I wanted to build a minimal syntax highlighting for fasta files. Such files are used commonly in biology/bioinformatics and may look like this:
``` >Description of first element TAGCGACTACGACTACGATCAGCATCTACGAT >Description of second element TGAGCTACGACGTGAGCGGGGAGCGGCGCCTAG ``` I wanted to highlight the description lines and thought that marking it as "comment" should work. However, it looks like it is not possible to use `>` as character for a comment. /home/myuser/.config/geany/filedefs/filetypes.Fasta.conf: ``` [styling=Conf] [settings] lexer_filetype=Conf extension=fasta comment_single=> ``` The `filetype_extensions.conf` was adjusted accordingly and the *.fasta files are recognized as Fasta files according to the menu `Document` -> `Set filetype` This does not work as intended. Lines starting with `#` or `;` are highlighted as comments, but lines starting with `>` are not. Did I do anything wrong? Could you please help me with this (seemingly simple) issue? -- You are receiving this because you are subscribed to this thread. Reply to this email directly or view it on GitHub: https://github.com/geany/geany/issues/1240
