Re: how to can measure my level of knowledge?
Hi William, Here are my two cents after nearly 30 years of writing code in many different languages. Writing in any functional language is exactly the same as in every other functional language. The easiest way to learn and improve is by learning to break down your problem into manageable steps. The simplest analogy I can provide is the question and answer of: How do you eat an elephant? One bite at a time. Writing code is the thing you take a complex problem and break it down into smaller chunks. Let's say I am asked to take an arbitrary git repository and list all .txt and .png files in that git repository. I can just sit down and begin writing but how would I do all that? I would first do it by hand and record or memorize the steps I am taking. I would checkout the repository, I would go through each directory and record all files that have either a .txt or a .png extension, and provide the list of these files and their path within the directory, maybe add their file size as well for goot measure. The next stage is writing maybe even in pseudo code or just pain text how each step will work, lets take the crawling of the repo as an example of what this would look like: - Put the full path of the directory where the repo was checked out on a list of directories to be processed - Read contents of the directory where I checked out the repository - For each file with a .txt and .png record the directory name a '/' an the filename - For each directory add them to the list of directories we need to process - Remove the now processed from the list of directories to be processed - Process the next directory on the list of directories to be processed - When no more directories are left to process we collected all files with the.txt and .png extension - Now we process the list of .txt and .png files and grab whatever additional information we need for each file - We now should have a structure with a full path for each .txt or .png file (the keys) in the repository with associated as values the information associated with each file - All that is left it is a simple matter of printing out the structure from the previous line one key at a time Based on this list of steps above you can see where the loops would be, I have indented those to make it easy to see which bits would go in a loop. You now have the general structure of your code figured out and where you will need loops you have an idea of what structures you will need to store your data etc... The above is completely language agnostic you can implement this in any programing language all you need to do is figure out how to do each step one at a time. You might not know how to list the contents of a directory in your language of choice (in this case Perl) but that is easy enough to look up. The same for finding the attributes associated with a file, again this is easy enough to look up. Since you have this step by step plan you can easily figure out how to do each bit and then just string them together. I often add those above steps in my code as comments, and add the actual code below each step. So I can see exactly what my goal is with each step. Once that is done in your very first version of the code that produces the desired results you stop walk away and have another look at it the next day or so and clean things up as not a single person will write perfect code from the start there always is something missing or something that you would like to add (comments for instance). When done you have a working bit of code that you can explain step by step as you have set down and understood each step of the code. Having comments in the code is very helpful for future you... when you look back at that code a year or two from now you will be very happy to see the comments so you can understand what you where thinking or how you broke down the problem back then when you were still learning how to code in this language. Keeping this code or even just the portion of the code that does the walking through the directory structure in some code repository for future reference will help you not have to reinvent that wheel in the future. As it is highly likely that at some point a project will need something similar but this time .pdf files are what you are looking for or maybe even a user defined extension or all directories etc... The most important thing about being a good developer in any language is your ability to take a complex problem and break it down into small enough parts that any monkey with a little bit of programming knowledge and a search engine can figure out how to code each step. Now as you get more experienced you might find that for certain things you just know how to do that and you do not need to write it all down as you can just do it in your head. But having worked with people that wrote amazingly complex code form one of the developers
Re: [getting PAUSE account]
Just my two cents on this. There is no sense in putting one language over another if it is for personal use. In those cases use what you want and what you feel is best suited to your needs. You might Choose Perl as you are familiar with it and you need to process lots and lots of text for your project. On the other hand you might want to use PHP because the thing that you are trying to do is to extend an existing open source project with some cool function and it happens to be written in PHP. Maybe python is your poison of choice because you want to learn the language a bit better or feel that the modules related to AI are really useful and more mature in Python then they are in PHP and Perl. From that perspective it does not matter what you pick as there is no one that will tell you you were wrong and even when you end up telling yourself that it is only your time that you spend going down a path less fruitful than you had initially expected. But when you are looking at a business context you are most often forced into a certain language because of reasons well outside of your control. The project already is written in Ruby, Python or Java. The new project must be written in Rust since someone upstairs has heard it is the best language ever and has decided all new projects will be written in Rust etc... Even if you are the one to make the choice of language you are often forced into a particular direction because there are only 3 people in the organization that know Smaltalk and there are 300 that are good with Java and C#. Also making the wrong decision can be very expensive since it is there is the ongoing maintenance cost and the cost of hiring people with the appropriate skills but also the cost of interfacing with newer technologies in the future a language like Perl that has seen its usage shrink an awful lot over the years will be far less likely to have well written and highly performant solutions for interfacing with the latest and greatest technology simply because the number of companies needing this and the number of individuals with the required knowledge and time to write those solutions is far smaller making it less likely that this will be done quickly. As for practicing Perl, the biggest problem that I always found with Perl when learning the language (long before github and such were around) is that it was hard to find projects that I could contribute to. But these days with github and gitlab for instance it is so much easier to find an interesting project to work on a good place to start would be: https://github.com/topics/perl these are open source projects that will welcome contributions, not all of them will have a issue tracker I guess but those that do make it very easy to see what kinds of things actual users are asking for or running into. I would suggest not looking at bugs but at feature requests and seeing if there is anything that you feel makes sense or could be fun, pay attention to what the core developers comment on the request as they might have reasons for not wanting to implement it. But usually it is just a lack of time that makes feature requests stay open. Initially it will seem very daunting to just pick up some random project and other people's code and it can be a challenge but also good fun. You might feel that you are nowhere near good enough to work on this or that just yet but with a little patience and a bit or a lot of effort you will find that there is no problem that you cannot tackle. It is all about you having the interest in and the time for completing the task you set yourself. You might very well find that someone else has implemented a solution for the same problem by the time you are done with it. That is great as you can see how someone else solved the problem and maybe learn from their efforts or find that your solution is better as theirs will not work in this or that case for instance. The main thing is to just get stuck in and to have fun doing it, if it is not fun you picked the wrong project or the wrong task or maybe even the wrong language to work in, some languages are far less fun to work in than others. As a final hint, have a look at the documentation if there is any that describes coding standards as there are enough people with strong opinions about things like "unless" or bracket placement for instance that even a great solution might end up getting rejected based on not meeting the coding standards of the project you are working on. On Mon, Jan 1, 2024 at 5:09 PM Mike wrote: > > That is true. I don't see the appeal with Python, but > I have barely dabbled in it. I code for me and I know > Perl. I don't have the motivation to learn a new language. > Perl works well, so I use it. > > > Mike > > > On 12/25/23 22:05, William Torrez Corea wrote: > > > I am a beginner, I am learning of the book Beginning Perl by Curtis "Ovid" > Poe. I am learning subroutines. > > I want to develop a program or work in a project where the
Re: Preference
In this day and age Kotlin is probably your best bet but if you take on Java you are 90% there with regards to Kotlin. As for Perl, unless you are in a very specific niche Perl is pretty much dead as a commercially viable option as there are too few people that are halfway decent at it so no company would be silly enough to build a large project based on Perl these days. It lacks a lot of the modern conveniences that Java for instance offers. The chances of finding an up to date library for interaction with any modern software package are virtually zero and a lot of people that are not very good at perl have written a lot of very ugly code that is near unreadable and certainly not maintainable giving the language a very poor reputation in the overall software development community. Now that is not to say Perl cannot still be a great language to learn and have fun with. There are still, albeit niche, areas where you will find perl used certainly in the EDI (Electronic Data Interchange space for instance) Perl is still a commonly sought after skill. And as time progresses people with these skills will get more and more rare allowing those that possess this arcane knowledge to charge an arm and a leg for their services much like Cobal developers and Mainframe specialists do now. Keep in mind that Perl is written by a linguist and as such (especially for English speakers) has a very natural syntax making it easy to learn. At the same time and this is where the ugly code syndrom comes in, it is extremely flexible with regards to syntax making it very easy to construct pretty ugly code. Because just like in natural language there are many ways to say the same thing and though they all are syntactically correct most are ugly or worse quite confusing. As with any language Perl can be great and quite nicely written but even in its heyday those who wrote beautiful Perl code where rare, these days the majority of people writing Perl for commercial purposes come from other languages and are forced to write Perl out of necessity rather than desire. So the quality of their code is often less than they would find acceptable in their language of choice. So if you do go down the Perl route expect to have to deal with ugly code an awful lot and unfortunately quite a few "real" developers that look down on someone that still practices the dark arts as they believe Perl to be slow, near impossible to maintain and not a real programming language. So my advice is start with Java if you are planning on working in the IT world (way more job opportunities even for very inexperienced people). Do Perl on the side and when you have proven yourself as a developer and like to write in Perl you can always look for a job where you get to practice the dark arts. Doing it the other way around you will find far less opportunities, and often a demand for quite senior people as the existing code is ancient there is no one else that can read it and it is used in a quite critical operation. On Sun, Oct 29, 2023 at 2:14 AM Claude Brown via beginners < beginners@perl.org> wrote: > I’d go with Java, in order: > > > >- Popularity – there is just more stuff being written in Java. This >would indicate the employment options are greater. > - https://www.tiobe.com/tiobe-index/ > - Java currently rates 4th vs Perl at 27th > > > >- Over the long arc, Java probably has a faster learning curve. As >much as I love Perl, it has some rather arcane syntax at times. > > > > I’m sure you will get many opinions to the contrary on a Perl mailing list > > > > > FWIW, I’d wildly guess the following for my coding time: > >- 90% using Perl >- 9% using PHP/JavaScript for web-pages >- 0.9% in, say, C++ or C >- 0.09% in Java or C# > > > > The rest of the time I slack off. > > > > Cheers, > > > Claude. > > > > > > > > *From:* William Torrez Corea > *Sent:* Sunday, October 29, 2023 8:46 AM > *To:* Perl Beginners > *Subject:* Preference > > > > *CAUTION:* This email originated from outside of the organization. Do not > click links or open attachments unless you recognize the sender and know > the content is safe. > > What is preferable to learn? > > > > Java or Perl > > > > What is the learning curve of this language of programming? > > > -- > > > With kindest regards, William. > > ⢀⣴⠾⠻⢶⣦⠀ > ⣾⠁⢠⠒⠀⣿⡁ Debian - The universal operating system > ⢿⡄⠘⠷⠚⠋⠀ https://www.debian.org > ⠈⠳⣄ > >
Re: Please help: perl run out of memory
Hi Wilson,
Looking at the script I see some room for improvement. You currently
declare %hash as a global variable, and keep it around forever. With tens
of millions of rows that is quite a large structure to just have sitting
around after you have build the %stat hash. So I would start by limiting
the scope of the %hash from global to only till %stat has been filled. Of
course then there is the posibility of swapping the key and the value in
your stats hash, making the value an array of item ids or even a string of
item ids (might make sense if you do not expect to ever print all of them
in a list but only a top 1000 or so.
As for sorting a hugh hash in memory there comes a point where one has to
decide if Perl is the right tool for the job. It can probably do the job
but much like you can hammer a nail into a wall with a swiss armyknife Perl
is likely not the best tool for the job here. Looking around I see mostly
people advising to use a DB solution of some description be that Berkley
DB, SQLite or similar relatively simple database solutions you are likely
going to find this a much faster option than using pure Perl for sorting
such large hashes.
The reason why Spark is so much faster at this and more memory efficient at
the same time is that it has been designed to handle huge datasets like
this which very often need to be sorted or counted in some way. Though you
can definetely get the same output using Perl you will likely find that you
are looking at a nail while holding a swiss armyknife.
Just generally speaking having any variable sticking around for any length
of time after you are done with it is bad prectice in all languages. In an
interpeted language such as perl there is no way for an optimization step
to know you are never going to use this variable again so Perl is likely
going to hold on to the variable till the program exists where in a
compiled language an compiler might be able to see that this is the last
time this variable is used thus evict it from memory on your behalf but
that is only possible in some cases in many others such optimisations are
not going to kick in as the compiler cannot be certain that this function
that uses the variable is never going to be called again for instance. This
is why global variables in all languages are generally a bad idea but in
interpeted languages even more so.
Hope that helps a bit,
Rob
On Sun, Apr 17, 2022 at 8:00 PM David Mertens
wrote:
> I see nothing glaringly inefficient in the Perl. This would be fine on
> your system if you were dealing with 1 million items, but you could easily
> be pushing up against your system's limits with the generic data structures
> that Perl uses, especially since Perl is probably using 64-bit floats and
> ints, and storing the hash keys twice (because you have to hashes).
>
> You could try to use the Perl Data Language, PDL, to create large typed
> arrays with minimal overhead. However, I think a more Perlish approach
> would be to use a single hash to store the data, as you do (or maybe using
> pack/unpack to store the data using 32-bit floats and integers). Then
> instead of using sort, run through the whole collection and build your own
> top-20 list (or 50 or whatever) by hand. This way the final process of
> picking out the top 20 doesn't allocate new storage for all 80 million
> items.
>
> Does that make sense? I could bang out some code illustrating what I mean
> if that would help.
>
> David
>
> On Sun, Apr 17, 2022, 5:33 AM wilson wrote:
>
>> hello the experts,
>>
>> can you help check my script for how to optimize it?
>> currently it was going as "run out of memory".
>>
>> $ perl count.pl
>> Out of memory!
>> Killed
>>
>>
>> My script:
>> use strict;
>>
>> my %hash;
>> my %stat;
>>
>> # dataset: userId, itemId, rate, time
>> # AV056ETQ5RXLN,031887,1.0,1397692800
>>
>> open HD,"rate.csv" or die $!;
>> while() {
>> my ($item,$rate) = (split /\,/)[1,2];
>> $hash{$item}{total} += $rate;
>> $hash{$item}{count} +=1;
>> }
>> close HD;
>>
>> for my $key (keys %hash) {
>> $stat{$key} = $hash{$key}{total} / $hash{$key}{count};
>> }
>>
>> my $i = 0;
>> for (sort { $stat{$b} <=> $stat{$a}} keys %stat) {
>> print "$_: $stat{$_}\n";
>> last if $i == 99;
>> $i ++;
>> }
>>
>> The purpose is to aggregate and average the itemId's scores, and print
>> the result after sorting.
>>
>> The dataset has 80+ million items:
>>
>> $ wc -l rate.csv
>> 82677131 rate.csv
>>
>> And my memory is somewhat limited:
>>
>> $ free -m
>>totalusedfree shared buff/cache
>> available
>> Mem: 1992 152 76 01763
>>1700
>> Swap: 1023 802 221
>>
>>
>>
>> What confused me is that Apache Spark can make this job done with this
>> limited memory. It got the statistics done within 2 minutes. But I want
>> to give perl a try since it's not that convenient to run a spark job
>> always.
>>
>>
Re: question about perl script
This should do:
#!/usr/bin/perl
use strict;
use warnings;
open my $a, '<:encoding(UTF-8)', 'a' or die "Unable to open a: $!";
open my $b, '<:encoding(UTF-8)', 'b' or die "Unable to open b: $!";
my %pair = ();
while ( my $line = <$a> ) {
my @line = split(" ", $line);
$pair{$line[0]} = 1;
}
while ( my $line = <$b> ) {
my @line = split(" ", $line);
if ( $pair{$line[0]} ) {
next;
} else {
print $line
}
}
close $a;
close $b;
A bit simplified of course using strict because as your code grows its the
only way to stay sane.
