Yes, your references are too long - I think samtools index should have given an error message (and many idxstats too) if a reference exceeds the 512Mbp limit.
i.e. 2^29 - 1 = 536870911 bp Peter On Wed, Jun 25, 2014 at 1:37 PM, Gaidatzis, Dimosthenis <dimosthenis.gaidat...@fmi.ch> wrote: > Dear samtools developers > > During an RNA-seq project i noticed an unusual output returned by idxstats. I > managed to downsize the original sam file and to reproduce this issue with a > mini sam file (small.sam) containing only two alignments(see attachment or > end of email). i am using samtools-0.1.19 and performing the following > commands: > > samtools view -b -S small.sam > small.bam > samtools sort small.bam small.sorted > samtools index small.sorted.bam > samtools idxstats small.sorted.bam > > chr1 541556283 1 0 > chr2 541556283 11141270 27000832 > * 0 0 0 > > i think the issue might be related to the fact that the chromosomes in that > case are quite big. i would like to ask if this issue is related only to > idxstats and if the sorted bam file and the index are still ok to work with. > > Kind regards > Dimos Gaidatzis > > > sam file: > @HD VN:1.0 SO:unsorted > @SQ SN:chr1 LN:541556283 > @SQ SN:chr2 LN:541556283 > @PG ID:Bowtie VN:1.0.1 > CL:"/work/gbioinfo/linux/lib64/R/library/Rbowtie/bowtie" > SRR306742.2253485 0 chr2 536900149 255 50M * 0 0 > GTACTTAGTAGGTGTGTAGTGCATAGAATTTCAGACATTAACTCAGGAAG > 2FC9:>=C2;E9EA8AF8B>?D6D?CCC9EF@ABBE8C7D8:26@>6:5< XA:i:0 MD:Z:36C13 > NM:i:1 > SRR306742.1426453 0 chr1 541555283 255 50M * 0 0 > AACGGAAGTACCATACTTTATCACAGCTCTTATTTACAGTGAAACTGAGT > 2FC9:>=C2;E9EA8AF8B>?D6D?CCC9EF@ABBE8C7D8:26@>6:5< XA:i:0 MD:Z:36C13 > NM:i:1 > > > > ------------------------------------------------------------------------------ > Open source business process management suite built on Java and Eclipse > Turn processes into business applications with Bonita BPM Community Edition > Quickly connect people, data, and systems into organized workflows > Winner of BOSSIE, CODIE, OW2 and Gartner awards > http://p.sf.net/sfu/Bonitasoft > _______________________________________________ > Samtools-help mailing list > Samtools-help@lists.sourceforge.net > https://lists.sourceforge.net/lists/listinfo/samtools-help ------------------------------------------------------------------------------ Open source business process management suite built on Java and Eclipse Turn processes into business applications with Bonita BPM Community Edition Quickly connect people, data, and systems into organized workflows Winner of BOSSIE, CODIE, OW2 and Gartner awards http://p.sf.net/sfu/Bonitasoft _______________________________________________ Samtools-help mailing list Samtools-help@lists.sourceforge.net https://lists.sourceforge.net/lists/listinfo/samtools-help
