A quick thought,  might not be what you have in mind.

If, say, you’re seeking the frequency of letters,  it’s worth prefixing the 
sorted alphabet of interest to your string and then subtracting one from the 
scores.

Useful for me sometimes, anyway.

Mike

Sent from my iPad

> On 12 Oct 2019, at 06:50, 'Jim Russell' via Programming 
> <[email protected]> wrote:
> 
> Looks promising. Typically, the strings are different lengths, and we may not 
> have access to them at the same time. (Which is why I hade the intermediate 
> summary step.) Let me ponder that (I don't think it will matter) while I 
> study your approach more. Thanks very much!
> 
>> On Oct 12, 2019, at 1:22 AM, Ric Sherlock <[email protected]> wrote:
>> 
>> Here's one approach...
>> 
>> I find it much easier to work with if there is actual data. The following
>> may not be representative of your data but it gives us somewhere to start.
>> 
>> ]'X Y'=: 'actg' {~ 2 30 ?@$ 4
>> 
>> ggtaaaatgactgtagtgaagaaggagtcc
>> 
>> ctgattaaggttcggtgtcgataccgcgca
>> 
>> 
>> We now have 2 strings X and Y. Let's obtain the trigrams for each string
>> 
>> trig=: 3,\&.> X;Y Get the nub of the union of both sets of trigrams and
>> prepend it to each trigram set. supertrig=: (,~&.> <@~.@;) trig Now we can
>> use Key to count the trigrams in each set and decrement by 1 (for the extra
>> copy that we added). <: #/.~&> supertrig
>> 
>> 1 2 1 2 1 1 2 1 1 1 1 1 2 1 2 2 1 1 1 1 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
>> 
>> 2 0 1 0 0 0 1 0 0 1 1 0 0 1 0 1 0 1 0 0 1 0 2 1 1 1 1 2 1 1 1 1 1 1 2 1 1
>> 
>> Or to summarise by trigram:
>> 
>> (~.@; trig);|: <: #/.~&> supertrig
>> 
>> +---+---+
>> 
>> |ggt|1 2|
>> 
>> |gta|2 0|
>> 
>> |taa|1 1|
>> 
>> |aaa|2 0|
>> 
>> |aat|1 0|
>> 
>> |atg|1 0|
>> 
>> |tga|2 1|
>> 
>> |gac|1 0|
>> 
>> |act|1 0|
>> 
>> |ctg|1 1|
>> 
>> |tgt|1 1|
>> 
>> |tag|1 0|
>> 
>> |agt|2 0|
>> 
>> |gtg|1 1|
>> 
>> |gaa|2 0|
>> 
>> |aag|2 1|
>> 
>> |aga|1 0|
>> 
>> |agg|1 1|
>> 
>> |gga|1 0|
>> 
>> |gag|1 0|
>> 
>> |gtc|1 1|
>> 
>> |tcc|1 0|
>> 
>> |gat|0 2|
>> 
>> |att|0 1|
>> 
>> |tta|0 1|
>> 
>> |gtt|0 1|
>> 
>> |ttc|0 1|
>> 
>> |tcg|0 2|
>> 
>> |cgg|0 1|
>> 
>> |cga|0 1|
>> 
>> |ata|0 1|
>> 
>> |tac|0 1|
>> 
>> |acc|0 1|
>> 
>> |ccg|0 1|
>> 
>> |cgc|0 2|
>> 
>> |gcg|0 1|
>> 
>> |gca|0 1|
>> 
>> +---+---+
>> 
>> 
>>> On Sat, Oct 12, 2019 at 4:40 PM 'Jim Russell' via Programming <
>>> [email protected]> wrote:
>>> 
>>> Sure, thanks. I'm working to re-implement a text comparison program I did
>>> using VBA & Microsoft Access a number of years back.
>>> 
>>> The object is to compare two text documents and see how similar one is to
>>> the other by  comparing the number of unique trigrams that are found in
>>> each.
>>> For each text string a table of trigrams is constructed with the
>>> expression 3,\x. The resulting table of 3-character samples m is then
>>> tallied using #/.~m . This yields a vector of counts of each unique trigram
>>> corresponding to (an unseen) nub of m. The count, and a copy of the nub of
>>> m, represent a summary of the text in string x.
>>> This same process then repeated to creat a smry for the second string, y.
>>> 
>>> The next step in the process is to assign a score of 0 to 1 based on a
>>> comparison of the two string summaries. It would seem sensible to compare
>>> the nub of the two text strings to each other. What is the difference in
>>> counts between the trigrams they have in common, and how many trigram hits
>>> for each are unique?
>>> That is where using nub1 #/. nub2 would be attractive, were it not
>>> required that the arguments had the same row counts, and Key could not
>>> count unmatched rows.
>>> 
>>> As it stands, I fear I am duplicating effort to find the nubs in preparing
>>> the summaries, and again if I have to use i. to calculate the scores. If I
>>> get a vector result when I use key on vectors, might I expect a table
>>> result (including the counts and the nub) when key is applied to tables?
>>> 
>>> Or is there a more appropriate approach? (In access and VBA, I used
>>> dictionary objects with 3 character keys, as I recall. But I was very
>>> pleasantly surprised at how well the 3 character trigrams recognized text
>>> similarities.)
>>> 
>>> I really appreciate any insights you might have, Ric, and thanks for
>>> tolerating my ignorance.
>>> 
>>>>> On Oct 11, 2019, at 10:23 PM, Ric Sherlock <[email protected]> wrote:
>>>> 
>>>> Not sure I'm understanding your questions. Maybe including some of the
>>>> expressions you've tried to illustrate your points would help?
>>> 
>>> ----------------------------------------------------------------------
>>> For information about J forums see http://www.jsoftware.com/forums.htm
>>> 
>> ----------------------------------------------------------------------
>> For information about J forums see http://www.jsoftware.com/forums.htm
> 
> ----------------------------------------------------------------------
> For information about J forums see http://www.jsoftware.com/forums.htm
----------------------------------------------------------------------
For information about J forums see http://www.jsoftware.com/forums.htm

Reply via email to