Now there are a few issues with this, the main one being that this is all
done in memory, so as your files grow you might run into trouble with
memory usage. So you might want to read chunks at a time rather than the
whole file. Also keep in mind that every action (like chomp) takes time
time that in this case is totally not needed, so stripping those pointless
steps out will help make things go faster which certainly as the file sizes
grow will make a difference.
Lastly I would suggest adding comments to the code so you can much more
easily hand this over to the next person that might want to understand what
you are doing or how you are doing that even though you are no longer there
to ask those questions (or after a few years you no longer remember)
Regards,
Rob
On Wed, Oct 30, 2019 at 7:04 AM Uri Guttman wrote:
> On 10/29/19 10:48 PM, 刘东 wrote:
>
> Dear every one:
> I try to write a perl script to delet the content of file
> carp01_1_both.txt as same as from another file
> carp-carp01_TKD181002053-1_1_sg.txt, so to get a new file from file
> carp-carp01_TKD181002053-1_1_sg.txt but excluding file carp01_1_both.txt.
> However, when I run this scrip, it does not work, and display the
> information as follows:
> ...
> Semicolon seems to be missing at carp01_1_both.txt line 44993.
> Number found where operator expected at carp01_1_both.txt line 44994, near
> "55659 1"
> (Missing operator before 1?)
> Number found where operator expected at carp01_1_both.txt line 44994, near
> "ATCACG55"
> (Do you need to predeclare ATCACG?)
> Number found where operator expected at carp01_1_both.txt line 44994, near
> "55116"
> (Missing operator before 116?)
> syntax error at carp01_1_both.txt line 1, near "979:"
>
>
> it appears that perl is trying to compile one of your data files. show the
> command line where you run your script
>
>
> perl script:
> #!/usr/bin/perl -w
>
> better to use warnings than -w. also use strict is important
>
> open(NAME,"<$ARGV[0]")|| die;
> open(SECON,"<$ARGV[1]")|| die;
> open(SELEC,">$ARGV[2]")|| die;
>
> your die lines should say which file failed to open
>
> uri
>
>
Looking for a lightweight usable websocket server
Hi all, I'm working on a simple (or so I thought) project to build a websocket server that broadcasts data the server receives via a telnet connection. So a telnet connection is easily setup and messages are simple to relay to any file handle. But now comes the harder part. A websocket server seems to generally be build to do one thing and one thing only in perl and that is respond to incoming data. Running in an infinite loop attaching event handlers to data that is received. At least Net::Websocket::Server works that way. Could any of you advice me a better library? I don't mind having to mess about with Protocol::Websocket myself but if there is a good lightweight library out there (not forcing me to install tons and tons of other libraries would be good) I would much rather use that. Thanks for any help pointer or tips.
Re: obfuscating code
Are we really spiraling into a discussion on the merits of open versus closed source? Perl is a scripting language, it was create by a linguist which it is why it allows for so many different ways to get the code to do the same thing. It is like a language very flexible in many ways. Obfuscating code is not a good idea for the nice market that Perl inhabits it is as simple as that. If you want to do something like lets say quantum super positioning then sure that could be done in Perl. But even the author of that module stated that it was a pretty silly thing to do in Perl as it was simply not meant to do such things. Other scripting languages try (wrong or right that's up to you) to be everything to all people and for large part are beginning to loose sight of the scripting language that they are at their core. More and more these languages are attempting to compete with the Java's of this world who in its own right is trying to take the place of C/C++. Personally I am of the opinion that most programming languages have a good reason for existing, there is a problem domain in which they are simply the best tool in the box. But the idea that a lot of modern languages seem to try is to be the only tool in the box which in my opinion is totally wrong. The reason why most Perl people will tell you obfuscation in Perl is simply not right and should not be done is because the problem domain that Perl covers is not on in which obfuscation is the way you should go. If you are inventing something so extraordinary or exceptional that you absolutely need to protect your code from prying eyes then you should wonder if you should be using Perl for this. I know learning another language is not the most fun or exciting bit of writing code but sometimes that other language is simply much better suited to deal with the problem you are trying to tackle. Regardless of where you stand in the open source vs. closed source discussion, I think we can all agree that code obfuscation is simply not something that Perl the Perl authors or a rather substantial portion of the Perl community support. Therefore you might want to try and build some tool that does obfuscate your code for you if you really need it and cannot change the language you are working in for what ever reason. But I seriously doubt you will see a large portion of the Perl community supporting your efforts. Not unlike the tools that turn Perl scripts into binary files ready to be executed on a platform of your choice (during compile time of course) an obfuscation tool will be used for sure, but there is not a wide spread believe within the Perl community that this is the right thing to do with Perl. The main argument being there are better languages to do that in. On Wed, Feb 13, 2013 at 8:49 PM, Bob McConnell r...@cbord.com wrote: People have been selling both Open Source and Free Software for years. Both IBM and RedHat are doing very well at it. But they don't always require cash or monetary profit as their selling price. You might also want to consider this article about the open source economic model. http://lxer.com/module/newswire/ext_link.php?rid=180777 bm -Original Message- From: Octavian Rasnita [mailto:orasn...@gmail.com] Sent: Wednesday, February 13, 2013 12:53 PM To: Bob McConnell; Perl Beginners Subject: Re: obfuscating code From: Bob McConnell r...@cbord.com You cannot obfuscate the input to an interpreter. It has to be in a format that the interpreter will recognize, which necessarily means that people can also read it. If you really need to hide your source code, you have to switch to a compiled language with an actively optimizing compiler. I don't think that a Perl programmer can't hide his source code well enough, and if he wants to do that, he needs to switch to another language. If he created a Windows executable nice packaged in a setup.exe installer and wants to sell it for $10 - $20, then hiding the source code might help. If he just says that the users should pay $10 for using that program provided as source code, somebody who knows a little Perl could pay for it, then change the name of the program, eventually do some cosmetic changes in the source code, package it using ActiveState PDK and sell it as a new program that competes with the original one. Some may even like to do this to show that they are great programmers and that they created an application. If getting the source code is complicated enough, than those who may want to duplicate the program may get bored and abandon the idea. Apple, Microsoft, Oracle, IBM, SAP use to sell proprietary applications and their financial situation is not too bad. :-) I think that if providing everything as open source would have been such a good idea from the financial point of view, they would have provided all their applications as open source for a long time. Octavian -- To
Re: obfuscating code
Hi Bob, The problem with obfuscation is that if does not work. No mater how far you go (all database tables are called Tnumber with every column being Cnumber) all variables being single letter things like $a and @a and %b one that wants to will always be able to read it. The only thing that you are going to achieve is that the people that are unfortunate enough to have to maintain you product will cures you, reverse engineer the code and write a maintainable version to replace your code. I have been supporting various systems for various companies in several different branches of industry for over 13 years now. At all companies I have seen the same thing, some perl script build by a perl guru (often self proclaimed). That is near impossible to read and/or enormously big; often very difficult to work with in terms of the environment requirements, command line options that have to be in a certain order, undocumented command line parameters that might or might not do something. Every single time I ended up having to replace that code with something much simpler cleaner and easier maintain because the old code was simply not able to grow with the companies needs and the previous perl guy had left a long time ago. Obfuscation is not security, it is just a way to get remembered as the guy that left the code that no one could maintain. Even switching to a different language will not help, after all code that gets executed can be reverse engineered. When you slap enough copyrights and other wonderful protection on your code then the mere input and resulting output can be emulated in any language of your choice. In the end the beautiful thing of computers is that given a certain program and a certain input the result of that program combined with that input will always be the same, which means there is no way to hide what you are doing just to make it harder to figure out which as I explained above is never a good idea and your code will normally out live you by many years. And the next person is not going to be singing your praises for making their live miserable thanks to code that no one can figure out. Of course other languages that are compiled for instance make it a little harder to read the code because of this compilation step, but this does not stop people from reading the code it just means they have to take an extra step. Which they will if needed simply because copying a working solution is always better then inventing the wheel all over again. The only semi obfuscation that works a little bit is today's buzzword 'cloud computing' it allows you to keep your code in your own hands away from the customer thus better hidden then ever before. Of course this does not mean that you or me could not for instance build our own Facebook or Google. It will just be a whole lot harder to do as we are missing one important bit of information: the input, at least the bit of input that is running on their servers... But all in all when you end up working for Google or for Facebook you can be certain that the code is not obfuscated as it would not be feasible to maintain a code base of that size with so many people if it where obfuscated. Or as the perl help says, Obfuscation only works if you simply delete the code. All other solutions will simply frustrate those with good intentions and just make it more interesting for those with bad intentions. On Tue, Feb 12, 2013 at 7:39 PM, jbiskofski jbiskof...@gmail.com wrote: I understand that obfuscating code is not a real detriment to a seriously motivated knowledgeable hacker. Yet I still think some security is preferable to no security at all. Also I wish this problem could be attacked somehow other than suggesting to switch to a different language. On Tue, Feb 12, 2013 at 12:32 PM, Bob McConnell r...@cbord.com wrote: You cannot obfuscate the input to an interpreter. It has to be in a format that the interpreter will recognize, which necessarily means that people can also read it. If you really need to hide your source code, you have to switch to a compiled language with an actively optimizing compiler. Then only distribute the output from the compiler. Even then there may be de-compilers or disassemblers that can reconstruct much of your source in readable form. Bob McConnell -Original Message- From: jbiskofski [mailto:jbiskof...@gmail.com] Sent: Tuesday, February 12, 2013 1:30 PM To: timothy adigun Cc: John SJ Anderson; Perl Beginners Subject: Re: obfuscating code I see everyone is eager to judge this as a terrible idea, its the exact same response Ive gotten to this question on mailing lists on IRC. HOWEVER, I think this can be a valid concern. We are always talking about how the best way to shine good light on Perl is writing cool stuff in it. Well Ive actually gone out a built a company that does a HUGE LMS in Perl, its used by over 300K students in Mexico (
Re: Date::Manip question
On Thu, Nov 8, 2012 at 11:56 AM, Marco van Kammen mvankam...@mirabeau.nlwrote: Hi List, ** ** For a logrotation and cleanup script I want to fill the following variables. ** ** my $current_month =(should be Nov) my $current_mont_num = (should be 11) my $previous_month = (should be Oct) my $previous_month_num = (should be 10) ** ** I’ve been looking at the module Date::Manip to get this going, but I can’t seem to get it working. ** ** Any help in the right direction would be appreciated. ** ** With Kind Regards, ** ** ** ** *Marco van Kammen* Applicatiebeheerder *Mirabeau | Managed Services*Dr. C.J.K. van Aalstweg 8F 301, 1625 NV Hoorn +31(0)20-5950550 - www.mirabeau.nl [image: Mirabeau]Please consider the environment before printing this email Hi Marco, For this I would nto bother with Date::Manip but just use time. Something like the below would do perfectly fine... my ($sec,$min,$hour,$mday,$mon,$year,$wday,$yday,$isdst) = localtime(time); my @months = ( 'JAN', 'FEB', 'MAR', 'APR', 'MAY', 'JUN', 'JUL', 'AUG', 'SEP', 'OCT', 'NOV', 'DEC' ); my $current_month = $months[$mon]; my $current_mont_num = $mon; my $previous_month = $months[$mon -1]; my $previous_month_num = $mon -1; print $current_month\n$current_mont_num\n$previous_month\n$previous_month_num\n; Easy enough and without a module needed a lot more portable without a lot of work. Regards, Rob Coops miralogo69b6.pngblank4113.gifleaf1fbe.gifblank20ad.gifblank1c63.gifblank52fd.gif
Re: Date::Manip question
On Thu, Nov 8, 2012 at 12:53 PM, Rob Coops rco...@gmail.com wrote: On Thu, Nov 8, 2012 at 11:56 AM, Marco van Kammen mvankam...@mirabeau.nlwrote: Hi List, ** ** For a logrotation and cleanup script I want to fill the following variables. ** ** my $current_month =(should be Nov) my $current_mont_num = (should be 11) my $previous_month = (should be Oct) my $previous_month_num = (should be 10) ** ** I’ve been looking at the module Date::Manip to get this going, but I can’t seem to get it working. ** ** Any help in the right direction would be appreciated. ** ** With Kind Regards, ** ** ** ** *Marco van Kammen* Applicatiebeheerder *Mirabeau | Managed Services*Dr. C.J.K. van Aalstweg 8F 301, 1625 NV Hoorn +31(0)20-5950550 - www.mirabeau.nl [image: Mirabeau]Please consider the environment before printing this email Hi Marco, For this I would nto bother with Date::Manip but just use time. Something like the below would do perfectly fine... my ($sec,$min,$hour,$mday,$mon,$year,$wday,$yday,$isdst) = localtime(time); my @months = ( 'JAN', 'FEB', 'MAR', 'APR', 'MAY', 'JUN', 'JUL', 'AUG', 'SEP', 'OCT', 'NOV', 'DEC' ); my $current_month = $months[$mon]; my $current_mont_num = $mon; my $previous_month = $months[$mon -1]; my $previous_month_num = $mon -1; print $current_month\n$current_mont_num\n$previous_month\n$previous_month_num\n; Easy enough and without a module needed a lot more portable without a lot of work. Regards, Rob Coops Yeah a minor update... $mon starts counting at 0 so for the current month number add 1 and for the previous month number do not substract 1. :-) my $current_month = $months[$mon]; my $current_mont_num = $mon + 1; my $previous_month = $months[$mon -1]; my $previous_month_num = $mon; blank20ad.gifblank1c63.gifmiralogo69b6.pngblank52fd.gifleaf1fbe.gifblank4113.gif
Re: Fast XML parser?
On Wed, Oct 31, 2012 at 5:39 PM, Jenda Krynicky je...@krynicky.cz wrote: From: Octavian Rasnita orasn...@gmail.com I forgot to say that the script I previously sent to the list also crashed Perl and it popped an error window with: perl.exe - Application Error The instruction at 0x7c910f20 referenced memory at 0x0004. The memory could not be read. Click on OK to terminate the program I have created a smaller XML file with only ~ 100 lines and I ran agan that script, and it worked fine. But it doesn't work with the entire xml file which has more than 200 MB, because it crashes Perl and I don't know why. And strange, but I've seen that now it just crashes Perl, but it doesn't return that Free to wrong pool error. Octavian That must be something either within your perl or the XML::Parser::Expat. What versions of those two do you have? Any chance you could update? Jenda = je...@krynicky.cz === http://Jenda.Krynicky.cz = When it comes to wine, women and song, wizards are allowed to get drunk and croon as much as they like. -- Terry Pratchett in Sourcery -- To unsubscribe, e-mail: beginners-unsubscr...@perl.org For additional commands, e-mail: beginners-h...@perl.org http://learn.perl.org/ The memory issue is really an issue of the module it self I have had those problems as well, the more complex the xml structure the more memory it takes up and the faster you will run out. I simply moved on to other modules as I could not afford to spend my time on trying to figure out a workaround. Regards, Rob Coops
Re: Fast XML parser?
