Also note that + the output files of individual sequences will have an identifier of the + form ".sn." ( n an integer) embedded in the name indicating the index + of the sequence in the input file. The identifier is omitted for single + sequence input files. + + For more information on the output please see [3]Table Explanation and + [4]Alignment Explanation. + + + + + [5][USEMAP:buttonarrow.png] [6]Home + + [7][USEMAP:buttonarrow.png] [8]What's New + + [9][USEMAP:buttonarrow.png] [10]Submit Page + + [11][USEMAP:buttonarrow.png] [12]Downloads + + + __________________________________________________________________ + + [13][bu.gif] Last revised September 11, 2003 + Send any questions or comments to: + [14]Yozen Hernandez + +References + + 1. http://tandem.bu.edu/trf/trf.html + 2. http://tandem.bu.edu/trf/trf.definitions.html#fasta + 3. http://tandem.bu.edu/trf/trf.definitions.html#table + 4. http://tandem.bu.edu/trf/trf.definitions.html#alignment + 5. LYNXIMGMAP:http://tandem.bu.edu/trf/trf.unix.help.html#FPMap0 + 6. http://tandem.bu.edu/trf/trf.html + 7. LYNXIMGMAP:http://tandem.bu.edu/trf/trf.unix.help.html#FPMap3 + 8. http://tandem.bu.edu/trf/trf.whatnew.html + 9. LYNXIMGMAP:http://tandem.bu.edu/trf/trf.unix.help.html#FPMap1 + 10. http://tandem.bu.edu/trf/trf.submit.options.html + 11. LYNXIMGMAP:http://tandem.bu.edu/trf/trf.unix.help.html#FPMap2 + 12. http://tandem.bu.edu/trf/trf.download.html + 13. http://www.bu.edu/ + 14. javascript:spamGuard('yhernand','bu.edu') + +[USEMAP] +http://tandem.bu.edu/trf/trf.unix.help.html#FPMap2 + 1. http://tandem.bu.edu/trf/trf.download.html + +[USEMAP] +http://tandem.bu.edu/trf/trf.unix.help.html#FPMap1 + 1. http://tandem.bu.edu/trf/trf.submit.options.html + +[USEMAP] +http://tandem.bu.edu/trf/trf.unix.help.html#FPMap3 + 1. http://tandem.bu.edu/trf/trf.whatnew.html + +[USEMAP] +http://tandem.bu.edu/trf/trf.unix.help.html#FPMap0 + 1. http://tandem.bu.edu/trf/trf.html diff --git a/sci-biology/trf-bin/files/trf.whatsnew.txt b/sci-biology/trf-bin/files/trf.whatsnew.txt new file mode 100644 index 0000000..8967a7d --- /dev/null +++ b/sci-biology/trf-bin/files/trf.whatsnew.txt @@ -0,0 +1,243 @@ + [1][trflogo.png] + + +[newspaper.png] What's New? + +New For Version 4.09 (Feb 22, 2016) + + [checkmark.png] new -l/-L flag allows the user to specify the length of + the longest expected TR array in the input sequence, in millions. The + default value is 2, for 2 million bp. For HG38, a value of 6 is + necessary. + + Example usage: +trf409.linux64.exe hg38.fasta 2 5 7 80 10 50 2000 -l 6 + + [checkmark.png] Setting a sufficiently high value may result in a + crash, very long execution time, or a sharp drop in available memory on + your system. We have only tested up to a value of 25. + + [checkmark.png] For workloads requiring over 3GB of RAM (any value of + -l above 5), the 32-bit builds cannot be used. + + [checkmark.png] New -v/-V flag allows you to quickly check your version + of TRF. + + [checkmark.png] New -u/-U flag allows you to quickly display the usage + help text. + + +New For Version 4.07b + + [checkmark.png] new -ngs flag allows more compact output and piping of + input on linux systems, returns standard linux exit value of 0 on + success + + [checkmark.png] temporary output is no longer written to disk + + [checkmark.png] changed alignment to go further when score drops to 0 + on first pass, more repeats are reported now + + [checkmark.png] fixed bestlist structure deallocations, this + significantly improves run speed on multi-sequence fasta files + + [checkmark.png] fixed line in alignment files "file K of N", K was off + by 1 before + + [checkmark.png] Added check to make sure all required parameters are + entered from the commandline + + +New For Version 4.04 + + [checkmark.png] Widened radius of narrowband alignment to avoid losing + alignment in some cases + + +New For Version 4.03 + + [checkmark.png] Added -R switch to produce output without redundancy if + desired + + [checkmark.png] Fixed a bug in the redundancy algorithm which sometimes + caused repeats to vanish + + [checkmark.png] Fixed a bug when N characters being part of pattern + cause problems + + +New For Version 4.00 + + [checkmark.png] Improved longer period detection and period 1 detection + + [checkmark.png] Improved alignment + + [checkmark.png] Added a flag to suppress HTML output (-h) + + [checkmark.png] Fixed a loading sequence problem with incomplete FASTA + format files + + [checkmark.png] Increased minimum period for larger repeats from 1.9 to + 1.8 (patternsize > 50) + + [checkmark.png] Added Linux GUI version (GTK+) + + +New For Version 3.21 + + [checkmark.png] Fixed Sequence Name Bug: This bug affected the parsing + of FASTA header on Windows versions of the program. The bug caused the + program to report a sequence name that had a control character appended + at the end and a missing parameters line in the output data file. This + bug surfaced as a result of version 3.20 fixes. + + +New For Version 3.20 + + [checkmark.png] Improved Redundancy Control: We have improved the + program's ability to remove redundant versions of the same tandem + repeat. On earlier versions certain conditions could cause the + algorithm to leave a redundant version in the output. The new version + properly identifies these and removes them. + + [checkmark.png] Improved End-of-Line Identification: Different + operating systems use different conventions for end of line (EOL) + character sequence in text files. We have made improvements in the + routines that allows TRF to read sequence text from files using various + EOL conventions. + + [checkmark.png] Fixed Memory Overrun Bug: We have corrected a problem + where some large-pattern, low-scoring repeats could cause a memory + fault in previous versions. Thanks to Angie Hinrichs at UC Santa Cruz's + Genome Bioinformatics group for the bug report and the offending + sequence. + + + +Previous Update (Version 3.01) + + [checkmark.png] Unlimited Sequence Size: We have eliminated the + sequence size restriction of previous versions. In this version you are + only limited by the memory available in your system. + + [checkmark.png] Multi-Sequence Files: The program handles files + containing multiple sequences. Each sequence must contain its own FASTA + header. A summary page is produced which links to the results of + individual sequences. + + [checkmark.png] Data File Includes Repeat Sequence: We now include + complete repeat sequence for each repeat record reported in the data + file. + + [checkmark.png] Smaller Scores: The downloadable versions of the + program are now able to report matches with scores as low as 20. We + recommend caution when using this feature since very large output files + can be generated at this score level. + + [checkmark.png] Longer Patter Sizes: The program finds repeats with + period size as large as 2000 base pairs. + + [checkmark.png] New File Naming Convention: For input files containing + a single sequence the naming convention for output files has not been + changed. For input files containing multiple sequences a summary page + is produced. This file has the extension "summary.html" and contains + links to the repeat tables of the individual sequences. In the name of + each of those repeat tables and their alignment files, an additional + identifier ".sn." ( n an integer, for example: ".s3.") has been + inserted before the parameters to indicate the sequence index in the + input file. + + [checkmark.png] Repeat Table Changes: Each table now shows the total + number of repeats found in the sequence and links to other tables have + been added at the bottom of the page. + + [checkmark.png] Longer Flanking Sequence: 500 characters of flanking + sequence on each side of the repeat are now reported. + + + Previous Update (Version 2.02) + + [checkmark.png] Multiple Repeat Tables: If the output contains more + than 140 repeats, multiple linked repeat tables and alignment files + will be produced. This will speed downloading time and overcome + problems with tables too big for web browsers to format. + + [checkmark.png] Consensus Sequence: The program prints the consensus + sequence for each repeat in the alignment file, below the alignment. + + [checkmark.png] Flanking Sequence: As an option, the program prints 200 + characters of flanking sequence from each side of the repeat. This may + be useful for PCR primer determination. Find it in the alignment file. + + [checkmark.png] Masked Sequence File: As an option, the program returns + a copy of the original sequence with the tandem repeats "masked" out. + The masked sequence file is a [2]FASTA format file with every tandem + repeat character changed to the letter 'N'. The word "masked" is added + to the sequence description line just after the '>' character. + + [checkmark.png] Data File: As an option, the program returns a text + file containing the same data, in the