Good Evening,
can anybody confirm that this implementation is somewhat faster
than the current benchmark (at expense of memory consumption)?
Cheers, Thorsten
On 30.07.2011 23:08, Ben wrote:
> hello cafe-istas --
>
> for those of you who are into these things, a lot of the shootout programs
> are suffering from "make errors" and thus do not have benchmarks.
>
> http://shootout.alioth.debian.org/u64q/haskell.php
>
> best, ben
>
> Begin forwarded message:
>
>> From: Don Stewart <[email protected]>
>> Date: July 30, 2011 9:52:12 AM PDT
>> To: Ben <[email protected]>
>> Cc: Don Bruce Stewart <[email protected]>
>> Subject: Re: shootout
>>
>> Best to bring this up on haskell-cafe@
>>
>> On Sun, Jul 31, 2011 at 12:34 AM, Ben <[email protected]> wrote:
>>> FYI, a lot of the haskell programs on the shootout suffer from "make
>>> errors" and thus do not have benchmarks.
>>>
>>> best, ben
>
> _______________________________________________
> Haskell-Cafe mailing list
> [email protected]
> http://www.haskell.org/mailman/listinfo/haskell-cafe
{-# LANGUAGE BangPatterns #-}
module Main where
import System.Environment
import qualified Data.ByteString.Lazy as L
import qualified Data.ByteString.Lazy.Char8 as C
import qualified Data.ByteString as S
import Data.ByteString.Internal
import Data.Word
-- Look Up Table
data P = P !Word8 !Float
type LUT = [P]
iubs, homs :: LUT
iubs = cdf [('a',0.27),('c',0.12),('g',0.12),('t',0.27),('B',0.02)
,('D',0.02),('H',0.02),('K',0.02),('M',0.02),('N',0.02)
,('R',0.02),('S',0.02),('V',0.02),('W',0.02),('Y',0.02)]
homs = cdf [('a',0.3029549426680),('c',0.1979883004921)
,('g',0.1975473066391),('t',0.3015094502008)]
-- compile LUT from assoc list
cdf :: [(Char,Float)] -> LUT
cdf ls = reverse $ cdf' [] 0 ls
where cdf' acc _ [] = acc
cdf' acc !c ((v,k):ls) = cdf' ((P v' c'):acc) c' ls
where !c' = k + c
!v' = c2w v
-- extract Char from List by Key
choose :: LUT -> Float -> Word8
choose lut !f = choose' lut
where choose' ((P v k):ls)| f <= k = v
| otherwise = choose' ls
-- PRNG
im, ia, ic :: Int
im = 139968
ia = 3877
ic = 29573
data R = R !Float !Int
imd :: Float
imd = fromIntegral im
rand :: Int -> R
rand seed = R newran newseed
where
!newseed = (seed * ia + ic) `rem` im
!newran = (fromIntegral newseed) / imd
-- /PRNG
-- Write properly aligned output
fasta !n s | n >= 60 = go ts t n 60
| otherwise = go ts t n n
where (t:ts) = L.toChunks s
go ss s !n !m | n == 0 = return ()
| ll < m = S.putStr l >> go (tail ss) (head ss) (n-ll) (m-ll)
| ll == m && n' >= 60 = S.putStrLn l >> go ss r n' 60
| ll == m && n' < 60 = S.putStrLn l >> go ss r n' n'
where (l,r) = S.splitAt m s
ll = S.length l
!n' = n-m
-- build cache from PRNG
data Q = Q !Int !Int
cacheUF ls = L.unfoldr go $ Q 42 139968
where go (Q _ 0) = Nothing
go (Q sd n) = Just (choose ls f, Q s (n-1))
where (R f s) = rand sd
alu = C.pack "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG\
\GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA\
\CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT\
\ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA\
\GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG\
\AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC\
\AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA"
fastas n = do putStrLn ">ONE Homo sapiens alu"
fasta (n*2) $ L.cycle alu
putStrLn ">TWO IUB ambiguity codes"
fasta (n*3) $ L.cycle $ cacheUF iubs
putStrLn ">THREE Homo sapiens frequency"
fasta (n*5) $ L.drop d $ L.cycle $ cacheUF homs
where d = fromIntegral (n*3) `mod` 139968
main = do n <- getArgs >>= readIO . head
fastas n
_______________________________________________
Haskell-Cafe mailing list
[email protected]
http://www.haskell.org/mailman/listinfo/haskell-cafe