On Mon, Oct 29, 2012 at 9:18 AM, Shlomi Fish shlo...@shlomifish.org wrote:
On Mon, 29 Oct 2012 10:09:53 +0200
Shlomi Fish shlo...@shlomifish.org wrote:
Hi Octavian,
On Sun, 28 Oct 2012 17:45:15 +0200
Octavian Rasnita orasn...@gmail.com wrote:
From: Shlomi Fish shlo...@shlomifish.org
Hi Octavian,
Hi Shlomi,
I tried to use XML::LibXML::Reader which uses the pool parser, and I
read
that:
However, it is also possible to mix Reader with DOM. At every point the
user may copy the current node (optionally expanded into a complete
sub-tree) from the processed document to another DOM tree, or to
instruct the Reader to collect sub-document in form of a DOM tree
So I tried:
use XML::LibXML::Reader;
my $xml = 'path/to/xml/file.xml';
my $reader = XML::LibXML::Reader-new( location = $xml ) or die
cannot
read $xml;
while ( $reader-nextElement( 'Lexem' ) ) {
my $id = $reader-getAttribute( 'id' ); #works fine
my $doc = $reader-document;
my $timestamp = $doc-getElementsByTagName( 'Timestamp' ); #Doesn't
work well
my @lexem_text = $doc-getElementsByTagName( 'Form' ); #Doesn't
work
fine
}
I'm not sure you should do -document. I cannot tell you off-hand how to
do it
right, but I can try to investigate when I have some spare cycles.
OK, after a short amount of investigation, I found that this program works:
[CODE]
use strict;
use warnings;
use XML::LibXML::Reader;
my $xml = 'Lexems.xml';
my $reader = XML::LibXML::Reader-new( location = $xml ) or die cannot
read
$xml;
while ( $reader-nextElement( 'Lexem' ) ) {
my $id = $reader-getAttribute( 'id' ); #works fine
my $doc = $reader-copyCurrentNode(1);
my $timestamp = $doc-getElementsByTagName( 'Timestamp' );
my @lexem_text = $doc-getElementsByTagName( 'Form' );
}
[/CODE]
Note that you can also use XPath for looking up XML information.
Regards,
Shlomi Fish
--
-
Shlomi Fish http://www.shlomifish.org/
List of Text Processing Tools - http://shlom.in/text-proc
Sophie: Let’s suppose you have a table with 2^n cups…
Jack: Wait a second! Is ‘n’ a natural number?
Please reply to list if it's a mailing list post - http://shlom.in/reply .
--
To unsubscribe, e-mail: beginners-unsubscr...@perl.org
For additional commands, e-mail: beginners-h...@perl.org
http://learn.perl.org/
A little late I know but still...
Last year I was asked to process a large amount of XML files 2x 1.6M files
that needed to be compared on a element by element level and with some
fuzzy logic needed to be the same. Things like floating point precision
could change (1.00 = 1) and in some cases data could show up in a different
order (repeating elements for multiple items on an order). The whole idea
was system A that took flat text output from a mainframe and translated
this to XML for consumption by a web service was being replaced by system B
that did the same thing but on a entirely different software stack.
Of course this needed to go as fast as possible as we simply could not sit
around for a few days while the computer did it's thing. LibXML was my
saviour and using XPath was the fastest solution. Though it is possible to
do the DOM thing you end up with the DOM being translated to XPath under
the hood (at least the performance seemed to indicate that). After a lot of
testing and using pretty much any XML parser I could find using LibXML and
XPath was really the fastest.
If you are going for speed then you will want to avoid any copy operations
you can and you will want to as much as possible use references. Because
even though a memory copy of some 100 bytes is a very fast operation on a
few million files the the little time it takes kind of adds up to a lot
longer then you would like it to.
When you are looking at speed first and foremost try and avoid anything
that would slow you down. A copy of information is slow so don't do it if
you can avoid it. A reference to a memory location is slightly harder to
work with in programming but a lot faster. A translation from DOM to XPath
would take you time to do, the computer needs the same time. If it is pure
speed you are after avoid this as well.
If you are sure you are as fast as you can be add a benchmark to the code
and try individual optimisations that might or might not be faster... you
would be surprised how the perl internals sometimes are a lot faster with
some operations then with others even though feeling wise you would not
have expected this to be the case.
For my case as it was a once in every 25 years kind of major change I
didn't do to much benchmarking as the code would be discarded at the end of
the project. (well stored in a dusty old SVN repository for others to reuse
and never to be looked at again realistically) I got it to go fast enough
for a
Re: Using alarm
On Fri, Oct 26, 2012 at 4:46 PM, Unknown User knowsuperunkn...@gmail.comwrote:
I have code that goes something like this:
my $start = time();
my $delay = 60;
...
while (my $line = $fh) {
my $err;
...
...
my $timenow = time();
if ( $timenow - $start = $delay ) {
$start = $t;
dumpstats($err);
$err = {};
}
}
...
I wonder if it would be possible to replace this loop with a handler
based on alarm.
If it is possible, which would be more efficient?
Thanks
--
To unsubscribe, e-mail: beginners-unsubscr...@perl.org
For additional commands, e-mail: beginners-h...@perl.org
http://learn.perl.org/
Possible most certainly, desirable maybe...
Here is the main thing your loop can run for an x number of seconds 60 at a
minimum or 120 maybe even 120 as your code might not get to the end of
the loop before then. Using alarm or any type of module based on this
function will ensure that you will perform the same action a lot closer to
your desired 60 second mark. Using Time::HiRes will allow you to specify
less then seconds which might be interesting in some cases (then you will
use the ualarm call instead of allarm)
Hope that helps a little,
Rob
Re: My script is...
On Fri, Sep 14, 2012 at 2:52 PM, jmrhide-p...@yahoo.com wrote: I appreciate the helpful input. It appears from my server stats that the script in question has only run a couple of times a day on average, so that's fewer than a thousand instances in the past year. I ran LOTS of tests of the script, none of which hung or produced unexpected output. If the output was as expected, then the script had to execute correctly to the end of the output stage at least. But the only thing after that is a brief sub that advises the user that they must enable cookies in order to use the script. If that code were executing, then the output I see when I run the script would not be as expected. The While(1) loops all occur PRIOR to the output stage. All they do is generate a random integer, make sure it's not the same as the last one, and move on. So I still don't get it! John M Rathbun MD Hi John, Basically every one on this list has said the same. The script is a mess it is hard to read hard to maintain and should be cleaned up before we can really comment on this. To not be to rude to you script it looks like it was run over by a truck, repeatedly. You might have applied a good dose of ducktape and staples but it is simply not really maintainable anymore. It actually is bad enough for everyone to say please clean it up before asking for help as we just can't read it. And these are for a large part perl professionals writting code on a daily basis... On top of that it could very well be that you script in your development environment is running on a different version of Apache or Perl also it could very well be that the modules installed in the production environment Apache (mod_perl maybe?) are the cause of all these troubles. In any case I would advise the same as every one else did before, clean up the script first so it is a lot simpler to read. After that figure out what modules you production Apache is running with and identify their potential impact on your script by running these your self or reading the documentation of course (though you will always have to prove what you read in the documentation in the real world so a lot of us are at least tempted to skip the boring reading bit). If none of that helps (I am reasonably sure it will) have a look at the Perl version your provider is using and make sure that you are using the same version as well there might be a difference there. Regards, Rob Coops
Re: hash of arrays sorting
On Thu, Aug 23, 2012 at 9:10 AM, Uri Guttman u...@stemsystems.com wrote:
On 08/23/2012 02:54 AM, Salvador Fandino wrote:
It's a pity Sort::Maker not in Debian
There is also Sort::Key, available in Debian testing and unstable, and
which is usually faster than Sort::Maker and also Sort::Key::Radix, even
faster when sorting by numeric keys but not available in Debian.
use Sort::Key qw(ukeysort);
my @sorted = ukeysort { /^(\d+)-(\d+)/
or die bad key $_;
$1 * 100 + $2 } @data;
The 'u' prefix in 'ukeysort' specifies that the sorting key is an
unsigned integer.
you are comparing apples and oranges. your module provides numerous
specialized sort subs (like php does) which means the coder has to remember
or lookup what each one does. i counted at least 32 similarly names subs
which is very confusing. having a single sub with a flexible api is a much
better interface.
your claim for it being faster needs backing with benchmarks with multiple
keys. single key sorts are fast with just the sort function as is. since
your multikey sorts must use a map/sort/map method, again showing how they
are faster then the GRT would be interesting.
uri
--
To unsubscribe, e-mail: beginners-unsubscr...@perl.org
For additional commands, e-mail: beginners-h...@perl.org
http://learn.perl.org/
As said before is all needs benchmarking to see what is really faster and
how much faster actually (a 1% increase in time but a much easier interface
or far less dependencies could be preferable in some cases). If I had to
deal with this I would probably use the map, sort, map solution proposed
before as this solution is available on all platforms and therefore highly
portable (in the environment I work in there is a range of perl versions
from 5.005 to the latest release on a wide range of operating systems)
As for faster or slower, have a look at the size of the hash you are
sorting, if the hash only has a few hundred keys the speed difference might
not even be noticeable (a few ms more or less in a long running process is
not going to be noticed). On the other hand is there is tens of thousands
of keys and the sorting time is reduced an awful lot with this sort being
the main time consumer within the overall process... It might be worth
installing the module even if it is a slightly painful thing in some
environments.
Regards,
Rob
Re: How to format the data ??
On Wed, Aug 22, 2012 at 4:39 PM, jet speed speedj...@googlemail.com wrote:
Hi All,
Please advice me on now to capture the data below in the format as below.
i thought of using hash, but then the problem is each DisplayDevNum has
multiple WWN. some has 4 elements, some has 2. Any other method ?
Apprecaite your comments.
i want to caputre in the below format.
DisplayDevNum and its corresponding WWN=10:00:00:00:c9:c9:xx:xx and
nickname= x
DisplayDevNum and its corresponding WWN=10:00:00:00:c9:c9:xx:xx and
nickname= x
DisplayDevNum=1D:D4
domainID=7
devNum=8,888
List of 4 WWN elements
WWN=10:00:00:00:c9:c9:89:8c
nickname=res-abc
WWN=10:00:00:00:c9:c9:89:8b
nickname=res-abd
WWN=10:00:00:00:c9:c9:89:8a
nickname=res-a33
WWN=10:00:00:00:c9:c9:89:8i
nickname=res-34
DisplayDevNum=1D:D9
domainID=7
devNum=8,888
List of 2 WWN elements
WWN=10:00:00:00:c8:c9:89:8f
nickname=res-a1
WWN=10:00:00:00:c9:c9:89:81
nickname=res-a33
Sj
Hi Sj,
The hash idea is a good one but it is going to be a little bit more complex
then a simple hash. You will first need to record the DisplayDevNum (and
remember it, then find all the underlying information and associate it with
the DisplayDevNum.
The following example does just that:
use strict;
use warnings;
use Switch;
use Data::Dumper;
my $DisplayDevNum_tracker;
my $WWN_tracker;
my %complex_hash;
open my $fh, , text.txt or die $!;
while ( $fh ) {
chomp;
my $line = $_;
my ( $key, $value ) = split/=/,$line;
switch ( $key ) {
case 'DisplayDevNum' { $DisplayDevNum_tracker = $value; $complex_hash{
$value } = {}; }
case 'domainID' { $complex_hash{ $DisplayDevNum_tracker
}{'domainID'} = $value; }
case 'devNum'{ $complex_hash{ $DisplayDevNum_tracker }{'devNum'}
= $value; }
case 'WWN' { $WWN_tracker = $value; $complex_hash{
$DisplayDevNum_tracker }{ $value } = {}; }
case 'nickname' { $complex_hash{ $DisplayDevNum_tracker }{
$WWN_tracker } = $value; }
}
}
print Dumper %complex_hash;
In short open the file loop over it one line at a time, remove the
linefeed. Then split on the = sign automatically dropping lines you do not
care about. Then using a switch statement figure out what type of line you
are dealing with.
If it is a DisplayDevNum line remember the value. if the key is anything
else use the remembered DisplayDevNum to associate the new data with it. If
the WWN line is found remember the value and once you get to the nickname
associate this with the remembered WWN value.
Printing it all out you get a hash that looks like this:
$VAR1 = '1D:D9';
$VAR2 = {
'devNum' = '8,888',
'domainID' = '7',
'10:00:00:00:c9:c9:89:81' = 'res-a33',
'10:00:00:00:c8:c9:89:8f' = 'res-a1'
};
$VAR3 = '1D:D4';
$VAR4 = {
'10:00:00:00:c9:c9:89:8a' = 'res-a33',
'devNum' = '8,888',
'domainID' = '7',
'10:00:00:00:c9:c9:89:8b' = 'res-abd',
'10:00:00:00:c9:c9:89:8c' = 'res-abc',
'10:00:00:00:c9:c9:89:8i' = 'res-34'
};
Which is I believe what you are looking for right?
Regards,
Rob
Re: search and replace
On Thu, Aug 16, 2012 at 10:55 AM, Gergely Buday gbu...@gmail.com wrote: Here is the correct version: #!/usr/bin/perl $csproj_text = C:\\build.txt; $csproj_text =~ s/\\//g; print $csproj_text\n; Notice that in order to put a literal backslash into a perl string, you should escape it. In your original program, you have put a \b, a bell character into the string. - Gergely On 16 August 2012 10:48, Irfan Sayed irfan_sayed2...@yahoo.com wrote: hi, i have following code to search single \ and replace it with \\ but it is not doing as expected: $csproj_text = C:\build.txt; $csproj_text =~ s/\\//g; print $csproj_text\n; the output is : Cuild.txt instead the output should be : C:\\build.txt can someone please suggest, what is the wrong ? regards irfan -- To unsubscribe, e-mail: beginners-unsubscr...@perl.org For additional commands, e-mail: beginners-h...@perl.org http://learn.perl.org/ That or replace the with ' and all wil be fine. $csproj_text = 'C:\build.txt'; $csproj_text =~ s/\\//g; print $csproj_text\n; Regards, Rob
Re: case statement in perl
On Wed, Aug 1, 2012 at 9:08 AM, Paul.G medur...@yahoo.com.au wrote:
The example below is just a test, I need to be able to insert multiple
values into a command, those values can be either 1, 2 or upto 5.
Below is closer to the working example, but I will read that document and
to help make a final decision.
