Hi Stephen, The mpiblast behavior you are observing is "normal" and results from mpiblast carefully calculating the exact effective search space size for every query in the large query set you are using. Unfortunately, that part of mpiblast 1.4.0 is still a serial component of the algorithm which takes place prior to the database search.
Others have also complained about how long the initial search space calculation takes on AA queries, so I have introduced a bit of code to mpiblast.cpp that should provide a fast approximation to the true effective search space. My logic behind doing so is that the error introduced by the approximation will in most cases be small enough that it shouldn't matter (ask me if you want a more detailed explanation). The approximation works by taking the effective database size and query length adjustment from the first query and applying it to all subsequent queries. This will be more likely to cause e-value inaccuracy if the first query is not representative of the remaining queries, i.e. the first query is substantially longer, shorter, or contains a substantially different amount of low-complexity sequence that would be removed by the dust filter. I have committed the changes to mpiblast.cpp in our CVS repository. Follow these instructions to build from the CVS repository: http://mpiblast.lanl.gov/Docs.FAQ.html#cvs The changes may take up to a day to sync between the developer repository and the public repository. Note that I have not yet had time to test the changes, but they are small, so hopefully they'll "just work." I'll make an effort to do some testing over the weekend... hope this helps, -Aaron Stephen Ficklin wrote: > Hi, I have a query file with 359,001 ESTs (218MB). I'm running a blastx using > mpiBLAST against the Swiss-Prot Uniprot database containing 241,242 protein > sequences (119MB) in size. The job on the master node has been doing all > the work. The worker nodes just sit idle and after more than 12 hours I > still have no results and the workers nodes are still doing nothing. > > Here's my command-line entry: > /usr/local/mpich/bin/mpirun -np 12 -machinefile > /home/userx/test/mpiblast/machines /usr/local/mpiblast/bin/mpiblast -p blastx > -i /local/scratch/rosaceae2006_6_14.trim.lib -d uniprot_sprot.fasta -e 1e-5 > -F F -o /home/userx/test/mpiblast/results.out --debug=/test/mpiblast/debug.out > > I'm running this job on a 60 node cluster with each node having dual 64bit > AMD Opteron 2.2Ghz processors and 2GB of RAM. The database files, mpiblast > binaries and output files all reside on NFS mounted filesystems. > > Is mpiblast really just in the "preparation" phase before the workers get > busy? Can anyone tell me if I am just being impatient by thinking there's > something wrong? Will I get results if I just let it