I tried the same thing on my box, and indeed the version that isn't strict in the rand function outperforms the original by a fair margin, and seems to do slightly better than my own as well. Killing the bangs in the unroll function also seems to help (especially that in (s!, Just r')). Why this is is slightly beyond me at the moment. Killing the bang before the b in the choose function also adds a speedup, which makes perfect sense, as there's no reason to force strictness on an argument you're throwing away a good span of the time. The bang before the k in the look function should stay -- in fact, it seems the appropriate place to force the evaluation that we were forcing too early in some of the other functions. Ditto the bang before the g in unfold. As for the bangs in writeFasta, better to leave them be and not risk messing things up, since, as is, the writeFasta function uses nearly no cycles compared to random generation.

At this point, given that lazier random generation seems to be better, using unboxed types for this seems a losing idea, as they'd force strictness all over again, so that's not worth trying to salvage.

I'm still curious if the pre-calculation of partial sums that I did works well across processors, as I don't see why it shouldn't. My less-strictified version of Don's code is attached, and below are the functions you'll need to insert/replace to make the partial-sums optimization work.

Regards,
Sterl

P.S., if you're running on a unix, I find it much more convenient to use the time program rather than rolling timing into my own code. I tested this program using, for example > time ./fastaRefUnStrict 250000 | tail

Attachment: fastaRefUnStrict.hs
Description: Binary data


--

Code for partial sums:

choose :: [(Word8,Float)] -> Float -> Word8
choose [(b,_)]       _ = b
choose ((b,f):xs) p = if p < f then b else choose xs p

makeCumul :: [(Word8,Float)]->[(Word8,Float)]
makeCumul freqMap = tail . reverse . foldl' fm [(undefined,0)] $ freqMap
    where fm acc@((_,ct):rst) (w,f) = (w,ct + f) : acc

iubs :: [(Word8,Float)]
iubs = makeCumul $ map (first c2w)
        [('a',0.27),('c',0.12),('g',0.12),('t',0.27),('B',0.02)
        ,('D',0.02),('H',0.02),('K',0.02),('M',0.02),('N',0.02)
        ,('R',0.02),('S',0.02),('V',0.02),('W',0.02),('Y',0.02)]

homs :: [(Word8,Float)]
homs = makeCumul $ map (first c2w)
        [('a',0.3029549426680),('c',0.1979883004921)
        ,('g',0.1975473066391),('t',0.3015094502008)]

On Nov 27, 2007, at 2:09 PM, Richard Kelsall wrote:

Simon Peyton-Jones wrote:
| Something I found with Dons version on my machine was that if I removed | all the exclamation marks and the -fbang-patterns bit at the top it went | about 20% faster as well as being much cleaner code, but with my very | rudimentary understanding of Haskell I wasn't entirely sure it would | produce the same results if I did this and didn't get round to checking. If, after investigation (and perhaps checking with Don) you find that adding bangs makes your program go slower, even though the function is in fact strict (otherwise it might go slower because it's just doing more work!) then I'd love to see a test case.

Sorry, I don't understand the code, I've jumped in the deep-end before
learning to swim, but I can now tell you it's producing the same results when I remove some of the exclamation marks. I've checked with an MD5 on
the output.

The timings in seconds for 10,000,000 iterations averaged over 5 runs.
(There was quite a bit of variation.) Compiled with GHC 6.6.1. (I got
stuck compiling it under 6.8) The fancy compile options are from the
shootout page.

Dons original program      13.26    compiled ghc --make
Dons original program      12.54    compiled with -O -fglasgow-exts
                                       -optc-mfpmath=sse -optc-msse2
                                       -optc-march=pentium4
Removed 3 bangs from rand  11.47    compiled ghc --make
Removed 3 bangs from rand  11.57    compiled with -O -fglasgow-exts
                                       -optc-mfpmath=sse -optc-msse2
                                       -optc-march=pentium4

The code below is Dons program from

http://shootout.alioth.debian.org/gp4/benchmark.php? test=fasta&lang=ghc&id=0

with a timing function added by me. The rand function is where I removed three exclamation marks to make the program faster. Previously I removed
different combinations of bangs. Some bangs seem to make it faster and
some seem to make it slower.

Richard.