# Check Free PV's
operation_CHECKFREEPVS();
$NEWMIRROR = $MIRROR + $numPV;
if ($numPV ne 0 $MIRROR le 5) {
# lvextend
print $numPV $NEWMIRROR $MIRROR\n;
switch ($numPV) {
case 1 { run(/usr/sbin/lvextend -m $NEWMIRROR -s $sourcelv
$FreePV[0]); }
case 2 { run(/usr/sbin/lvextend -m $NEWMIRROR -s $sourcelv
$FreePV[0] $FreePV[1]); }
case 3 { run(/usr/sbin/lvextend -m $NEWMIRROR -s $sourcelv
$FreePV[0] $FreePV[1] $FreePV[2]); }
case 4 { run(/usr/sbin/lvextend -m $NEWMIRROR -s $sourcelv
$FreePV[0] $FreePV[1] $FreePV[2] $FreePV[3]); }
case 5 { run(/usr/sbin/lvextend -m $NEWMIRROR -s $sourcelv
$FreePV[0] $FreePV[1] $FreePV[2] $FreePV[3] $FreePV[4]);
}
}
# lvsync
run(/usr/sbin/lvsync -T $sourcelv);
logprint Successful $NEWMIRROR mirrors \t\t synced;
}
else {
cleanexit (10, FAIL \t\t No Free PV's Available);
}
return 0;
}
From: John W. Krahn jwkr...@shaw.ca
To: Perl Beginners beginners@perl.org
Sent: Wednesday, 1 August 2012 4:58 PM
Subject: Re: case statement in perl
Paul.G wrote:
Below is an extract from the perl script, the switch/case statement
seemed like a simple solution.
# Mail Program #
operation_CHECKFREEPVS();
print $numPV \n;
# print $FreePV[1] $FreePV[0] $numPV\n;
if ($numPV ne 0 ) {
switch ($numPV) {
case 1 { print $FreePV[0] \n; }
case 2 { print $FreePV[0] $FreePV[1] \n; }
case 3 { print $FreePV[0] $FreePV[1] $FreePV[2] \n; }
}
}
Couldn't you just do that like this:
if ( @FreePV @FreePV = 3 ) {
print join( ' ', @FreePV ), \n;
}
else {
print No PV's available \n;
}
John
--
Any intelligent fool can make things bigger and
more complex... It takes a touch of genius -
and a lot of courage to move in the opposite
direction. -- Albert Einstein
--
To unsubscribe, e-mail: beginners-unsubscr...@perl.org
For additional commands, e-mail: beginners-h...@perl.org
http://learn.perl.org/
Why make life so hard as John suggested you check for the number of
arguments and as long as it is less then 5 you simply join them with a
space and you are done with a single line...
No matter what you do you will always have to check the variables that you
are going to push out, right now I could very well feed a parameter that
ends in a ; and then do something like *rm -rf /* which could make a
serious mess of your system...
Personally I would suggest checking the command flags if they are valid,
and do not contain any funny characters before even considdering putting
this in a system call or equivalent.
Regards,
Rob
Re: read file attributes
On Mon, Jul 30, 2012 at 1:24 PM, Irfan Sayed irfan_sayed2...@yahoo.comwrote: hi, i need to access the attributes of file. more precisely, i need to check if the file is digitally signed or not for example; if i right click on file, then i need to check if the digital signature tab is there or not for that specific file and valid certificate is there. please suggest if any perl module is available to get this info regards, irfan Hi Ifran, It would help if you indicate the platform you are working on :-) Now I assume you are working on windows and in that case I would guess (never needed this myself so I can't say for sure) that *Win32API::Filehttp://search.cpan.org/~chorny/Win32API-File-0.1200/File.pm *should do the trick. After all is offers a direct interface to the windows file API and therefore should be able to provide you what you are looking for. Regards, Rob
Re: Multiprocessing script
On Thu, Jul 26, 2012 at 11:01 AM, Shlomi Fish shlo...@shlomifish.orgwrote:
Hi Punit,
a few comments on your code.
On Thu, 26 Jul 2012 10:17:13 +0530
punit jain contactpunitj...@gmail.com wrote:
Hi,
Below is my script where alarm is generated after 15 sec and changes the
global variable in parent from 0 to 1. Is there any mistake in my
multiprocess approach with time-based stop ?
#!/usr/bin/perl
use strict;
use warnings;
use Parallel::ForkManager;
It's good that you're using strict and warnings, but you lack more
empty
lines between paragraphs in your code.
my $MAX_PROC=2;
$|++;
my $stopFlag=0;
You should use IO::Handle-autoflush(1) instead of $|++ for clarity.
main();
sub main {
preprocess(@ARGV);
multiproc($MAX_PROC, @ARGV);
}
Your indentation is bad. Where is preprocess() defined? Moreover, I should
note
that passing @ARGV directly to subroutine smells of lack of separation of
concerns.
sub multiproc {
my $proc=shift;
Your indentation is bad and you need spaces surrounding the =.
my $argu = $ARGV[0];
Don't use $ARGV[0] directly:
http://perl-begin.org/tutorials/bad-elements/#subroutine-arguments
open(USRFILE, $argu) or die cant open $!;
1. Don't use bareword file handles.
2. Use three-args opens.
3. Don't surround strings with quotations.
See:
* http://perl-begin.org/tutorials/bad-elements/#vars_in_quotes
* http://perl-begin.org/tutorials/bad-elements/#open-function-style
You also should use a more descriptive and cohernet name than USRFILE and
also
see:
http://perl-begin.org/tutorials/bad-elements/#calling-variables-file
my $pmgr = Parallel::ForkManager-new($
proc);
$pmgr-run_on_finish(
sub { my ($pid, $exit_code, $ident) = @_;
Don't put the argument unpacking on the same line as the {.
print ** $ident just got out of the pool ** with PID $pid and
parent pid as $$ exit code: $exit_code\n;
}
);
$pmgr- run_on_start(
sub { my ($pid,$ident)=@_;
Again, and you have a space after the -.
print ** $ident started, pid: $pid **\n;
}
);
$SIG{ALRM} = sub { $stopFlag = 1; };
alarm(16);
while(my $user = USRFILE) {
chomp($user);
print value of Stop Flag in parent $0 is $stopFlag\n;
if($stopFlag == 1) {
print stop flag has been set\n;
last;
}
Just use if ($stopFlag) here.
my $id = $pmgr-start($user) and next;
print value of Stop Flag in child $id is $stopFlag\n;
sleep(7);
$pmgr-finish($user);
}
print Waiting for all children to exit\n;
Again - bad indentation.
Regards,
Shlomi Fish
$pmgr-wait_all_children();
alarm(0);
print All children completed\n;
}
This is what I get output : -
perl mprocess.pl /tmp/list1
value of Stop Flag in parent mprocess.pl is 0
value of Stop Flag in child 0 is 0
** te...@test.com started, pid: 21777 **
value of Stop Flag in parent mprocess.pl is 0
value of Stop Flag in child 0 is 0
** te...@test.com started, pid: 21778 **
value of Stop Flag in parent mprocess.pl is 0
** te...@test.com just got out of the pool ** with PID 21777 and parent
pid
as 21776 exit code: 0
** te...@test.com just got out of the pool ** with PID 21778 and parent
pid
as 21776 exit code: 0
value of Stop Flag in child 0 is 0
** te...@test.com started, pid: 21811 **
value of Stop Flag in parent mprocess.pl is 0
value of Stop Flag in child 0 is 0
** te...@test.com started, pid: 21812 **
value of Stop Flag in parent mprocess.pl is 0
** te...@test.com just got out of the pool ** with PID 21811 and parent
pid
as 21776 exit code: 0
** te...@test.com just got out of the pool ** with PID 21812 and parent
pid
as 21776 exit code: 0
value of Stop Flag in child 0 is 0
** te...@test.com started, pid: 21832 **
value of Stop Flag in parent mprocess.pl is 0
value of Stop Flag in child 0 is 0
** te...@test.com started, pid: 21833 **
value of Stop Flag in parent mprocess.pl is 0
** te...@test.com just got out of the pool ** with PID 21832 and parent
pid
as 21776 exit code: 0
** te...@test.com just got out of the pool ** with PID 21833 and parent
pid
as 21776 exit code: 0
value of Stop Flag in child 0 is 1
** te...@test.com started, pid: 22030 **
value of Stop Flag in parent mprocess.pl is 1
stop flag has been set
Waiting for all children to exit
** te...@test.com just got out of the pool ** with PID 22030 and parent
pid
as 21776 exit code: 0
All children completed
The concern here is I see value of stopflag as 1 for child before the
parent which is a bit wierd:-
value of Stop Flag in child 0 is 1
** te...@test.com started, pid: 22030 **
value of Stop Flag in parent mprocess.pl is 1
Thanks and Regards.
--
Re: How to zip all files which are value from awk command ?
On Thu, Jul 26, 2012 at 12:05 PM, Jack Vo jacksvo2...@gmail.com wrote:
Hi all,
I need to compress many files in a directory on server. I use awk and
zip command to compress these files.
By awk command, I filter theses file :
*# ls -latr | grep iMAP.med0 | awk '{print $9}'*
iMAP.med0101_agent.trace.**20120726153046.tar.gz
iMAP.med0101_agent.trace.**20120726152942.tar.gz
iMAP.med0107_agent.trace.**20120726154526.tar.gz
iMAP.med0101_agent.trace.**20120726154741.tar.gz
iMAP.med0101_agent.trace.**20120726154616.tar.gz
iMAP.med0101_agent.trace.**20120726154436.tar.gz
iMAP.med0105_agent.trace.**20120726154555.tar.gz
iMAP.med0101_agent.trace.**20120726154532.tar.gz
iMAP.med0101_agent.trace.**20120726154700.tar.gz
iMAP.med0101_agent.trace.**20120726154720.tar.gz
I want to compress them to trace_file.zip, and I use the command, but can
not zip these files. Which parameters or syntax did I wrong ?
*# ls -latr | grep iMAP.med0 | awk '{ system(zip /tmp/trace_file $9)}'*
# ls -latr /tmp/ | grep trace_file
#
--
Thank and best regards,
Jack Vo
Hi Jack,
Sorry but how is this related to perl? This is a linux/unix question that
most on this list might be able to answer but that does not mean it belongs
on this list.
Rob.
Re: Sluggish code
On Mon, Jun 11, 2012 at 4:31 PM, venkates venka...@nt.ntnu.no wrote:
Hi all,
I am trying to filter files from a directory (code provided below) by
comparing the contents of each file with a hash ref (a parsed id map file
provided as an argument). The code is working however, is extremely slow.
The .csv files (81 files) that I am reading are not very large (largest
file is 183,258 bytes). I would appreciate if you could suggest
improvements to the code.
sub filter {
my ( $pazar_dir_path, $up_map, $output ) = @_;
croak Not enough arguments! if ( @_ 3 );
my $accepted = 0;
my $rejected = 0;
opendir DH, $pazar_dir_path or croak (Error in opening directory
'$pazar_dir_path': $!);
open my $OUT, '', $output or croak (Cannot open file for writing
'$output': $!);
while ( my @data_files = grep(/\.csv$/,readdir(DH)) ) {
my @records;
foreach my $file ( @data_files ) {
open my $FH, '', $pazar_dir_path/$file or croak (Cannot
open file '$file': $!);
while ( my $data = $FH ) {
chomp $data;
my $record_output;
@records = split /\t/, $data;
foreach my $up_acs ( keys %{$up_map} ) {
foreach my $ensemble_id ( @{$up_map-{$up_acs}{'Ensembl_
**TRS'}} ){
if ( $records[1] eq $ensemble_id ) {
$record_output = join( \t, @records );
print $OUT $record_output\n;
$accepted++;
}
else {
$rejected++;
next;
}
}
}
}
close $FH;
}
}
close $OUT;
closedir (DH);
print accepted records: $accepted\n, rejected records: $rejected\n;
return $output;
}
__DATA__
TF210ENSMUST0001326SP1_MOUSEGS422
ENSMUSG00379747148974877149005136Mus musculus
MUC5AC14570593ELECTROPHORETIC MOBILITY SHIFT ASSAY
(EMSA)::SUPERSHIFT
TF211ENSMUST0066003SP3_MOUSEGS422
ENSMUSG00379747148974877149005136Mus musculus
MUC5AC14570593ELECTROPHORETIC MOBILITY SHIFT ASSAY
(EMSA)::SUPERSHIFT
Thanks a lot,
Aravind
--
To unsubscribe, e-mail: beginners-unsubscr...@perl.org
For additional commands, e-mail: beginners-h...@perl.org
http://learn.perl.org/
Hi Aravind,
Even though I don't have time to go into the code and really find out why I
can instantly see a bad thing and in peudo code it looks like:
Loop (1) {
Loop (2) {
Loop (3) {
}
}
}
To me that looks like if I have to loop over 81 files like you said and
each of the underlying loops has 81 actions as well then I am doing
81x81x81= 531441 times what ever loop (3) does and 6561 times what ever
loop (2) does as well as 81 times what ever loop (1) does.
To make this a lot faster try and pull the loops appart. You are looping
over a directory, simply het the list and stop te loop, then open each file
seperately and only after youa re sure it is a useful file start processing
the contents of the file. Try and to limit as much as possible the
construct where you have a loop inside a loop.
You seem to be parsing the files line by line as you are saying they are
all very small you might want to pull them in in one go and then thread
them as one long string rather then processing them line by line.
Then there is one more thing I saw and don't quite understand you take your
hash and compare every key in your hash with each and every value in your
file. Why? Why not simply take the value in your file and see if it has a
matching key in the hash (a lot faster then your way). As you are only
comparing the two values you can simply ask the hash if key X exists if it
does you can process if not reject it instantly. As a hash is optimized for
this work you skip the need to loop over the entire hash every single time.
In very short if you want speed writting a loop in a loop in a loop in a
loop is never a good idea. If you have to a loop in a loop is possible more
thn that should be avoided as much as possible.
Regards,
Rob Coops
Re: parsing script help please
On Thu, May 31, 2012 at 11:37 AM, nathalie n...@sanger.ac.uk wrote:
Hi
I have this format of file: (see attached example)
1 3206102-3207048 3411782-3411981 3660632-3661428
2 4481796-4482748 4483180-4483486
and I would like to change it to this
1 3206102-3207048
1 3411782-3411981
1 3660632-3661428
2 4481796-4482748
2 4483180-4483486 .
I have tried with this script to create an array for each line, and to
print the first element (1 or 2) with the rest of the line but the output
don't seem to be right, could you please advise?
#!/software/bin/perl
use warnings;
use strict;
my $file=example.txt;
my $in;
open( $in , '' , $file ) or die( $! );
#open( $out, txtout);
while ($in){
next if /^#/;
my @lines=split(/\t/);
chomp;
for (@lines) { print $lines[0],\t,$_,\n; };
ouput
1 1 i don't want this
1 3206102-3207048
1 3411782-3411981
1 3660632-3661428
1 i don't want this
1
1
1
1
1
1
1
1
1
1
1
1
1
1
1
1
1 1
1 4334680-4340171
1 4341990-4342161
1 4342282-4342905
1
1
1
1
1
1
1
1
1
1
1
1
1
1
1
1
1
1 1
1 4481796-4482748
1 4483180-4483486
1
1
1
1
1
1
1
1
1
1
1
1
1
1
1
1
1
1
1 1
1 4797994-4798062
1 4798535-4798566
1 4818664-4818729
1 4820348-4820395
1 4822391-4822461
1 4827081-4827154
1 4829467-4829568
1 4831036-4831212
1 4835043-4835096
many thanks
Nathalie
--
The Wellcome Trust Sanger Institute is operated by Genome Research
Limited, a charity registered in England with number 1021457 and a company
registered in England with number 2742969, whose registered office is 215
Euston Road, London, NW1 2BE.