continue to run... or > does something look amiss? > > Thanks, > Stephen > > > Below is the output from the debug logs and also from strace... > > >From process 0: > > [0] 0.125637 Locking fragment list > [0] 0.125722 Locked fragment list > [0] 0.14224 broadcasting file size of 218960601 > [0] 0.142269 file size broadcasted > [0] 0.757526 broadcasting file > [0] 83.6573 file broadcasted > [0] 83.679 initializing ncbi ...blastall -p blastx -i > /local/scratch/rosaceae2006_6_14.trim.lib -e 1e-5 -F F -o > /home/userx/test/mpiblast/results.out -d > /share/dblibs/mpiblast/uniprot_sprot.fasta > [0] 83.6794 > (0) done initializing ncbi. > [0] 83.7389 Init blast error code 0 > > > >From process 1: > [1] 0.181678 Temp name base: > /local/scratch/rosaceae2006_6_14.trim.libXXXXXX > [1] 0.181869 Got temp name: > /local/scratch/rosaceae2006_6_14.trim.libAIhXHa > [1] 0.181895 waiting for file size broadcast > [1] 0.181913 received file size broadcast of 218960601 > [1] 0.181945 opening receive file > /local/scratch/rosaceae2006_6_14.trim.libAIhXHa > [1] 0.181991 receiving file to > /local/scratch/rosaceae2006_6_14.trim.libAIhXHa > [1] 83.7265 received file broadcast > [1] 254.948 Query file received as > /local/scratch/rosaceae2006_6_14.trim.lib > > > When the process first begins it appears to be reading in the query file. > This takes approximately 1 1/2 hours. Here's a portion of the strace: > > read(4, "CCAACTGTAACTTAACCGGGAGAGGTCCCGCC"..., 4096) = 4096 > read(4, "ACCGGTGGAGTGAAGAAGCCCCACCGTTTCAG"..., 4096) = 4096 > read(4, "\nCATCCACGACTTTTGTTCCGACATGGCTCTC"..., 4096) = 4096 > mmap(NULL, 2461696, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_ANONYMOUS, -1, 0) = > 0x2aafb5e000 > munmap(0x2ab000e000, 2461696) = 0 > read(4, "GGATTAGATGGTAAGAATAACTGGAGAGTTGA"..., 4096) = 4096 > mmap(NULL, 2461696, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_ANONYMOUS, -1, 0) = > 0x2aafdb7000 > munmap(0x2ab0267000, 2461696) = 0 > read(4, "AATCCTGATGTGAACAAGAAGCTAAGTGCTGC"..., 4096) = 4096 > read(4, "TAGTGGGCTTGCCGCACTGCTCAAGGCGGCCC"..., 4096) = 4096 > brk(0x1e7f6000) = 0x1e7f6000 > brk(0x1e7f4000) = 0x1e7f4000 > read(4, "CCGTCTGGATCTCCCGCGAAGT\nGATAGTCGG"..., 4096) = 4096 > read(4, "TCCAATCTGTTCCAGCTTCCATAAGACCGTGG"..., 4096) = 4096 > read(4, "AAACTNCTGAGTGTCGACTCCCTTT\n>Malus"..., 4096) = 4096 > read(4, "GCCTTGACTACCTTG\nGCAACCCAAACCTTAT"..., 4096) = 4096 > read(4, "TCTTGAGAGCAGGAGCTGCCAAG\nGCCCTTGG"..., 4096) = 4096 > read(4, "TCTTCCCTGTTCCTCCATTTCCGAGCTCCAAA"..., 4096) = 4096 > read(4, "GACCAAAC\nTCGGCCGCCTCGTGAAGGAAGGC"..., 4096) = 4096 > mmap(NULL, 2461696, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_ANONYMOUS, -1, 0) = > 0x2ab0010000 > munmap(0x2aafb5e000, 2461696) = 0 > brk(0x1e815000) = 0x1e815000 > read(4, "C\nAGGCTCAGTCCGGAACCGGGAAAACAGCAA"..., 4096) = 4096 > read(4, "\nCGTAGTAGCATAACTACTACGAATTTC\n>Ma"..., 4096) = 4096 > read(4, "CCTGNGAAAGTCTTGCTGAACCAATACAG\nAC"..., 4096) = 4096 > read(4, "ACAAGAACTTG\nTGCCCAGGATGAGGTTTTAA"..., 4096) = 4096 > read(4, "AAAGAACCCTATTTAGGGAGTGCAATAGAGA\n"..., 4096) = 4096 > read(4, "GCGGCCCACCACGGCGTCGTCACAAGCGACTG"..., 4096) = 4096 > read(4, "ACCATGGGCAATGATTTGTGGTATGGACCGGA"..., 4096) = 4096 > read(4, "AAAGATGTCATTTTCATGATGATGATATTGCC"..., 4096) = 4096 > brk(0x1e836000) = 0x1e836000 > brk(0x1e835000) = 0x1e835000 > mmap(NULL, 2461696, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_ANONYMOUS, -1, 0) = > 0x2aafb5e000 > munmap(0x2ab0010000, 2461696) = 0 > read(4, "ATCTTGCCATATGATTATGAAAAAAATGAAGT"..., 4096) = 4096 > mmap(NULL, 2461696, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_ANONYMOUS, -1, 0) = > 0x2ab0010000 > munmap(0x2aafdb7000, 2461696) = 0 > read(4, "AAGATGTCGAGTGCCGCCGATCCCGAGCACAG"..., 4096) = 4096 > read(4, "GCTCGTGGACAGCAGGGTTCTTATCCTATCAA"..., 4096) = 4096 > read(4, "TAGGTGAGAATCCTTCTCTGGATTGGTCCAAC"..., 4096) = 4096 > read(4, "GAAAGTTTTAATATTTTGAATTTAAATTTG\nA"..., 4096) = 4096 > read(4, "TTCTCGGCACAATATCTTGCATGCGATAAATA"..., 4096) = 4096 > brk(0x1e856000) = 0x1e856000 > read(4, "TTGCCTCACCATGTGCACAAGCTGTGTCGCAT"..., 4096) = 4096 > > > Later, it appears that the program is doing something with the databases. It > never seems to come out of this phase, just looping doing the same type thing > over and over again: > > mmap(NULL, 266240, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_ANONYMOUS, -1, 0) = > 0x2ab9fc3000 > mmap(NULL, 266240, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_ANONYMOUS, -1, 0) = > 0x2aba004000 > stat("BLOSUM62", 0x7fbfffd0c0) = -1 ENOENT (No such file or > directory) > stat("/usr/local/blast/data/BLOSUM62", {st_mode=S_IFREG|0644, st_size=2061, > ...}) = 0 > open("/usr/local/blast/data/BLOSUM62", O_RDONLY) = 6 > fstat(6, {st_mode=S_IFREG|0644, st_size=2061, ...}) = 0 > mmap(NULL, 32768, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_ANONYMOUS, -1, 0) = > 0x2aba045000 > read(6, "# Entries for the BLOSUM62 matri"..., 32768) = 2061 > read(6, "", 32768) = 0 > close(6) = 0 > munmap(0x2aba045000, 32768) = 0 > munmap(0x2aba004000, 266240) = 0 > mmap(NULL, 528384, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_ANONYMOUS, -1, 0) = > 0x2aba004000 > munmap(0x2ab9fc3000, 266240) = 0 > munmap(0x2aba004000, 528384) = 0 > munmap(0x2ab9e29000, 166504) = 0 > munmap(0x2ab9e52000, 166504) = 0 > munmap(0x2ab9e7b000, 166504) = 0 > munmap(0x2ab9ea4000, 166504) = 0 > munmap(0x2ab9ecd000, 166512) = 0 > munmap(0x2ab9ef6000, 166512) = 0 > munmap(0x2ab9f1f000, 166512) = 0 > munmap(0x2ab9f48000, 166512) = 0 > munmap(0x2ab9f71000, 166512) = 0 > munmap(0x2ab9f9a000, 166504) = 0 > stat("/share/dblibs/mpiblast/uniprot_sprot.fasta.pal", {st_mode=S_IFREG|0644, > st_size=604, ...