On Fri, 11 Jan 2008 14:44:19 +0530 "suyash jape" <[EMAIL PROTECTED]> wrote:
> Hi all > i want to access a web page through python script, fillup the necessary > fields, > and press submit button (which does POST call) and retrieve the result page > and retrieve some values from it. > > Here is the script i have written till now. > > >import urllib2 > > # create array of name/value pairs > > self.params = urllib.urlencode({'seqname': 'BioSequence', 'sequence': > 'ATACATTATCCAAACATAAAAAGCATGGCTT'}) > > > > # send http-post > > request = urllib.urlopen("http://www.hydrazome.metazome.net/search.php", > params) > > > > # read back each line of reply > > line = request.read() > >print line > > This script fills up the correct values in the search.php page.But i am not > sure if it is doing the POST (submit call). > Beacause in 'line' varialble, i am getting the search.php page.Not the > result page which is blast_results.php. > > How to retrieve the result page? Sounds like you're not POSTing to the right page. The form on .../search.php lets you fill in values, but those values are not necessarily POSTed to search.php. In particular, the form element has an action attribute that has a URL to which the values on the page should be posted. If that points to .../blast_results.php, then that's the page you need to pass to urlopen with your data. <mike -- Mike Meyer <[EMAIL PROTECTED]> http://www.mired.org/consulting.html Independent Network/Unix/Perforce consultant, email for more information. -- http://mail.python.org/mailman/listinfo/python-list