--
To unsubscribe, e-mail: beginners-unsubscr...@perl.org
For additional commands, e-mail: beginners-h...@perl.org
http://learn.perl.org/
Hi Nathalie,
Instead of using the split function I would personally go for a regular
expression as it allows for a lot more control over what you want to find.
Here is my solution...
#!/usr/local/bin/perl
use strict;
use warnings;
my $fh;
my %results;
open ( $fh, '', 'temp.txt' ) or die $!;
while ( $fh ) {
chomp;
my $line = $_;
my $rownum = substr($line, 0, 1);
my @othernumbers;
while ( /(\d{7}-\d{7})/g ) {
push ( @othernumbers, $1 );
}
$results{$rownum} = \@othernumbers;
}
close $fh;
use Data::Dumper;
print Dumper %results;
This should print the results below:
$VAR1 = '1';
$VAR2 = [
'3206102-3207048',
'3411782-3411981',
'3660632-3661428'
];
$VAR3 = '2';
$VAR4 = [
'4481796-4482748',
'4483180-4483486'
];
And this is I believe where you wanted to go. Of course you could just
print it directly without the need for the temp variables etc but I assume
that you want to do something more with the found values then just dump
them on your screen.
Regards,
Rob
Re: Perl help
On Tue, Apr 3, 2012 at 11:38 AM, Om Prakash oomprak...@gmail.com wrote:
Hi all,
I have some data which is like
A:12
B:13
C: 14
Now the data is line by line and multiple line with A B C is common though
12 13 14 is changing, i want to take this data column wise, and the the
value should come under A B C. Any help will be appreciated.
Regards.../om
--
To unsubscribe, e-mail: beginners-unsubscr...@perl.org
For additional commands, e-mail: beginners-h...@perl.org
http://learn.perl.org/
So basically you have an imput like this:
A:12
B:13
C:14
B:2
C:54
A:1
A:34
etc...
Right?
And what you want it is a way to show:
A - 35
B - 15
C - 68
Right?
Ok lets just assume that that is what you are looking for as I am not 100%
sure based on your email.
Anyway what you are doing in that case is pulling them apart at first so
you should be able to identify the two sides the letter and the number
behind it.
use strict;
use warnings;
my %hash;
open $fh, '', 'input.file' or die $!;
while ( $fh ) {
chomp;
my ($letter, $number ) = split ( /:/, $_ );
# So now we have the letter and number split for every line in the file
# lets now start counting using the earlier declared hash
# I'm not bothering with any error handling that I'll leave up to you
$hash{$letter} += $number;
}
# Now once having looped over all lines we can close the file handle and
close ( $fh );
# To make my life easy I will simply spit out the whole hash in one go ans
let you see if that is what you are looking for as I have no idea thi is
actually correct
use Data::Dumper;
print Dumper %hash;
The result should look kind like this (order of the data might vary)
$VAR1 = {
'A' = 35,
'C' = 68,
'B' = 15,
}
Regards,
Rob
Re: Learning perl
On Mon, Mar 5, 2012 at 4:35 PM, Shawn H Corey shawnhco...@gmail.com wrote: On 12-03-05 10:19 AM, lina wrote: Is the books wrote before 2006 a bit older, are there much changes in the last 10 years for perl? All changes to Perl are available via perldoc. `perldoc perl` and search for /delta/. `perldoc pelrdelta` gives the latest. -- Just my 0.0002 million dollars worth, Shawn Programming is as much about organization and communication as it is about coding. It's Mutual Aid, not fierce competition, that's the dominate force of evolution. Of course, anyone who has worked in open source already knows this. -- To unsubscribe, e-mail: beginners-unsubscr...@perl.org For additional commands, e-mail: beginners-h...@perl.org http://learn.perl.org/ In general it is a good idea to read the information about what changed between then and now as there are some changes that will usually not break older code but will be the difference between a Well written bit of code and a Outdated bit of code but in general most if not all of the things you find in a good book from 2006 should still work now in 2012. As for a good book to begin with learning: Learning Perl (ISBN: 1-4493-0358-7) also known as the camel book would be a good place to start. Other things like websites such as: perl.com and perl-begin.org are good resources to have a look at as well. Besides that I personally learned most from finding a problem or a relatively simple thing that for which I thought a perl solution would be great. I then spend time and effort trying to figure out how to get this work done with perl. Of course this is assuming that you have some programming background already so you know how to tackle the work in what ever other language, all you then need to do is figure out the way to do this in perl. The main thing specially when you are learning what ever language is to have fun with it. Don't take on to much (you are not going to build the next Google empire in Perl after a week or so of practice) and to keep on asking questions when you run into something that you just can't get your head around. That does not always mean mean ask on this mailing list it could be as simple as using Google to find a good explanation that helps you understand the how or the why. Of course the usually friendly people on this mailing list are often happy to help. The best way to get help is to show what you have done so far and to as clearly as possible explain what it is that you want to do or are expecting the code to do etc... the easier it is to understand what you are looking for the more likely it is that people will be able to help you. Regards, Rob
Re: translate a file
On Fri, Feb 17, 2012 at 4:32 PM, lina lina.lastn...@gmail.com wrote:
Hi,
I have a file,
cat try.xpm
a 1
b 2
c 3
d 4
abbbcdddb
I wish to use perl to translate the last line into the numerical value.
#!/usr/bin/perl
use warnings;
use strict;
open FILE, try.xpm or die $!;
my @line = FILE;
while (FILE) {
print $_;
}
strangely it print me nothing out,
Thanks for any suggestions,
Best regards,
--
To unsubscribe, e-mail: beginners-unsubscr...@perl.org
For additional commands, e-mail: beginners-h...@perl.org
http://learn.perl.org/
Hi thats not that strange look at what you are doing...
#!/usr/bin/perl
use warnings;
use strict;
# So far so good
open FILE, try.xpm or die $!; # Open the file no problem there though I
would use a variable instead of a handle like that but I'll leave that up
to others to complain about ;-)
my @line = FILE; # Read the entire file to @line
while (FILE) { # Read the FILE handle till the end of the file is reached
(you already got there in the previous step so this will instantly return)
print $_; # Yeah that should work providing that you get into the
loop
}
Of course you could put the cursor back at the beginning of the file after
you shove it all into @line or you could remove that step. Another option
could be to loop over @line rather then over the file. Now there is one
thing to mention here and that is if you as it is called slurp a file into
memory as you do with the my @line = FILE; statement you might depending
on the size of the file get in problem with the memory available on your
system. Now a days most computers have GB's of memory but a lot
of operating systems limit the amount of memory they will normally allocate
to a process to a certain amount given that other programs also like to use
some of that memory so it is usually not a bad idea to have a good think
about if you really need to shove it all into memory or if you could live
with processing the data one line at a time storing only that information
that you really need rather then all the information available to you.
Regards,
Rob
Re: Executing remote command without using any modules
On Wed, Jan 18, 2012 at 5:31 AM, charith charith...@gmail.com wrote: Hi All, I create following bash script to run some block of commands on remote server and get information but I try to do same using Perl but I couldn't make it so any one can suggest way to get done this using perl ? (please without using any modules) my .sh... ssh -T $LOGIN EOI cd /x02/oracle/downloads find ./ -type d | sed -e 's/[^-][^\/]*\//--/g;s/--/ |-/' DirectoryStructure.txt cat DirectoryStructure.txt exit EOI thanks The simplest way to do this is to use the exec command it is not the right way by any means but it should work most of the time. The main problems you will find is that you cannot do much error handling, you would basically only be able to see if your script executed SSH correctly or not and that is all that you would be able to do... As far as output you should be able to capture that but it would be just plain old flat text any other work you might want to do with it you would have to do using regular expressions etc... All in all it is not a nice solution, but if you really cannot use modules then you are likely stuck with it. I would advise you to have a look at the Net::OpenSSH module. I know you said no modules but hear me out... Net::OpenSSH is a pure perl module that doesn't have any mandatory dependencies (obviously, besides requiring OpenSSH binaries). This means that you could include it as a part of your program as a module that does not need installing as there is no need to do this. Of course you will have to go into the gutts of the module and find out how it calls the OpenSSH binaries and make sure that you deal with a situation where the binaries are in another location then the one on your machine and of course the case where the are not installed at all. It is going to be a nasty thing and you will have to deal with solving the same problem over and over again with every new release of the Net::OpenSSH module you want to use... You also will need to deal with stuff like outdated versions of OpenSSH and other such wonderful situations. Personally I would not go this route but it really depends on what you need to do if all you need is just a directory listing the exec command might be enough, if you are looking for more things and need to do proper error handling then you will most likely need to find a way to deal with a module anyway. By the way, if you are using SSH to connect to remote machines why could you not simply run this on a single machine? This would make your life a lot simpler as getting a module installed on a single machine is a lot less arguing with the administrator of the server park then getting it installed on a lot of machines. After all if you are to use perl but have to live without modules then what is the point... Perl without modules is like C/C++ without external libraries it will work but it is going to be a massive pain in the rear and likely a very difficult slow and error prone job. Regards, Rob
Re: extracting email addresses from a file
On Tue, Nov 29, 2011 at 4:13 PM, Rajeev Prasad rp.ne...@yahoo.com wrote: hello, i am trying to extract email address from a afile, but not quite succesful. here is what i have: the file: myterqlqt qntmrq Prqtesm qltul qzeez Smqik qltulqzee...@jmqil.com 976665 myterqlqt qntmrq Prqtesm teepqk Mittql teep...@jmqil.com 939383 Onjole qntmrq Prqtesm lmqrqtm Etqrq cont...@lmqrqteeyqm.orj 9889 Vijqyqwqtq qntmrq Prqtesm Sitmqrtmq si...@msitmu.in 939775777 Visqkmqpqtnqm qntmrq Prqtesm Smyqmprqsqt Mqntri mumqnrijmts...@yqmoo.co.in9735566 Wqrqnjql qntmrq Prqtesm Smqsmi qrjulq smqsmi.qrj...@jmqil.com 99799 juntur qntmrq Prqtesm Rqvitejq Jqllepqlli rqvte...@jmqil.com 983 jooty qntmrq Prqtesm Sqtti Kumqr ys...@jmqil.com 986663, West jotqvqri (Eluru) qntmrq Prqtesm Rqm Prqsqt rqmprqsqttujji@yqmoo.com96 59 Mqncmeriql qntmrq Prqtesm Smqntmilql jqmlotm smqntmilql.jqmlotm@live.com933565 898575 Kmqmmqm qntmrq Prqtesm Lqksmmqn Rqo jqtipqrtmy jqtipqrt...@jmqil.com Kurnool (Nemru Nqjqr) qntmrq Prqtesm lqntulmqi Iqlql mussqin limuss...@yqmoo.co.in 986, 8958575, 8958575 my attempt: perl -ple 's/^.*\s(\w*@\w*.\w+).*$/$1/' file my result: qltulqzee...@jmqil.com teep...@jmqil.com cont...@lmqrqteeyqm.orj si...@msitmu.in mumqnrijmts...@yqmoo.co Wqrqnjql qntmrq Prqtesm Smqsmi qrjulq smqsmi.qrj...@jmqil.com 99799 rqvte...@jmqil.com ys...@jmqil.com rqmprqsqttu...@yqmoo.com Mqncmeriql qntmrq Prqtesm Smqntmilql jqmlotm smqntmilql.jqmlotm@live.com933565 898575 jqtipqrt...@jmqil.com limuss...@yqmoo.co please advise how should be my regex? thx. Hi Rajeev, Now making ar regular expression just for your example list I would say this will work... perl -ple 's/^.*\b(\w+@\w*.\w+)\b.*$/$1/' file But I have done this before and I knwo that some people are funny and have an email that looks like one of the below examples. This is crap because of the dots dot...@website.at 234234234, 234523423 This is also crap because of the dots dot.at@subdomain.website.at234234234, 234523423 You would get this out of your file: qltulqzee...@jmqil.com teep...@jmqil.com cont...@lmqrqteeyqm.orj si...@msitmu.in mumqnrijmts...@yqmoo.co qrj...@jmqil.com rqvte...@jmqil.com ys...@jmqil.com rqmprqsqttu...@yqmoo.com jqml...@live.com jqtipqrt...@jmqil.com limuss...@yqmoo.co a...@website.at at@subdomain.website Not to good now is it... therefore I would suggest doing the following pretty much fool proof trick perl -ple 's/^.*\s(.+@.+.\w+)\s.*$/$1/' file This way you are saying that you want to capture all data preceded by a space then some stuff an @ some more stuff a dot and some more stuff. This should capture pretty much all emails in your file without any real restrictions on the formatting making it quite easy to capture everything that looks like an email address. :-) Regards, Rob
Re: extracting email addresses from a file
On Tue, Nov 29, 2011 at 4:54 PM, Sheppy R bobross...@gmail.com wrote: Couldn't you just use the non-whitespace character to capture everything before and after the @ symbol? s/^.*\s(\S+@\S+)\s.*$/$1/ Yes you could of course but... this is why I was saying nearly no syntax checking... the minor check to ensure that you have the . in there helps to weed out the mystuff@someplace funny none email addresses. The biggest problem with email addresses is that the rules of how an email address can be formatted are so relaxed and thus so complex that there is to the best of my knowledge not a single person that has ever managed to create a 100% correct regular expression that checks if a string does in fact match all criteria of a valid email address. One of the problems is that even if you where to manage to create such a thing there are a few possibilities in the specification that are valid but will not likely be accepted by any email server or mail client. Take for instance the following email address 1111@something...@ somewhere.info this is technically a valid email address but I can already tell you that your mail client is likely to choke on it and the mail server at somewhere.info will not like it much either. This is the problem with the email addresses as they are used as opposed to the specification and what that allows. I would personally try and avoid doing any sanity checking on the emails you filter out at least on the first pass... After all the reason you are filtering emails addresses is because in the end it is better to have a few none existing email addresses then miss a few valid once. The cost of missing a email address is a order of magnitude bigger then the cost of sending out an email that bounces because of a none existing email address. Therefore I suggest you grab as much as you can on the first pass anything that smells like an email address. The next step you can then filter further to for instance only those that have a domain name that your DNS server can lookup. Then the next step is to try and mail them and filter the once out that bounce, so check your email account for any messages stating that the receiving mail server does not know the account. In the end you will have a list of valid existing email addresses that you can then spam to no end or well what ever else your intention is with them ;-) Regards, Rob Coops
Re: $host = shift || $hostname; vs. $host = $hostname;
On Thu, Nov 24, 2011 at 7:19 PM, JPH jph4dot...@xs4all.nl wrote:
I found the script below at http://hints.macworld.com/**
dlfiles/is_tcp_port_listening_**pl.txthttp://hints.macworld.com/dlfiles/is_tcp_port_listening_pl.txt
I am trying to figure out what's happening at lines 20-23.
Why is the author using 'shift ||' and not a plain $host = $hostname;
Anyone to enlighten me?
Thanks!