}) = 0 > open("/share/dblibs/mpiblast/uniprot_sprot.fasta.pal", O_RDONLY) = 6 > open("/share/dblibs/mpiblast/uniprot_sprot.fasta.pal", O_RDONLY) = 7 > fstat(7, {st_mode=S_IFREG|0644, st_size=604, ...}) = 0 > mmap(NULL, 32768, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_ANONYMOUS, -1, 0) = > 0x2ab9e29000 > read(7, "#\n# Alias file created Wed Nov 2"..., 32768) = 604 > close(7) = 0 > munmap(0x2ab9e29000, 32768) = 0 > fstat(6, {st_mode=S_IFREG|0644, st_size=604, ...}) = 0 > mmap(NULL, 32768, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_ANONYMOUS, -1, 0) = > 0x2ab9e29000 > read(6, "#\n# Alias file created Wed Nov 2"..., 32768) = 604 > read(6, "", 32768) = 0 > close(6) = 0 > munmap(0x2ab9e29000, 32768) = 0 > stat("/share/dblibs/mpiblast/uniprot_sprot.fasta.000.pal", 0x7fbffea020) = -1 > ENOENT (No such file or directory) > stat("/share/dblibs/mpiblast/uniprot_sprot.fasta.000.pin", > {st_mode=S_IFREG|0644, st_size=166504, ...}) = 0 > stat("/share/dblibs/mpiblast/comindex.mm", 0x7fbffef130) = -1 ENOENT (No such > file or directory) > stat("/share/dblibs/mpiblast/uniprot_sprot.fasta.000.pin", > {st_mode=S_IFREG|0644, st_size=166504, ...}) = 0 > open("/share/dblibs/mpiblast/uniprot_sprot.fasta.000.pin", O_RDONLY) = 6 > mmap(NULL, 166504, PROT_READ, MAP_SHARED, 6, 0) = 0x2ab9e29000 > close(6) = 0 > stat("/share/dblibs/mpiblast/uniprot_sprot.fasta.000.pnd", > {st_mode=S_IFREG|0644, st_size=0, ...}) = 0 > stat("/share/dblibs/mpiblast/uniprot_sprot.fasta.000.psd", > {st_mode=S_IFREG|0644, st_size=768708, ...}) = 0 > stat("/share/dblibs/mpiblast/uniprot_sprot.fasta.000.psi", > {st_mode=S_IFREG|0644, st_size=17296, ...}) = 0 > stat("/share/dblibs/mpiblast/uniprot_sprot.fasta.000.ppd", 0x7fbffef130) = -1 > ENOENT (No such file or directory) > stat("/share/dblibs/mpiblast/uniprot_sprot.fasta.001.pal", 0x7fbffea020) = -1 > ENOENT (No such file or directory) > stat("/share/dblibs/mpiblast/uniprot_sprot.fasta.001.pin", > {st_mode=S_IFREG|0644, st_size=166504, ...}) = 0 > stat("/share/dblibs/mpiblast/comindex.mm", 0x7fbffef130) = -1 ENOENT (No such > file or directory) > stat("/share/dblibs/mpiblast/uniprot_sprot.fasta.001.pin", > {st_mode=S_IFREG|0644, st_size=166504, ...}) = 0 > open("/share/dblibs/mpiblast/uniprot_sprot.fasta.001.pin", O_RDONLY) = 6 > mmap(NULL, 166504, PROT_READ, MAP_SHARED, 6, 0) = 0x2ab9e52000 > close(6) = 0 > stat("/share/dblibs/mpiblast/uniprot_sprot.fasta.001.pnd", > {st_mode=S_IFREG|0644, st_size=0, ...}) = 0 > stat("/share/dblibs/mpiblast/uniprot_sprot.fasta.001.psd", > {st_mode=S_IFREG|0644, st_size=768492, ...}) = 0 > stat("/share/dblibs/mpiblast/uniprot_sprot.fasta.001.psi", > {st_mode=S_IFREG|0644, st_size=17274, ...