same order, as the summary table + file, plus consensus sequences, but without any labels or formatting + instructions. This file is suitable for automated processing, for + example with a perl script. + + [checkmark.png] Select Parameters: Now you can select parameters when + you submit a sequence, or simply use the default parameters. Visit the + [3]Submit Options Page for more details. + + [checkmark.png] Sequence Alphabet: The program now handles sequences + containing letter other than A, C, G, and T. + + [checkmark.png] Enhanced Alignment File: We have modified the + presentation of the alignment file. The output should be easier to view + and print. + + [checkmark.png] Automatic Redundancy Removal: The program now reports + only the smallest period size for a repeat unless a larger period size + has a significantly higher score. + + [checkmark.png] Windows Version Now Available: A Windows version of the + program is now available for download. This version of the the program + can be run under Windows 95/98 and Windows NT 4. Please visit our + [4]Download Page for more details. + + + + + [5][USEMAP:buttonarrow.png] [6]Home + + [7][USEMAP:buttonarrow.png] [8]Submit Page + + [9][USEMAP:buttonarrow.png] [10]Downloads + __________________________________________________________________ + + [11][bu.gif] Last revised February 22, 2016 + Send any questions or comments to: + [12]Yozen Hernandez + +References + + 1. http://tandem.bu.edu/trf/trf.html + 2. http://tandem.bu.edu/trf/trf.definitions.html#fasta + 3. http://tandem.bu.edu/trf/trf.submit.options.html + 4. http://tandem.bu.edu/trf/trf.download.html + 5. LYNXIMGMAP:http://tandem.bu.edu/trf/trf.whatnew.html#FPMap0 + 6. http://tandem.bu.edu/trf/trf.html + 7. LYNXIMGMAP:http://tandem.bu.edu/trf/trf.whatnew.html#FPMap1 + 8. http://tandem.bu.edu/trf/trf.submit.options.html + 9. LYNXIMGMAP:http://tandem.bu.edu/trf/trf.whatnew.html#FPMap2 + 10. http://tandem.bu.edu/trf/trf.download.html + 11. http://www.bu.edu/ + 12. javascript:spamGuard('yhernand','bu.edu') + +[USEMAP] +http://tandem.bu.edu/trf/trf.whatnew.html#FPMap2 + 1. http://tandem.bu.edu/trf/trf.download.html + +[USEMAP] +http://tandem.bu.edu/trf/trf.whatnew.html#FPMap1 + 1. http://tandem.bu.edu/trf/trf.submit.options.html + +[USEMAP] +http://tandem.bu.edu/trf/trf.whatnew.html#FPMap0 + 1. http://tandem.bu.edu/trf/trf.html diff --git a/sci-biology/trf-bin/metadata.xml b/sci-biology/trf-bin/metadata.xml new file mode 100644 index 0000000..959160f --- /dev/null +++ b/sci-biology/trf-bin/metadata.xml @@ -0,0 +1,8 @@ +<?xml version="1.0" encoding="UTF-8"?> +<!DOCTYPE pkgmetadata SYSTEM "http://www.gentoo.org/dtd/metadata.dtd";> +<pkgmetadata> + <maintainer type="project"> + <email>[email protected]</email> + <name>Gentoo Biology Project</name> + </maintainer> +</pkgmetadata> diff --git a/sci-biology/trf-bin/trf-bin-4.09.ebuild b/sci-biology/trf-bin/trf-bin-4.09.ebuild new file mode 100644 index 0000000..11fae9c --- /dev/null +++ b/sci-biology/trf-bin/trf-bin-4.09.ebuild @@ -0,0 +1,53 @@ +# Copyright 1999-2017 Gentoo Foundation +# Distributed under the terms of the GNU General Public License v2 +# $Id$ + +EAPI=6 + +inherit eutils + +MY_PV="${PV/.}" # drop the dot +MY_PN="trf" +MY_P="trf${MY_PV}" + +DESCRIPTION="Tandem Repeats Finder" +HOMEPAGE="http://tandem.bu.edu/trf/trf.html"; +SRC_URI="x86? ( http://tandem.bu.edu/trf/downloads/${MY_P}.linux32 ) + amd64? ( http://tandem.bu.edu/trf/downloads/${MY_P}.linux64 )" + +LICENSE="trf" # http://tandem.bu.edu/trf/trf.license.html +SLOT="0" +KEYWORDS="~amd64 ~x86" +RESTRICT="mirror bindist" + +S="${WORKDIR}" + +QA_PREBUILT="opt/${MY_PN}/.*" + +src_unpack() { + if use x86; then + cp "${DISTDIR}/${MY_P}".linux32 "${S}/${MY_PN}" || die + elif use amd64; then + cp "${DISTDIR}/${MY_P}".linux64 "${S}/${MY_PN}" || die + else + eerror "Unsupported platform, check http://tandem.bu.edu/trf/downloads/"; + fi + default +} + +src_install() { + exeinto /opt/"${MY_PN}"/bin + doexe "${MY_PN}" + # GTK version (http://tandem.bu.edu/trf/downloads/trf400.linuxgtk.exe) has broken linking + #if use gtk; then + # doexe trf400.linuxgtk.exe + # make_desktop_entry /opt/${PN}/trf400.linuxgtk.exe "Tandem Repeats Finder" || die + #fi + # http://tandem.bu.edu/trf/trf.unix.help.html + # http://tandem.bu.edu/trf/trf.definitions.html + # http://tandem.bu.edu/trf/trf.whatnew.html + dodoc \ + "${FILESDIR}/"trf.txt \ + "${FILESDIR}/"trf.definitions.txt \ + "${FILESDIR}/"trf.whatsnew.txt +}