JP
---
1 #!/usr/bin/perl -w
2 #
3 # Author: Ralf Schwarz r...@schwarz.ath.cx
4 # February 20th 2006
5 #
6 # returns 0 if host is listening on specified tcp port
7 #
8
9 use strict;
10 use Socket;
11
12 # set time until connection attempt times out
13 my $timeout = 3;
14
15 if ($#ARGV != 1) {
16 print usage: is_tcp_port_listening hostname portnumber\n;
17 exit 2;
18 }
19
20 my $hostname = $ARGV[0];
21 my $portnumber = $ARGV[1];
22 my $host = shift || $hostname;
23 my $port = shift || $portnumber;
--
To unsubscribe, e-mail: beginners-unsubscr...@perl.org
For additional commands, e-mail: beginners-h...@perl.org
http://learn.perl.org/
I'm not sure what the meaning is of this but the thing that is happening is
simple enough. You have @ARGV which contains [ 'A host name', 'A port
number']. On line 20 you set $hostname = $ARGV[0] = 'A host name' and on
line 21 you set $portnumber = $ARGV[1] = 'A port number'. So far so good,
then on line 22 you assign $host the contents of $_[0] or $hostname, and on
23 you set $host = $_[1] or $portnumber;
Now I am not familiar enough with the perl innards to fully understand the
logic behind this construction, but basically in this setup you will prefer
the use of @_ over the information in @ARGV after all the value after the
|| will only be used in case the shift argument results in an
undef assignment to $host or $port.
Not much clearer I'm sorry but that is as far as I understand it.
Regards,
Rob
Re: Installing CPAN Params::Validate and DateTime on Mac OS X 10.6.8
On Tue, Oct 18, 2011 at 4:20 PM, Madrigal, Juan A j.madrig...@miami.eduwrote: Hi All! I'm having serious problems trying to install DateTime-0.70 along with pre-requisites Params-Validate-1.00 on Mac OS X 10.6.8 via CPAN. I'm using the default install of Perl 5.10 (64bit). What jumps out to me is this: Error: no compiler detected to compile 'lib/DateTime.c'. Aborting I have gcc 4.2 installed and I've even reinstalled Xcode 4.0.2 and no luck. Here are the other errors: Warning: Prerequisite 'Params::Validate = 0.76' for 'D/DR/DROLSKY/DateTime-0.70.tar.gz' failed when processing 'D/DR/DROLSKY/Params-Validate-1.00.tar.gz' with 'make = NO'. Continuing, but chances to succeed are limited. Building DateTime Error: no compiler detected to compile 'lib/DateTime.c'. Aborting DROLSKY/DateTime-0.70.tar.gz ./Build -- NOT OK Running Build test Can't test without successful make Running Build install Make had returned bad status, install seems impossible CPAN: Module::Build loaded ok (v0.38) Failed during this command: DROLSKY/DateTime-Locale-0.45.tar.gz : make_test FAILED but failure ignored because 'force' in effect DROLSKY/DateTime-TimeZone-1.40.tar.gz: make_test FAILED but failure ignored because 'force' in effect DROLSKY/Params-Validate-1.00.tar.gz : make NO DROLSKY/DateTime-0.70.tar.gz : make NO Any ideas? What flags would I need to build and compile a separate install of perl for Mac OS X 10.6.8 (64bit), say under /usr/local/bin/perl along with cpan? Thanks, Juan -- To unsubscribe, e-mail: beginners-unsubscr...@perl.org For additional commands, e-mail: beginners-h...@perl.org http://learn.perl.org/ Hi Juan, You might have GCC installed but do you have it configured? Error: no compiler detected to compile 'lib/DateTime.c'. Aborting Seems quite clear to me there is no C compiler found, you might want to have a look at your CPAN settings and see if your compiler is set there. Normally assuming you had the compiler installed before running CPAN setup it would automatically detect the compiler. By the sound of it you might have installed the compiler after running the CPAN setup in which case it will simply have no compiler listed and will likely throw an error like this. The other errors seems to stem from this problem so resolving that should most likely fix the rest of the errors as well. Regards, Rob
Re: Adding \.JPG$/\.jpg/ to a perlregexp
On Mon, Oct 17, 2011 at 9:07 PM, Csanyi Pal csanyi...@gmail.com wrote:
Leo Susanto leosusa...@gmail.com writes:
On Mon, Oct 17, 2011 at 11:46 AM, Csanyi Pal csanyi...@gmail.com
wrote:
my goal is to get in a directory the following:
PIC1.JPG renamed as Gyermekolimpia_Ujvidek_001.jpg
PIC2.JPG renamed as Gyermekolimpia_Ujvidek_002.jpg
...
PIC00223.JPG renamed as Gyermekolimpia_Ujvidek_223.jpg
So far I get this to work:
rename -n 's/\w\w\w\w\w/sprintf(Gyermekolimpia_Ujvidek_)/e' *.JPG
PIC1.JPG renamed as Gyermekolimpia_Ujvidek_110.JPG
etc.
PIC00223.JPG renamed as Gyermekolimpia_Ujvidek_223.JPG
This is good but I want to make the .JPG extensions lowercase.
I know that the following command do this:
rename -v 's/\.JPG$/\.jpg/' *.JPG
but I want to know how to add
\.JPG$/\.jpg/
into the following command?
rename -n 's/\w\w\w\w\w/sprintf(Gyermekolimpia_Ujvidek_)/e' *.JPG
s/.+(\d{3}).jpg/Gyermekolimpia_Ujvidek_$1.jpg/i
rename -v 's/.+(\d{3}).jpg/Gyermekolimpia_Ujvidek_$1.jpg/i' *.JPG
It works perfectly. Can you explain to me how does it works?
--
Regards, Pal
http://cspl.me
--
To unsubscribe, e-mail: beginners-unsubscr...@perl.org
For additional commands, e-mail: beginners-h...@perl.org
http://learn.perl.org/
I'll try :-)
Lets split it in the various parts first:
.+
(\d{3})
. (this is not completely correct but we will get to that)
jpg
The first part basically tells the regular expression engine to find '.'
(any character) and to find it as often as it can +
The second step finds \d (a digit) exactly 3 times {3} and it is in brackets
which means these digits are captured for reuse later (we will get to that
as well). Thanks to the fact that this capture group is here the above .+
will not simply capture all characters but will stop due to the fact that
this bit matches the 3 digits in the file name.
The third bit where I said it is wrong is the . which captures any one
character after the 3 digits, it should probably have read \. which
restricts it to the . alone.
Then the last bit is no more then the extension preventing this from
matching some_file123.txt etc...
The next part is where we deal with the replacing of the previous file name
with the new one.
The first bit is no more then the new file name: Gyermekolimpia_Ujvidek_
Then the $1 which stands for the first capture group or (\d{3}) in our case
is placed here
The last bit places the extension there as .jpg
Then the one trick in all of this is the i at the end of the regular
expression which tells it to work in a case insensitive mode, so the capture
portion of your substitution that finds all files that match will find all
files where the last 3 charters are jpg regardless of how these are written.
So jpg or JPG or any other combination like JpG will be found providing that
the regular expression engine gets this far, it will stop trying to match as
soon as any of the elements above fails.
Regards,
Rob
Re: how to sort two array in perl
On Fri, Oct 14, 2011 at 4:32 PM, Shlomi Fish shlo...@shlomifish.org wrote:
On Thu, 13 Oct 2011 02:39:52 -0700 (PDT)
Lemon lemon...@gmail.com wrote:
Dear all,
I want to sort data set like this
(@a, @b)
1,21,2
7,89= 2,33
54,787,89
2,33 54,78
I know that linux command sort can do these kind of things by sort -
k1,1n, but how can I do it by perl? I could not use hash because
the first row may be repeat.
If the data set is an array of array references you can use the || to
chain
comparisons:
[CODE]
my @sorted = sort { ($a-[0] = $b-[0]) || ($a-[1] = $b-[1]) }
@a_and_b;
[/CODE]
If the two data sets are kept as separate arrays you can sort an array of
indexes:
[CODE]
my @sorted_indexes = sort { ($arr1[$a] = $arr1[$b]) || ($arr2[$a] =
$arr2[$b]) } (0 .. $#arr1);
[/CODE]
For more information see:
http://perl-begin.org/tutorials/perl-for-newbies/part4/#page--and_or--sort--PAGE
Regards,
Shlomi Fish
--
-
Shlomi Fish http://www.shlomifish.org/
Escape from GNU Autohell -
http://www.shlomifish.org/open-source/anti/autohell/
There is no IGLU Cabal! None of them could pass the Turing test. But
strangely
enough a computer program they coded, could.
Please reply to list if it's a mailing list post - http://shlom.in/reply .
--
To unsubscribe, e-mail: beginners-unsubscr...@perl.org
For additional commands, e-mail: beginners-h...@perl.org
http://learn.perl.org/
Another good source for explanations and a lot of answers to questions you
are sure to have at some point in time:
http://www.perlmonks.org/?node_id=15209
This one deals exactly with your question and suggests the same solution as
Shlomi does but spends a little bit more time on explaining this. (the link
Shlomi posted explains this as well of course ;-)
Regards,
Rob
Re: Regarding help in Threading
On Thu, Oct 6, 2011 at 11:30 AM, Vishal Gupta vishal.knit2...@hotmail.comwrote: Hi, I have to write a perl program (Parent script) which does the below 4 tasks simultaneously: 1. Executing a perl script in one shell. (Parent script) 2. Invoking a thread performing some tasks periodically lets say once in 15 min, and send a message when any task is completed, to parent shell. 2. Invoking a thread which is continuously checking the memory and cpu usage using top command and inform to parent script if it exceeds 50%. 3. Doing ls -l for a directory (containing 4 files) per minute and check if size of any file increases. 4. Invoking a shell script which has a execute in every 10 min and sending the result each time to file. The parent script has to execute continuously for 12 hours. Could you please tell me, how can i create this script ? Which concepts of Perl should I use for the above script? Please share with me the link, where can I get the tutorial/sample code of those concepts? Appreciate your help. Thanks regards, Vishal Hi Vishal, I would say have a look at http://perldoc.perl.org/threads.html which is what will help you do the trick. In very very basic terms you run a main loop, which calls 4 different subs one for each task assigning each sub its own thread. Then the main loop happily does what it name says it loops over and over checking the output of the threads and kicking of new once at the time interval your specified. The whole thing would look a bit look a bit like this: Start task 1 Start task 2 Start task 3 Start task 4 Start schedule thread Main loop Check for output from thread 1 Schedule a new start of thread 1 Deal with output form thread 1 Check for output from thread 2 Schedule a new start of thread 2 Deal with output form thread 2 Check for output from thread 3 Schedule a new start of thread 3 Deal with output form thread 3 Check for output from thread 4 Schedule a new start of thread 4 Deal with output form thread 4 loop Your schedule thread, is there to make sure that when it is time to start one of the threads you can fire it up again. Keeping the threads in a hash so you can simply when you start a new instance of thread 1 assign this to %hash( key=thread1, value=reference to your thread) this way your code for dealing with the output from a thread does not have to be very complex in terms of finding the thread you are looking for. I would advise make each of the tasks work on their own as a one off, then make the main loop and the starting of a thread work for just on thread and grow the complexity from there. A firs time working wit threads can be a little complex and starting with to many of them at once might just cause you more trouble then its worth. Regards, Rob
Re: Sandboxing while I am learning
On Tue, Aug 30, 2011 at 4:44 PM, Marc sono...@fannullone.us wrote: Sayth, So basically If I want to experiment and toy with different cpan apps and so forth I can without messing up my perl install. All you have to do is install cpanm for each version of Perl and then you don't have to worry about them stepping on each other. With cpan configured for each Perl, I have different environments depending on the version and it works great. This post may help: http://blog.fox.geek.nz/2010/09/installing-multiple-perls-with.html Marc -- To unsubscribe, e-mail: beginners-unsubscr...@perl.org For additional commands, e-mail: beginners-h...@perl.org http://learn.perl.org/ Personally I a ma big fan of virtual machines for this purpose I can install many Perl versions, compile support of different database versions combine with different apache versions and mods etc without having to even think about what this might do to my Perl installation. I keep my Perl installation clean and I can break what ever else I want by messing with a virtual machine image of my machine. Once I am sure that what I just did works as it should on the virtual machine I can copy the steps to my real machine and execute the same steps knowing that it will work. Then all you do is replace your virtual machine image and you can continue to play on your machine without ever endangering your machine. The multiple cpan installations is not bad it is dangerous in my opinion. I have seen people go white as a sheet of paper once they realized that they where not on the test but on the production machine and they just executed an rm -rf on the application server directory... The risk of such a simple mistake is even larger when all environments are on a single machine. Therefore I would personally not advise this but that might just be paranoid old me ;-) Regards, Rob
Re: Variable Assignment
On Tue, Aug 16, 2011 at 8:27 PM, Joseph L. Casale jcas...@activenetwerx.com
wrote:
What is the correct way to quickly assign the result of a regex against
a cmdline arg into a new variable:
my $var = ($ARGV[0] =~ s/(.*)foo/$1/i);
Obviously that's incorrect but is there a quick way without intermediate
assignment?
Thanks!
jlc
--
To unsubscribe, e-mail: beginners-unsubscr...@perl.org
For additional commands, e-mail: beginners-h...@perl.org
http://learn.perl.org/
Hi Joseph,
I would suggest naming your selectors like so: $ARGV[0] =~
s/(?'string'.*)foo/$1/i;
Now you can access this variable by simply using $+{string} as your
variable. That way you can identify your variables directly and assign them
meaningful names. Certainly in a more complex regular expressions with many
variables being retrieved this can be very useful. Of course the draw back
is that on the next regular expression this $+{whatever} will get reset
and you will loose what ever you retrieved similar to $1 etc...