}) = 0 > stat("/share/dblibs/mpiblast/uniprot_sprot.fasta.001.ppd", 0x7fbffef130) = -1 > ENOENT (No such file or directory) > stat("/share/dblibs/mpiblast/uniprot_sprot.fasta.002.pal", 0x7fbffea020) = -1 > ENOENT (No such file or directory) > stat("/share/dblibs/mpiblast/uniprot_sprot.fasta.002.pin", > {st_mode=S_IFREG|0644, st_size=166504, ...}) = 0 > stat("/share/dblibs/mpiblast/comindex.mm", 0x7fbffef130) = -1 ENOENT (No such > file or directory) > stat("/share/dblibs/mpiblast/uniprot_sprot.fasta.002.pin", > {st_mode=S_IFREG|0644, st_size=166504, ...}) = 0 > open("/share/dblibs/mpiblast/uniprot_sprot.fasta.002.pin", O_RDONLY) = 6 > mmap(NULL, 166504, PROT_READ, MAP_SHARED, 6, 0) = 0x2ab9e7b000 > close(6) = 0 > stat("/share/dblibs/mpiblast/uniprot_sprot.fasta.002.pnd", > {st_mode=S_IFREG|0644, st_size=0, ...}) = 0 > stat("/share/dblibs/mpiblast/uniprot_sprot.fasta.002.psd", > {st_mode=S_IFREG|0644, st_size=768856, ...}) = 0 > stat("/share/dblibs/mpiblast/uniprot_sprot.fasta.002.psi", > {st_mode=S_IFREG|0644, st_size=17246, ...}) = 0 > stat("/share/dblibs/mpiblast/uniprot_sprot.fasta.002.ppd", 0x7fbffef130) = -1 > ENOENT (No such file or directory) > stat("/share/dblibs/mpiblast/uniprot_sprot.fasta.003.pal", 0x7fbffea020) = -1 > ENOENT (No such file or directory) > stat("/share/dblibs/mpiblast/uniprot_sprot.fasta.003.pin", > {st_mode=S_IFREG|0644, st_size=166504, ...}) = 0 > stat("/share/dblibs/mpiblast/comindex.mm", 0x7fbffef130) = -1 ENOENT (No such > file or directory) > stat("/share/dblibs/mpiblast/uniprot_sprot.fasta.003.pin", > {st_mode=S_IFREG|0644, st_size=166504, ...}) = 0 > open("/share/dblibs/mpiblast/uniprot_sprot.fasta.003.pin", O_RDONLY) = 6 > mmap(NULL, 166504, PROT_READ, MAP_SHARED, 6, 0) = 0x2ab9ea4000 > close(6) = 0 > stat("/share/dblibs/mpiblast/uniprot_sprot.fasta.003.pnd", > {st_mode=S_IFREG|0644, st_size=0, ...}) = 0 > stat("/share/dblibs/mpiblast/uniprot_sprot.fasta.003.psd", > {st_mode=S_IFREG|0644, st_size=768804, ...}) = 0 > stat("/share/dblibs/mpiblast/uniprot_sprot.fasta.003.psi", > {st_mode=S_IFREG|0644, st_size=17257, ...}) = 0 > stat("/share/dblibs/mpiblast/uniprot_sprot.fasta.003.ppd", 0x7fbffef130) = -1 > ENOENT (No such file or directory) > stat("/share/dblibs/mpiblast/uniprot_sprot.fasta.004.pal", 0x7fbffea020) = -1 > ENOENT (No such file or directory) > stat("/share/dblibs/mpiblast/uniprot_sprot.fasta.004.pin", > {st_mode=S_IFREG|0644, st_size=166512, ...}) = 0 > stat("/share/dblibs/mpiblast/comindex.mm", 0x7fbffef130) = -1 ENOENT (No such > file or directory) > stat("/share/dblibs/mpiblast/uniprot_sprot.fasta.004.pin", > {st_mode=S_IFREG|0644, st_size=166512, ...}) = 0 > open("/share/dblibs/mpiblast/uniprot_sprot.fasta.004.pin", O_RDONLY) = 6 > mmap(NULL, 166512, PROT_READ, MAP_SHARED, 6, 0) = 0x2ab9ecd000 > close(6) = 0 > stat("/share/dblibs/mpiblast/uniprot_sprot.fasta.004.pnd", > {st_mode=S_IFREG|0644, st_size=0, ...