Hi Guys,
no, its not totally random but prob appears that way to outside users!
Under the hood for this query mart does a rnorvegicus_gene_ensembl
dataset query to get the gene_stable_id followed by a gene structure query and a sequnce
dataset query to get the sequence out. When mart does query chaining it
shows the attributes from the final dataset first in the order they were added,
followed by the second to last etc. This makes sense when doing two
visible dataset queries like a human, mouse join but in the scenario you
describe below it obviously does not make as much sense - for the todo
list for 0.7 hopefully
best wishes
Damian
On Mon, 18 Jun 2007, Aristotelis Tsirigos wrote:
Yes, I had the same problem sometime ago as well. It seem to occur randomly!
Aris
On 6/18/07, David Withers <[EMAIL PROTECTED]> wrote:
When I send the following query
http://www.biomart.org:/biomart/martservice?query=
<?xml version="1.0" encoding="UTF-8"?>
<!DOCTYPE Query>
<Query virtualSchemaName="default" count="0" softwareVersion="0.5"
requestId="taverna">
<Dataset name="rnorvegicus_gene_ensembl">
<Attribute name="gene_stable_id" />
<Attribute name="coding_gene_flank" />
<Filter name="ensembl_gene_id" value="ENSRNOG00000028302" />
<Filter name="upstream_flank" value="100" />
</Dataset>
</Query>
I get the result
CTCCCGGCCTCCGTTCCTTTCGGTCCGACGCGCCTCGGCCCCGCCCCAGCCCACCGGATTCTTTCCAGCTCGACCCCGGCTGCCAGTTTCCCCCGCCGCC
ENSRNOG00000028302
I was expecting the gene id to be the first result as it's the first
attribute in the query.
David.
--
David Withers
School of Computer Science, University of Manchester,
Oxford Road, Manchester, M13 9PL, UK.
Tel: +44(0)161 275 0145