Regards,
Rob
Re: Perl script to retrieve specific lines from file
On Thu, Aug 11, 2011 at 1:10 AM, Uri Guttman u...@stemsystems.com wrote: KS == Kevin Spencer ke...@kevinspencer.org writes: KS On Wed, Aug 10, 2011 at 4:04 AM, Rob Coops rco...@gmail.com wrote: #!/usr/bin/perl use strict; use warnings; use File::Slurp; # A handy module check it out at: http://search.cpan.org/~uri/File-Slurp-.19/lib/File/Slurp.pm KS While handy, be aware that you are slurping the entire file into KS memory, so just be careful if you're going to be processing huge KS files. in general i would agree to never slurp in most genetics files which can be in the many GB sizes and up. the OP says the file has up to 10M letters which is fine to slurp on any modern machine. uri -- Uri Guttman -- uri AT perlhunter DOT com --- http://www.perlhunter.com-- Perl Developer Recruiting and Placement Services - - Perl Code Review, Architecture, Development, Training, Support --- -- To unsubscribe, e-mail: beginners-unsubscr...@perl.org For additional commands, e-mail: beginners-h...@perl.org http://learn.perl.org/ Believe it or not but I actually did count the number of zero's there ;-) I know that bio data tends to be rather large but looking at the size i figured it cannot hurt... though indeed if you are going for something more substantial you will want to use a different method of reading the file that reads the file in bits of 2MB at the time or so. Of course if you are pulling out only characters X to Y and you are certain that there is nothing but normal characters in the file you could simply start reading the file from point X and continue to Y, there is no need to loop over the whole thing 2M characters at a time. But beware that making such assmptions will always lead to failure at some point as there will always be one file that contains something else that you didn't expect. Even if that file does not show up in testing in a few years and after a few hundered thousand files you will at some point run into one. (it is the simple principle of increasing your sample size eventually you will find a outlier in there) Regards, Rob
Re: Perl script to retrieve specific lines from file
On Wed, Aug 10, 2011 at 12:43 PM, VinoRex.E vino...@gmail.com wrote: Hi every one i am a Biologist,i am having a DNA file having 2000 to 1000 letters. eg file:(ATGCATGCTAGCTAGTCGATCGCATCGATAGCTAGCTACGCG CGTACCGTGCAGAAGAGCAGGACATATATATTACGCGGCGATCGATCGTAGC GATCGATCGATCGCTAGCTGACTATGCATGCTAGCTAGTCGATCGCATCGATAGCTAGCTACGCGCGTACCGTGCAGAAGAGCAGGACATATATATTACGCGGCGATCGATCGTAGCGATCGATCGATCGCTAGCTGACTATGCATGCTAGCTAGTCGATCGCATCGATAGCTAGCTACGCGCGTACCGTGCA GAAGAGCAGGACATATATATTACGCGGCGATCGATCGTAGCGATCGATCGA TCGCTAGCTGACTATGCATGCTAGCTAGTCGATCGCATCGATAGCTAGCTACGCGCGTACCGTGCAGAA GAGCAGGACATATATATTACGCGGCGATCGATCGTAGCGATCGATCGATCGCTAGCTGACTATGCATGCTAGCTAGTCGATCGCATCGATAGCTAGCTACGCGCGTACCGTGCAGAAGAGCAGGACATATATATTACGCGGCGATCGATCGTAGCGATCGATCGATCGCTAGCTGACT) i calculated the total length of the sequence. what i want to execute is to extract and show the output only the specific(ie highlighted ones only). thank you Hi there, Here is what I suggest you do: First always use strict and warnings, second show us what yuo have done so far that will help show people that you are actually trying and not just asking others to do your homework for you. ;-) As for solving the problem here is what I would do: #!/usr/bin/perl use strict; use warnings; use File::Slurp; # A handy module check it out at: http://search.cpan.org/~uri/File-Slurp-.19/lib/File/Slurp.pm my $file_contents = read_file( 'your file' ); #Reads the whole file in one go, please note that this includes the linefeeds etc... you might or might not need to strip these out depending on how clean the files are. my $total = length( $file_contents ); my $substring = substr 0, 10, $file_contents; print Total number of characters: $total\nSub string: $substring\n; That should do the trick of course change the 0, 10 to the starting position of the substring and the total number of chars you would like to get have returned. The trick for you would be to loop over the files, or allow for command line or interactive feeding of the filename/path and the start point/length of the substring you want to get out of the file. Regards, Rob
Re: AES Encryption
On Thu, Aug 4, 2011 at 8:23 AM, SDA sday...@gmail.com wrote: I'm interested in using AES encryption in Perl. I've tried installing Crypto from CPAN, but can't get it to work. Any ideas? Modules... -- To unsubscribe, e-mail: beginners-unsubscr...@perl.org For additional commands, e-mail: beginners-h...@perl.org http://learn.perl.org/ Can't get it to work, is a very ambiguous reason for a problem with a module. The Crypto module is pretty much what you will be advised if you are planning on doing cryptography in perl. If you provide the errors you are getting, the OS and the perl version then it is quite likely that someone on the list will provide you with an explanation what is wrong, why it is wrong and how this can be corrected... Regards, Rob
Re: substring first 100 words from a string in perl
On Thu, Jul 28, 2011 at 3:23 PM, Khabza Mkhize khabza@gmail.com wrote:
I want to substring words, I might be using wrong terminology. But I tried
the following example the only problem I have it cut word any where it
likes. eg breathtaking on my string is only bre.
$string = This is an awe-inspiring tour to the towering headland
known as Cape Point. Magnificent beaches, breathtaking views, historic and
picturesque coastal ;
$rtioverview = substr ( $string , 0 , 100 );
Reults = This is an awe-inspiring tour to the towering headland known
as Cape Point. Magnificent beaches, bre;
any one can help to solve this problem please?
--
Developer
Green IT Web http://www.greenitweb.co.za
http://www.greenitweb.co.za
Using a regular expression can help here...
#!/usr/local/bin/perl
use strict;
use warnings;
my $string = This is an awe-inspiring tour to the towering headland known
as Cape Point. Magnificent beaches, breathtaking views, historic and
picturesque coastal ;
my $num_words = 5;
if (my ($words) = $string =~ /((?:\w+(?:\W+|$)){$num_words})/) {
print $words;
}
That should do the trick... you can then very simply pick the number of
words you want to return.
Another option is to split the thing into the various words and stick that
into an array:
my @words = split /\W+/, $string;
It depends on what you want to do with it of course... also considder doing
the following:
if (my ($words) = $string =~ /((?:\w+(?:\W+|$)){1..$num_words})/) {
print $words;
}
Which will return you all words from 1 to the total number fo words so if
you input strign does not contain the total 100 or 5 or what ever other
number of words you are looking for at least you get the words that are
found.
Re: Increment UID Field
On Wed, Jul 20, 2011 at 7:24 PM, Overkill overk...@sadiqs.net wrote:
Greetings,
I'm trying to increment the UID field of the unix password file from an csv
file. I've tried to insert C style increment and it keeps bomping out.
What would be the logic to increment the 5009 to increment by one? Thanks
for any help.
-Overkill
#!/usr/bin/perl
#use strict;
#use warnings;
while (DATA) {
chomp;
($first, $last, $username) = split(,);
print $username:x:5009:4001:$first $last:/home/$username:/bin/**
false\n;
}
exit;
__DATA__
Bob,Ahrary,bahrary
Jill,Anderson,janderson
--
To unsubscribe, e-mail: beginners-unsubscr...@perl.org
For additional commands, e-mail: beginners-h...@perl.org
http://learn.perl.org/
#!/usr/bin/perl
use strict;
use warnings;
my $userid = 5009;
while (DATA) {
chomp;
($first, $last, $username) = split(,);
print $username:x:$userid:4001:$first $last:/home/$username:/bin/**
false\n;
$userid++;
}
exit;
__DATA__
Bob,Ahrary,bahrary
Jill,Anderson,janderson
That should do the trick... you could go for a: print $username:x: .
$userid++ . :4001:$first $last:/home/$username:/bin/**false\n; as well if
you like to keep it shorter. or change $userid++; to $userid +1; or even
$userid = $userid +1; depending on your personal preference. The result is
adding 1 to the $userid variable which is what you are looking to do :-)
Regards,
Rob
Re: Increment UID Field
On Wed, Jul 20, 2011 at 9:53 PM, Shlomi Fish shlo...@shlomifish.org wrote:
Hi Overkill,
On Wed, 20 Jul 2011 13:24:06 -0400
Overkill overk...@sadiqs.net wrote:
Greetings,
I'm trying to increment the UID field of the unix password file from an
csv file. I've tried to insert C style increment and it keeps bomping
out. What would be the logic to increment the 5009 to increment by
one? Thanks for any help.
-Overkill
don't parse CSV using regular expressions - use Text::CSV :
http://perl-begin.org/uses/text-parsing/
Regards,
Shlomi Fish
#!/usr/bin/perl
#use strict;
#use warnings;
while (DATA) {
chomp;
($first, $last, $username) = split(,);
print $username:x:5009:4001:$first
$last:/home/$username:/bin/false\n;
}
exit;
__DATA__
Bob,Ahrary,bahrary
Jill,Anderson,janderson
--
-
Shlomi Fish http://www.shlomifish.org/
What Makes Software Apps High Quality - http://shlom.in/sw-quality
The prefix “God Said” has the extraordinary logical property of converting
any
statement that follows it into a true one.
Please reply to list if it's a mailing list post - http://shlom.in/reply .
--
To unsubscribe, e-mail: beginners-unsubscr...@perl.org
For additional commands, e-mail: beginners-h...@perl.org
http://learn.perl.org/
I'm willing to dispute that. :-)
For the simple reason that as long as you control the input to the CVS file
and can be certain that no UTF8 characters or any other mess sneaks in the
simple split using the /,/ regex will be faster and much simpler then the
Text::CVS module though in any situation where you do not control the input
or in the future might not have control over the input you should definitely
use it.
Based on the current data set however this module is pure overkill...
There is a fine line between a module being useful and being over kill if
you are creating a script that you might want to use in the future or share
with colleagues etc... then you should definitely use modules as usually
they cover all kinds of corner cases that you are unlikely to even think of
let alone cover in your code. But there are situations where that is simply
not needed. A simple example is a script I once wrote for an ISP to deal
with a cable company reorganizing their network, the input though not
controlled by me was bound by a lot of rules and I could without any worries
assume all kinds of things about my input based on the business rules
governing the naming of nodes bundles and locations in the network. Of
course these situations are not very common but in case you do encounter
such a situation it can be very handy to ignore the modules and go for a
much more limited but much more strict way of working that throws an error
on every corner case that should not happen based on the business rules. (as
long as you are prepared to get called out of bed at 3 at night when an
operator finds informs you that due to a decission made a little change in
the naming conventions and your script is rolling over and playing dead
because it was not informed about this...)
In general I do agree wit the usage of modules since in the end the modules
normally have seen many iterations and usually cover much more situations
the the once you can think of based on your typical working situaiton...
which means you are much more certain your script will be able to survive
even if in a few years form now you company moves to China and wants to use
chineese names rather then latin names; which would most likely break your
current script by the way :-)
Regards,
Rob
Re: error when installing WWW::Mechanize
On Tue, Jul 19, 2011 at 11:34 AM, Agnello George agnello.dso...@gmail.comwrote: Suggestions would be to install perlbrew and use it to install a more recent perl or just plain to force install, since everything else seems to be in working order. i did a force install and gave me the following output Test Summary Report --- t/local/click_button.t (Wstat: 0 Tests: 19 Failed: 0) TODO passed: 15-17, 19 t/local/nonascii.t (Wstat: 65280 Tests: 4 Failed: 0) Non-zero exit status: 255 Parse errors: Bad plan. You planned 5 tests but ran 4. Files=54, Tests=589, 24 wallclock secs ( 0.23 usr 0.04 sys + 7.04 cusr 0.82 csys = 8.13 CPU) Result: FAIL Failed 1/54 test programs. 0/589 subtests failed. make: *** [test_dynamic] Error 255 JESSE/WWW-Mechanize-1.68.tar.gz /usr/bin/make test -- NOT OK //hint// to see the cpan-testers results for installing this module, try: reports JESSE/WWW-Mechanize-1.68.tar.gz Running make install Installing /usr/lib/perl5/site_perl/5.8.8/WWW/Mechanize.pm Installing /usr/lib/perl5/site_perl/5.8.8/WWW/Mechanize/Examples.pod Installing /usr/lib/perl5/site_perl/5.8.8/WWW/Mechanize/Image.pm Installing /usr/lib/perl5/site_perl/5.8.8/WWW/Mechanize/Cookbook.pod Installing /usr/lib/perl5/site_perl/5.8.8/WWW/Mechanize/Link.pm Installing /usr/lib/perl5/site_perl/5.8.8/WWW/Mechanize/FAQ.pod Installing /usr/share/man/man1/mech-dump.1 Installing /usr/share/man/man3/WWW::Mechanize::Cookbook.3pm Installing /usr/share/man/man3/WWW::Mechanize.3pm Installing /usr/share/man/man3/WWW::Mechanize::Link.3pm Installing /usr/share/man/man3/WWW::Mechanize::Examples.3pm Installing /usr/share/man/man3/WWW::Mechanize::FAQ.3pm Installing /usr/share/man/man3/WWW::Mechanize::Image.3pm Installing /usr/bin/mech-dump Appending installation info to /usr/lib64/perl5/5.8.8/x86_64-linux-thread-multi/perllocal.pod JESSE/WWW-Mechanize-1.68.tar.gz /usr/bin/make install -- OK Failed during this command: JESSE/WWW-Mechanize-1.68.tar.gz : make_test FAILED but failure ignored because 'force' in effect .. would there be a issue when using the module in the future ..humm -- Regards Agnello D'souza -- To unsubscribe, e-mail: beginners-unsubscr...@perl.org For additional commands, e-mail: beginners-h...@perl.org http://learn.perl.org/ There might be but based on the fact that the errors are reported in the non ASCII part of the tests it is not highly likely to happen. I would suggest make a mental note of this and should you run into trouble later on simply see about upgrading Perl (if possible) or see if you can work out what the tests are testing and why they would fail. You are often able to avoid problems if you know exactly what causes them. Personally I usually do not bother upgrading Perl unless there is some serious error that's blocking me. The main reason is that you will have to go over all your scripts and code to make sure that all of them still work as intended. Even though there should be no difference it is a dangerous assumption that things will always work as advertised. :-) Regards, Rob
Re: Using perl to send sms through siemens tc65
On Mon, Jul 18, 2011 at 8:38 PM, Shlomi Fish shlo...@shlomifish.org wrote:
Hi Matevž ,
On Mon, 18 Jul 2011 15:21:09 +0200
Matevž Markovič ivwcorporation.mat...@gmail.com wrote:
Hy!
First, I want to say hy to everyone! I am a fresh perl programmer (I
learned some things in the past few days), who is happy to get to know a
new
language.
What is my problem? Actually, I did not know where to post this, so I am
just posting on this group (because I am after all a perl beginner). I
work
in a company, where they want me to configure a linux centos server, that
would send and receive sms messages through the siemens tc65 terminal
siemens mc65 receiver. My first goal is to get the terminal to send a sms
message. I connected the tc65 to the computer and used minicom to check,
whether the tc65 responds to AT commands.
Well, it responded, but there is also my problem; I do not know, how to
translate that into a perl application. I thought that a module like
GSM::SMS would help me, but without any knowledge about such things, I
cannot do much at this point.
Can you please help me?
Well, if you can do it manually using minicom, you can also probably do it
in
Perl using a serial port module:
http://metacpan.org/release/Device-SerialPort
I'm not familiar with GSM::SMS and have never sent SMS messages using Perl,
so
I cannot help you further, but it may provide a better interface than
working
with the serial port directly.
To properly learn Perl, see http://perl-begin.org/ .
Regards,
Shlomi Fish
Matevž Markovič
--
-
Shlomi Fish http://www.shlomifish.org/
Freecell Solver - http://fc-solve.berlios.de/
rjbs sub id { my $self = shift; $json_parser_for{ $self }
-decode($json_for{ $self })-{id} } # Inside‐out JSON‐notated objects
Please reply to list if it's a mailing list post - http://shlom.in/reply .
--
To unsubscribe, e-mail: beginners-unsubscr...@perl.org
For additional commands, e-mail: beginners-h...@perl.org
http://learn.perl.org/
Having had a quick look at the GSM::SMS module the intor says: *Out of the
box, it comes with a serial transport*, and a bit later: *A good start is to
read the docs for
GSM::SMS::NBShttp://search.cpan.org/~johanvdb/GSM-SMS-0.162/lib/GSM/SMS/NBS.pm
*
To me it looks like this module will do what you want but to be honest I
have no idea if it ill I have never used it. I would suggest having a look
at the example page. It looks quite straight forward from the examples I
have seen.