}) = 0 > stat("/share/dblibs/mpiblast/uniprot_sprot.fasta.004.psd", > {st_mode=S_IFREG|0644, st_size=769222, ...}) = 0 > stat("/share/dblibs/mpiblast/uniprot_sprot.fasta.004.psi", > {st_mode=S_IFREG|0644, st_size=17320, ...}) = 0 > stat("/share/dblibs/mpiblast/uniprot_sprot.fasta.004.ppd", 0x7fbffef130) = -1 > ENOENT (No such file or directory) > stat("/share/dblibs/mpiblast/uniprot_sprot.fasta.005.pal", 0x7fbffea020) = -1 > ENOENT (No such file or directory) > stat("/share/dblibs/mpiblast/uniprot_sprot.fasta.005.pin", > {st_mode=S_IFREG|0644, st_size=166512, ...}) = 0 > stat("/share/dblibs/mpiblast/comindex.mm", 0x7fbffef130) = -1 ENOENT (No such > file or directory) > stat("/share/dblibs/mpiblast/uniprot_sprot.fasta.005.pin", > {st_mode=S_IFREG|0644, st_size=166512, ...}) = 0 > open("/share/dblibs/mpiblast/uniprot_sprot.fasta.005.pin", O_RDONLY) = 6 > mmap(NULL, 166512, PROT_READ, MAP_SHARED, 6, 0) = 0x2ab9ef6000 > close(6) = 0 > stat("/share/dblibs/mpiblast/uniprot_sprot.fasta.005.pnd", > {st_mode=S_IFREG|0644, st_size=0, ...}) = 0 > stat("/share/dblibs/mpiblast/uniprot_sprot.fasta.005.psd", > {st_mode=S_IFREG|0644, st_size=768998, ...}) = 0 > stat("/share/dblibs/mpiblast/uniprot_sprot.fasta.005.psi", > {st_mode=S_IFREG|0644, st_size=17265, ...}) = 0 > stat("/share/dblibs/mpiblast/uniprot_sprot.fasta.005.ppd", 0x7fbffef130) = -1 > ENOENT (No such file or directory) > stat("/share/dblibs/mpiblast/uniprot_sprot.fasta.006.pal", 0x7fbffea020) = -1 > ENOENT (No such file or directory) > stat("/share/dblibs/mpiblast/uniprot_sprot.fasta.006.pin", > {st_mode=S_IFREG|0644, st_size=166512, ...}) = 0 > stat("/share/dblibs/mpiblast/comindex.mm", 0x7fbffef130) = -1 ENOENT (No such > file or directory) > stat("/share/dblibs/mpiblast/uniprot_sprot.fasta.006.pin", > {st_mode=S_IFREG|0644, st_size=166512, ...}) = 0 > open("/share/dblibs/mpiblast/uniprot_sprot.fasta.006.pin", O_RDONLY) = 6 > mmap(NULL, 166512, PROT_READ, MAP_SHARED, 6, 0) = 0x2ab9f1f000 > close(6) = 0 > stat("/share/dblibs/mpiblast/uniprot_sprot.fasta.006.pnd", > {st_mode=S_IFREG|0644, st_size=0, ...}) = 0 > stat("/share/dblibs/mpiblast/uniprot_sprot.fasta.006.psd", > {st_mode=S_IFREG|0644, st_size=768576, ...}) = 0 > stat("/share/dblibs/mpiblast/uniprot_sprot.fasta.006.psi", > {st_mode=S_IFREG|0644, st_size=17254, ...}) = 0 > stat("/share/dblibs/mpiblast/uniprot_sprot.fasta.006.ppd", 0x7fbffef130) = -1 > ENOENT (No such file or directory) > stat("/share/dblibs/mpiblast/uniprot_sprot.fasta.007.pal", 0x7fbffea020) = -1 > ENOENT (No such file or directory) > stat("/share/dblibs/mpiblast/uniprot_sprot.fasta.007.pin", > {st_mode=S_IFREG|0644, st_size=166512, ...}) = 0 > stat("/share/dblibs/mpiblast/comindex.mm", 0x7fbffef130) = -1 ENOENT (No such > file or directory) > stat("/share/dblibs/mpiblast/uniprot_sprot.fasta.007.pin", > {st_mode=S_IFREG|0644, st_size=166512, ...