Hi Kevin,
The read group information should contain a platform (PL) attribute. If the
issue still persists after the problem has been corrected, please post a
followup on the GATK forum
<http://gatkforums.broadinstitute.org/categories/ask-the-team> and we will
troubleshoot further there. Going forward we are using the GATK forum to
provide support for Picard tools.
Geraldine
On Mon, Feb 16, 2015 at 7:02 AM, <
samtools-help-requ...@lists.sourceforge.net> wrote:
> Send Samtools-help mailing list submissions to
> samtools-help@lists.sourceforge.net
>
> To subscribe or unsubscribe via the World Wide Web, visit
> https://lists.sourceforge.net/lists/listinfo/samtools-help
> or, via email, send a message with subject or body 'help' to
> samtools-help-requ...@lists.sourceforge.net
>
> You can reach the person managing the list at
> samtools-help-ow...@lists.sourceforge.net
>
> When replying, please edit your Subject line so it is more specific
> than "Re: Contents of Samtools-help digest..."
>
>
> Today's Topics:
>
> 1. CollectAlignmentSummaryMetrics - Adapter sequences incorrect
> use of adapter sequence parametesr? (Kevin Rue-Albrecht)
> 2. 1st & 2nd columns of RefFlat.txt for PICARD's
> CollectRnaSeqMetrics (Trakhtenberg, Feliks)
>
>
> ----------------------------------------------------------------------
>
> Message: 1
> Date: Sun, 15 Feb 2015 17:48:29 +0000
> From: Kevin Rue-Albrecht <kevin....@ucdconnect.ie>
> Subject: [Samtools-help] CollectAlignmentSummaryMetrics - Adapter
> sequences incorrect use of adapter sequence parametesr?
> To: samtools-help@lists.sourceforge.net
> Message-ID:
> <
> cakvv_yrwox7wv-xunxsw2bfhy8fcxznvyveu8kz1wza+yf4...@mail.gmail.com>
> Content-Type: text/plain; charset="utf-8"
>
> Dear all,
>
> After various unsuccessful attempts, and browsing the archive (partially
> fixed my problem), I am afraid I have to post here for help fixing my
> issue.
>
> I am trying to use CollectAlignmentSummaryMetrics for bisulfite libraries.
> My problem is that adapters are not detected by Picard while I can clearly
> find 3.5% of the first 1,000,000 read pairs with the first mate containing
> the reverse complement of the reverse strand adapter (i.e. perfect match to
> the adapter sequence detected by grep command). Maybe I am using the
> ADAPTER_SEQUENCE of Picard wrong?
>
> Similarly to the post
> https://sourceforge.net/p/samtools/mailman/message/32771613/ I was getting
> a lot of zeros when the reference genome sequence was not specified.
> However, giving a reference genome did not improve the detection of adapter
> sequences. Anything I am missing to detect the adapter sequences in my
> command line below ?
>
> Here is the command I used (in doubt, I gave the two adapter sequences +
> the two reverse complement sequences, but apparently none are detected):
> java -jar /usr/local/src/picard-tools-1.128/picard.jar
> CollectAlignmentSummaryMetrics
> INPUT=/workspace/scratch/krue/Methylation/bwa_8lanes/C12.bam
>
> OUTPUT=/workspace/scratch/krue/Methylation/bwa_8lanes/C12.test_picard_summary.txt
> ADAPTER_SEQUENCE=null ADAPTER_SEQUENCE=GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT
> ADAPTER_SEQUENCE=TACACTCTTTCCCTACACGACGCTCTTCCGATCT
> ADAPTER_SEQUENCE=AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC
> ADAPTER_SEQUENCE=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA
> IS_BISULFITE_SEQUENCED=true
>
> REFERENCE_SEQUENCE=/workspace/storage/genomes/bostaurus/UMD3.1.75/source_file/Bos_taurus.UMD3.1.75.dna.toplevel.fa
> STOP_AFTER=100000
>
> When I tested the SAM file, PicardValidateSamFile
> <
> http://broadinstitute.github.io/picard/command-line-overview.html#ValidateSamFile
> >
> returned only one error:
> ERROR: Read name C12_TAGCTT_L002_R_001, A platform (PL) attribute was not
> found for read group
>
>
> Many thanks in advance, and I hope I didn't miss an embarrassingly obvious
> explanation somewhere
> Kevin
>
> --
> K?vin RUE-ALBRECHT
> Wellcome Trust Computational Infection Biology PhD Programme
> University College Dublin
> Ireland
> http://fr.linkedin.com/pub/k%C3%A9vin-rue/28/a45/149/en
> -------------- next part --------------
> An HTML attachment was scrubbed...
>
> ------------------------------
>
> Message: 2
> Date: Sun, 15 Feb 2015 19:50:36 +0000
> From: "Trakhtenberg, Feliks"
> <ephraim.trakhtenb...@childrens.harvard.edu>
> Subject: [Samtools-help] 1st & 2nd columns of RefFlat.txt for PICARD's
> CollectRnaSeqMetrics
> To: "samtools-help@lists.sourceforge.net"
> <samtools-help@lists.sourceforge.net>
> Message-ID:
> <cff53bbc06a2dc4f899632900785483201cc2...@chexmbx5a.chboston.org>
> Content-Type: text/plain; charset="iso-8859-1"
>
> Hello,
>
> PICARD CollectRnaSeqMetrics requires RefFlat.txt, which I had to generate.
> I have transcript name in both the 1st and the 2nd columns of my
> RefFlat.txt. Would there be a difference in the output if the 1st column
> would have had a gene name instead of the transcript name (while the 2nd
> column would still have the transcript name)? I ask because I have
> alternatively spliced transcripts and due to the format of my original
> inputs I cannot easily generate the 1st column with gene names to address
> my question.
>
> Thank you,
> Ephraim
> -------------- next part --------------
> An HTML attachment was scrubbed...
>
> ------------------------------
>
>
> ------------------------------------------------------------------------------
> Download BIRT iHub F-Type - The Free Enterprise-Grade BIRT Server
> from Actuate! Instantly Supercharge Your Business Reports and Dashboards
> with Interactivity, Sharing, Native Excel Exports, App Integration & more
> Get technology previously reserved for billion-dollar corporations, FREE
>
> http://pubads.g.doubleclick.net/gampad/clk?id=190641631&iu=/4140/ostg.clktrk
>
> ------------------------------
>
> _______________________________________________
> Samtools-help mailing list
> Samtools-help@lists.sourceforge.net
> https://lists.sourceforge.net/lists/listinfo/samtools-help
>
>
> End of Samtools-help Digest, Vol 73, Issue 16
> *********************************************
>
--
Geraldine A. Van der Auwera, Ph.D.
Bioinformatics Scientist II
GATK Support & Outreach
Broad Institute
------------------------------------------------------------------------------
Dive into the World of Parallel Programming The Go Parallel Website, sponsored
by Intel and developed in partnership with Slashdot Media, is your hub for all
things parallel software development, from weekly thought leadership blogs to
news, videos, case studies, tutorials and more. Take a look and join the
conversation now. http://goparallel.sourceforge.net/
_______________________________________________
Samtools-help mailing list
Samtools-help@lists.sourceforge.net
https://lists.sourceforge.net/lists/listinfo/samtools-help
