Is the sort you are looking for the Burrows Wheeler transform process?

----- Original Message -----
From: Raul Miller <[email protected]>
To: Programming forum <[email protected]>
Cc: 
Sent: Friday, October 4, 2013 9:58:08 PM
Subject: Re: [Jprogramming] succinct de bruijn graphs

The arguments are (from left to right):

x: element to match on
m: position
y: sequence we match against

In rank:  'position' is an index into y
In select:  'position' is a count of matched elements

Here's another example:
   'c' (8) rank 'ctcaattacattgtcgaaga'
2
   't' (5) select 'ctcaattacattgtcgaaga'
11

Does that help?

Thanks,

-- 
Raul

On Fri, Oct 4, 2013 at 7:16 PM, Pascal Jasmin <[email protected]> wrote:
> I don't get why the rank function needs a 1 or 0 parameter.
>
> rank 5 should see that 5{ is 1 and then count the number of occurrences 
> preceeding it?  Or is the point that 0 (5) rank should return 2?
>
> Its unclear what you (or they) want to sort.
>
>
>
> ----- Original Message -----
> From: Raul Miller <[email protected]>
> To: Programming forum <[email protected]>
> Cc:
> Sent: Friday, October 4, 2013 6:09:04 PM
> Subject: [Jprogramming] succinct de bruijn graphs
>
> http://alexbowe.com/succinct-debruijn-graphs/
>
> There's a bit of a linguistic conflict, here - the terms rank and
> select used here are different from what a j programmer might expect:
>
>    rank=: 1 :('m+/@{.=')
>    1 (5) rank 0 1 1 0 1 0 0 1 0 0
> 3
>    select=: 1 :('m i.~ +/\@:=')
>    1 (4) select 0 1 1 0 1 0 0 1 0 0
> 7
>
> But how might we implement the sort described here?
>
> Thanks,
>
> --
> Raul
> ----------------------------------------------------------------------
> For information about J forums see http://www.jsoftware.com/forums.htm

>
> ----------------------------------------------------------------------
> For information about J forums see http://www.jsoftware.com/forums.htm
----------------------------------------------------------------------
For information about J forums see http://www.jsoftware.com/forums.htm

----------------------------------------------------------------------
For information about J forums see http://www.jsoftware.com/forums.htm

Reply via email to