------------------------------------------------------------------
{-# OPTIONS -O2 -optc-O2 -optc-ffast-math -fbang-patterns -fexcess- precision #-}
--
-- The Computer Language Benchmarks Game
-- http://shootout.alioth.debian.org/
--
-- Contributed by Don Stewart
-- A lazy bytestring solution.
--
-- Add:
-- -optc-mfpmath=sse -optc-msse2
--

import System
import Data.Word
import Control.Arrow

import Text.Printf     -- RK added.
import System.CPUTime  -- RK added.

import qualified Data.ByteString.Lazy as L
import qualified Data.ByteString.Lazy.Char8 as C (pack,unfoldr)
import qualified Data.ByteString as S
import Data.ByteString.Base


-- RK added this time function.
time :: IO t -> IO t
time a = do
    start <- getCPUTime
    v <- a
    end   <- getCPUTime
    let diff = (fromIntegral (end - start)) / (10 ^12)
    printf "Calc time %0.3f \n" (diff :: Double)
    return v


main = do         -- RK modified main to time the computation.
    time $ comp   -- RK mod.

comp :: IO Int    -- RK mod.
comp = do -- RK mod. This was Dons main. I just renamed to comp.
    n <- getArgs >>= readIO . head
    writeFasta  "ONE"   "Homo sapiens alu"       (n*2) (L.cycle alu)
    g <- unfold "TWO"   "IUB ambiguity codes"    (n*3) (look iubs) 42
    unfold      "THREE" "Homo sapiens frequency" (n*5) (look homs) g

---------------------------------------------------------------------- --
--
-- lazily unfold the randomised dna sequences
--

unfold l t n f !g = putStrLn (">" ++ l ++ " " ++ t) >> unroll f g n

unroll :: (Int -> (Word8, Int)) -> Int -> Int -> IO Int
unroll f = loop
    where
        loop r 0   = return r
        loop !r !i = case S.unfoldrN m (Just . f) r of
                        (!s, Just r') -> do
                            S.putStrLn s
                            loop r' (i-m)
          where m = min i 60

look ds !k = let (d,j) = rand k in (choose ds d, j)

choose :: [(Word8,Float)] -> Float -> Word8
choose [(b,_)]       _ = b
choose ((!b,!f):xs) !p = if p < f then b else choose xs (p-f)

---------------------------------------------------------------------- --
--
-- only demand as much of the infinite sequence as we require

writeFasta label title n s = do
     putStrLn $ ">" ++ label ++ " " ++ title
     let (t:ts) = L.toChunks s
     go ts t n
  where
     go ss !s !n
| l60 && n60 = S.putStrLn l >> go ss r (n-60) | n60 = S.putStr s >> S.putStrLn a >> go (tail ss) b (n-60)
        | n <= ln    = S.putStrLn (S.take n s)
| otherwise = S.putStr s >> S.putStrLn (S.take (n-ln) (head ss))
        where
            !ln   = S.length s
            !l60  = ln >= 60
            !n60  = n  >= 60
            (l,r) = S.splitAt 60 s
            (a,b) = S.splitAt (60-ln) (head ss)

---------------------------------------------------------------------- --

im  = 139968
ia  = 3877
ic  = 29573

rand :: Int -> (Float, Int)
rand seed = (newran,newseed)                 -- RK modified. Was !seed
    where
        newseed = (seed * ia + ic) `rem` im  -- RK mod. Was !newseed
newran = 1.0 * fromIntegral newseed / imd -- RK. Was ! newran
        imd      = fromIntegral im

---------------------------------------------------------------------- --

alu = C.pack
        "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG\
        \GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA\
        \CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT\
        \ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA\
        \GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG\
        \AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC\
        \AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA"

iubs = map (c2w *** id)
        [('a',0.27),('c',0.12),('g',0.12),('t',0.27),('B',0.02)
        ,('D',0.02),('H',0.02),('K',0.02),('M',0.02),('N',0.02)
        ,('R',0.02),('S',0.02),('V',0.02),('W',0.02),('Y',0.02)]

homs = map (c2w *** id)
        [('a',0.3029549426680),('c',0.1979883004921)
        ,('g',0.1975473066391),('t',0.3015094502008)]

_______________________________________________
Haskell-Cafe mailing list
[email protected]
http://www.haskell.org/mailman/listinfo/haskell-cafe

_______________________________________________
Haskell-Cafe mailing list
[email protected]
http://www.haskell.org/mailman/listinfo/haskell-cafe

Reply via email to