}) = 0 > open("/share/dblibs/mpiblast/uniprot_sprot.fasta.007.pin", O_RDONLY) = 6 > mmap(NULL, 166512, PROT_READ, MAP_SHARED, 6, 0) = 0x2ab9f48000 > close(6) = 0 > stat("/share/dblibs/mpiblast/uniprot_sprot.fasta.007.pnd", > t/uniprot_sprot.fasta.pal", O_RDONLY <unfinished ...> > > > > Here's the 'top' output while it's in this phase: > > top - 10:59:05 up 13 days, 17:19, 2 users, load average: 15.39, 14.99, 14.91 > Tasks: 106 total, 13 running, 93 sleeping, 0 stopped, 0 zombie > Cpu(s): 90.5% us, 8.8% sy, 0.0% ni, 0.0% id, 0.0% wa, 0.2% hi, 0.5% si > Mem: 2055592k total, 1841228k used, 214364k free, 36076k buffers > Swap: 4104596k total, 51876k used, 4052720k free, 560236k cached > > PID USER PR NI VIRT RES SHR S %CPU %MEM TIME+ COMMAND > 1364 userx 25 0 662m 657m 5408 R 96.9 32.8 288:42.29 mpiblast > 1366 userx 25 0 52764 50m 9164 R 17.0 2.5 32:03.48 mpiblast > 1368 userx 25 0 52764 50m 9140 R 17.0 2.5 42:13.77 mpiblast > 1365 userx 25 0 52764 50m 9272 R 16.3 2.5 31:41.58 mpiblast > 1374 userx 25 0 52764 50m 9124 R 16.3 2.5 36:11.10 mpiblast > 1376 userx 25 0 52764 50m 9180 R 16.0 2.5 40:15.22 mpiblast > 1371 userx 25 0 52764 50m 9088 R 15.6 2.5 48:58.12 mpiblast > 1367 userx 25 0 52764 50m 9248 R 0.7 2.5 18:32.87 mpiblast > 1369 userx 25 0 52764 50m 9120 R 0.7 2.5 13:34.60 mpiblast > 1373 userx 25 0 52764 50m 9104 R 0.7 2.5 27:16.60 mpiblast > 6724 userx 16 0 5284 928 692 R 0.7 0.0 0:00.16 top > 1370 userx 25 0 52764 50m 8972 R 0.3 2.5 7:01.37 mpiblast > 1335 userx 17 0 53804 868 864 S 0.0 0.0 0:00.00 sh > 1336 userx 17 0 53940 916 912 S 0.0 0.0 0:00.01 mpirun > 1375 userx 25 0 52764 50m 9156 R 0.0 2.5 6:18.04 mpiblast > 6363 userx 16 0 35768 2784 2012 S 0.0 0.1 0:00.29 sshd > 6364 userx 15 0 54824 1668 928 S 0.0 0.1 0:00.07 tcsh > > > > ------------------------------------------------------------------------- > Take Surveys. Earn Cash. Influence the Future of IT > Join SourceForge.net's Techsay panel and you'll get the chance to share your > opinions on IT & business topics through brief surveys - and earn cash > http://www.techsay.com/default.php?page=join.php&p=sourceforge&CID=DEVDEV > _______________________________________________ > Mpiblast-users mailing list > [email protected] > https://lists.sourceforge.net/lists/listinfo/mpiblast-users > ------------------------------------------------------------------------- Take Surveys. Earn Cash. Influence the Future of IT Join SourceForge.net's Techsay panel and you'll get the chance to share your opinions on IT & business topics through brief surveys - and earn cash http://www.techsay.com/default.php?page=join.php&p=sourceforge&CID=DEVDEV _______________________________________________ Mpiblast-users mailing list [email protected] https://lists.sourceforge.net/lists/listinfo/mpiblast-users
