I wanted to build a minimal syntax highlighting for fasta files. Such files are 
used commonly in biology/bioinformatics and may look like this:

```
>Description of first element
TAGCGACTACGACTACGATCAGCATCTACGAT

>Description of second element
TGAGCTACGACGTGAGCGGGGAGCGGCGCCTAG
```

I wanted to highlight the description lines and thought that marking it as 
"comment" should work. However, it looks like it is not possible to use `>` as 
character for a comment.

/home/myuser/.config/geany/filedefs/filetypes.Fasta.conf:
```
[styling=Conf]

[settings]
lexer_filetype=Conf
extension=fasta

comment_single=>
```

The `filetype_extensions.conf` was adjusted accordingly and the *.fasta files 
are recognized as Fasta files according to the menu `Document` -> `Set filetype`

This does not work as intended. Lines starting with `#` or `;` are highlighted 
as comments, but lines starting with `>` are not.

Did I do anything wrong? Could you please help me with this (seemingly simple) 
issue?

-- 
You are receiving this because you are subscribed to this thread.
Reply to this email directly or view it on GitHub:
https://github.com/geany/geany/issues/1240

Reply via email to