Still not much help I know but the good thing is that you have found your
way to CPAN and found a module that seems to do what you want it to do. Now
the only thing left to do is just giving it a try and see what it does. In
the worst case scenario you can always do as Shlomi suggested and have a go
at the serial port interface your self but using a purpose build module will
make your life a lot easier in most cases.
Regards,
Rob Coops
Re: XML suggestions
On Wed, Jul 13, 2011 at 3:27 AM, Feng He short...@gmail.com wrote: 2011/7/13 Doug Bradbury dbradb...@8thlight.com: Does anyone have suggestions for an active and easy to use XML building parsing module? For a simple XML parsing I have used the module XML::Simple which just run well. Regards. -- To unsubscribe, e-mail: beginners-unsubscr...@perl.org For additional commands, e-mail: beginners-h...@perl.org http://learn.perl.org/ Recently having done some work with various XML libraries in perl I have to recommend: XML::LibXML the documentation is well how to put it not fantastic... but once you get passed that you are looking at probably the fastest and most powerful library for XML parsing available in perl. It really depends on what you are looking to do though, if you are aiming for just a simple thing with only a few messages then don't worry about XML::LibXML and go for XML::Simple which is more then enough in most simple cases ;-) I found that both Twig and Treebuilder are great if you are looking at modifying the XML (add extra nodes, alter existing nodes) but since they build a full tree structure for the XML file you are working with depending on the size and complexity of the file this could cause serious memory bloat, and even out of memory errors. Personally I think that if you can stomach it getting past the somewhat difficult XML::LibXML documentation it will provide you the best and fastest way of working with XML files, but I have to be honest it took me several years before I found a project where I needed the speed and power of LibXML. On the other hand once learned... if you have the time to do so have a go at it you will enjoy working with it once you know how to. Regards, Rob
Re: Need help for interview
On Fri, Jul 8, 2011 at 11:53 AM, pawan kumar pawan.be.ku...@gmail.comwrote: Hi, I am BE(CSE) fresher.I got a call for interview and openings is in perl.I know the basics of perl.Please let me know what i have to prepare for interview.Any link for frequently asked scripts?? -- K.V. PAWAN KUMAR Good one... I fear that it totally depends on the company and what they do. You will certainly get the basic loops and a open file question. Then likely a print to a file handle some juggling about with arrays and hashs, but other then that who knows. I found that the questions often depend on what the team you are interviewing for is working with most. A team that parses a lot of log files will have more questions related to grep regular expressions (forgot to mention those there will/should be a question about that) where as a team that plays with databases over lunch will usually ask more questions related to SQL, DBI and things like that. In general the best thing to do is make sure you know the basics well enough to be able to code some simple scripts unless they are looking for a perl guru you usually are fine with just the basics. Besides they have your CV they know you are not a perl expert yet... The most important thing is not to try and talk your way out of it. If you don't know the answer to a question try to explain conceptually how to deal with it rather then in code. In the end the main thing they will be looking for is your skill as a coder and your understanding of programming/scripting languages not your years of experience with perl. I have yet to walk into an interview where I have to write some real code (beyond a one liner or something similarly short) so personally I would not worry about that to much, though it might be different in different parts of the world but in Europe I have not seen a request like that yet. Good luck with the interview, Rob
Re: understanding adding numeric accumulator
On Sat, Jul 9, 2011 at 1:33 AM, J. S. John phillyj...@gmail.com wrote:
Hi all,
I'm teaching myself perl. Right now, I am stuck with this script. I
don't understand how it works. I know what it does and how to do it by
hand.
$n = 1;
while ($n 10) {
$sum += $n;
$n += 2;
}
print The sum is $sum.\n
I know $sum is initially 0 (undef). I see that $sum becomes 1, then $n
becomes 3. The loop goes back and then I don't understand. Now $sum is
1+3?
Thanks,
JJ
--
To unsubscribe, e-mail: beginners-unsubscr...@perl.org
For additional commands, e-mail: beginners-h...@perl.org
http://learn.perl.org/
First of all it is a really bad thing to not use warnings and strict in your
scripts just start your script with:
use warnings;
use strict;
and this script will end up screaming that you have to declare your
variables.
So your script would end up looking like this:
use warnings;
use strict;
my $n = 1;
my $sum; # Should actually be my $sum = 0; even if it is only for
readability but we shall let that slide for now ;-)
while ($n 10) {
$sum += $n;
$n += 2;
}
print The sum is $sum.\n
So what does the script do?
Well literally it says while $n is smaller then 10 execute what is in side
the { } brackets. Inside you say $sum = $sum + $n; and then $n = $n + 2;
So on the second loop you look at the value of $n which now is 1 + 2 = 3. So
then we take $sum which is 1 and add $n to that so 1 + 3 = 4 and we increase
$n by 2 ending up at 5.
The next loop (5 is smaller then 10 after all) $sum becomes 4 + 5 = 9 and $n
becomes 5 + 2 = 7
The next loop (7 is smaller then 10 after all) $sum becomes 9 + 7 = 16 and
$n becomes 7 + 2 = 9
The next loop (9 is smaller then 10 after all) $sum becomes 16 + 9 = 25 and
$n becomes 9 + 2 = 11
Then 11 is not smaller then 10 anymore an the loop ends the next thing you
do is print the value of $sum which should by now be 25.
To see if I am right why not modify the script a little so it will print the
inner values:
use warnings;
use strict;
my $n = 1;
my $sum = 0;
while ($n 10) {
print '$sum = ' . $sum . ' $n = ' . $n;
print '$sum += $n';
$sum += $n;
print '$sum = ' . $sum;
$n += 2;
print '$n + 2 = ' . $n;
}
print The sum is $sum.\n
Now it should show you exactly what it is doing inside the loop :-)
Regards,
Rob
Re: Different behaviour
On Thu, Jul 7, 2011 at 11:42 AM, HACKER Nora nora.hac...@stgkk.at wrote:
Hello,
I would be really glad if someone could give me a hint to my following
problem: I have a script that runs smoothly on AIX5.3, installed Perl is
5.8.8. Now I need it to run on AIX6.1, Perl is 5.8.8 as well, but I
experience a strange, differing behaviour. I have a sub-function that greps
for a certain process in the ps list. In the course of this script this
function is called twice. On AIX5.3, I get the same result (process running
or not) both times, on AIX6.1 I get process running at the first call of
the sub, but error -1 at the second call. Could this be an OS behaviour
problem?
Here are the code snippets:
#
# This is the main function of my script (doing DB backups/restore)
sub backup {
#[... some other subs ...]
appl( 'start', 'D', checkStatus('D') ); # starts the Oracle DB if
checkStatus returns that DB is not running; gives correct result
#[... some other subs ...]
my $dbvers = getDBVersion(); # gets the application version from the DB;
on AIX6.1 this produces os level error -1
#[... some other subs ...]
}
#
# This is the sub-function for getting the application version from the DB
sub getDBVersion {
my $fnc = ( caller 0 )[$CALLER_ID];
DEBUG($fnc - DBType: $dbtype\n);
my $vdb = $empty;
my $adb = $empty;
if ( $dbtype eq 'V' ) { # in my case FALSE, ignore
# viaMG-DB temporär umspeichern, um Version aus ApplDB ermitteln zu
können
$vdb = $db;
DEBUG($fnc - viaMG-DB: $vdb\n);
print 'Bitte zugehörige Applikations-DB angeben: ';
INFO($fnc - Bitte zugehörige Applikations-DB angeben: );
$adb = STDIN;
chomp $adb;
$db = $adb;
INFO($fnc - DB: $db\n);
# SID setzen
$ENV{'ORACLE_SID'} = $db;
INFO($fnc - ORACLE_SID: $ENV{'ORACLE_SID'}\n);
}
my $status = checkStatus('D'); # -- this FAILS at the second
execution :-(
DEBUG($fnc - DBStatus aus Unterfunktion checkStatus: $status\n);
my $dbvers;
if ( $status == 0 ) {
my $dbverslst = $tmps/dbversion_$db.lst;
DEBUG($fnc - Tempfile mit DB-Version: $dbverslst\n);
system $sqlplus
. ' /as sysdba '
. \@$sqls/get_db_version.sql $db /dev/null 21;
DEBUG(
$fnc - $sqlplus \/as sysdba\ \@$sqls/get_db_version.sql
$db\n);
if ( fgrep { /ERROR/ } $dbverslst ) {
$dbvers = giveDBVersion();
} else {
DEBUG($fnc - Kein Error aus get_db_version.sql.\n);
}
my @dbversgrep;
my $fh_dbverslst = IO::File-new( $dbverslst);
if ( ! $fh_dbverslst ) {
LOGDIE($fnc - $dbverslst konnte nicht gelesen werden!\n);
}
while ($fh_dbverslst) {
chomp;
$_ =~ s/ //g;
if (/[\d.]/s) { push @dbversgrep, $_ }
}
undef $fh_dbverslst;
$dbvers = $dbversgrep[0];
INFO($fnc - Datenbank-Version (aus DB): $dbvers\n);
if ( -e $dbverslst ) {
unlink $dbverslst
or INFO(
$fnc - Datei $dbverslst konnte nicht gelöscht werden:
$!\n);
}
} else {
INFO( $fnc - Datenbank $db ist down.\n );
print Datenbank $db ist down.\n;
$dbvers = giveDBVersion();
}
if ( $dbtype eq 'V' ) {
$db = $vdb; # viaMG-DB wieder als Haupt-DB einsetzen
# SID setzen
$ENV{'ORACLE_SID'} = $db;
INFO($fnc - ORACLE_SID: $ENV{'ORACLE_SID'}\n);
}
return $dbvers;
}
#
# This is the sub-function for checking whether the Oracle DB (and/or
Tuxedo) is running
sub checkStatus {
my ( $art ) = @_;
my $fnc = ( caller 0 )[$CALLER_ID];
DEBUG($fnc - Übergabeparameter: @_\n);
my $status;
if ( $art eq 'D' ) {
system ps -ef |grep -v grep |grep dbw |grep -q $db;
my $test = `ps -ef |grep -v grep |grep dbw |grep $db`; # print
grepped ps list for debugging
print Test: $test\n;
$status = $? $SHIFT_ERROR;
if ( $status == 0 ) {
INFO($fnc - DB-Status: $status = DB $db is running\n);
} else {
INFO($fnc - DB-Status: $status = DB $db is not running\n);
}
} elsif ( $art eq 'T' ) {
system ps -ef |grep -v grep |grep -w BBL |grep -wq $tux;
$status = $? $SHIFT_ERROR;
if ( $status == 0 ) {
INFO($fnc - Tuxedo-Status: $status = Tuxedo $tux is
running\n);
} else {
INFO($fnc - Tuxedo-Status: $status = Tuxedo $tux is not
running\n);
}
}
return $status;
}
#
# This is the script output with the grepped ps list output for debugging
purposes:
oracle:/opt/magna/wartung dbmove.pl -m s -d MVRSTDB
Default-Tuxedo: mvrst
Return code: 0
Test: oracle 299118 1 0 08:57:47 - 0:00 ora_dbw1_MVRSTDB
oracle
Re: Different behaviour
On Thu, Jul 7, 2011 at 12:50 PM, HACKER Nora nora.hac...@stgkk.at wrote: ** Hi Rob, Thanks for your reply and your suggestions. So to make things really simple you basically make the following call: ***system ps -ef |grep -v grep |grep dbw |grep -q $db;* twice the first time you get the list as expected the second time you get a -1 from the OS. Would it be possible to capture more then just the -1 there should (at least usually) also be a error message in human readable format... that might provide you with a bit more insight into what the reason is that the OS doesn't like you asking twice. Normally, the OS errors in text format are also printed on the command line, so I guess there is nothing more to display …!? Personally I would simply to test repeat the call 10 times or so so that in both cases it is executed 10 times. If the first 10 all working without an issue and the second round throws errors then it certainly is not an OS issue but it must be that something else (on the OS level?) has changed in the mean time. ps is a very basic command and I cannot imagine what it might be that would cause that to trow an error, the grep command might but only of if that $db variable is very strange. You might want to try and print it before and after you make the actual system call just to make sure that it does not magically change which looking at your code it should not but then again the system call should not fail... Tried it, and the result is as follows – 10 times ok for the first round, 10 errors for the second round. I also checked the $db variable, following your suggestion, and it is set identically both times: Default-Tuxedo: mvrst DB: MVRSTDB Return code: 0 Return code: 0 Return code: 0 Return code: 0 Return code: 0 Return code: 0 Return code: 0 Return code: 0 Return code: 0 Return code: 0 Status: 0 DB MVRSTDB is running DB: MVRSTDB Return code: -1 Return code: -1 Return code: -1 Return code: -1 Return code: -1 Return code: -1 Return code: -1 Return code: -1 Return code: -1 Return code: -1 Status: 16777215 DB MVRSTDB is not running But as you can see above I have no idea why this script might be behaving as weird as it does. I do suspect that something OS related is the cause of the weirdness but having never even logged in to an AIX machine I can only guess... Nevertheless thanks for your effort J Cheers, Nora I guess that is clear then there is a definite change between the first and the second attempt at this system call. The first time no mater how often you all it you get the same result over and over again. The second time you always get a return code -1. So it is the OS that for what ever reason sees the second request as something quite different then the first... I assume you have compared both out puts from: my $test = `ps -ef |grep -v grep |grep dbw |grep $db`; # print grepped ps list for debugging and found no difference there? You can in both cases execute this on the command line without issues... Try making a different system call like 'echo Hello world' or something that simple just to see if this does the same and fails on the second try (it should) if it does I would have to say that your OS does not like your program running the same system call more then once (for what ever reason) Now if this was Solaris I would suggest a simple process trace to see exactly what the OS was seeing in terms of requests and what it was doing to cause it to choke on the second one. I don't know if this is possible on AIX if it is this would be the best option to figure it out. Lacking a tool like that I fear that I am at a loss as to how to even try and figure this one out. The Solaris process trace or ptrace as the tool is called allows you to see every call made on the OS level (open file, read memory, access port etc...) it allows you providing that you use more or push the output to a file to see exactly what a process is doing and why it is waiting, or failing to execute a certain call. It has helped me several times to find things like locks on files (also system files) due to other processes creating exclusive locks (seemingly random error explained) or issues with libraries that where so far down the dependency chain that no one even knew they where ever being called. Regards, Rob
Re: rmdir
On Mon, Jun 27, 2011 at 3:31 PM, pa...@laposte.net wrote: Hi Fish, In my example (there is no metachar), the two forms of system call are the same. from perldoc -f system: If there is only one scalar argument, the argument is checked for shell metacharacters, and if there are any, the entire argument is passed to the system's command shell for parsing (this is /bin/sh -c on Unix platforms, but varies on other platforms). If there are no shell metacharacters in the argument, it is split into words and passed directly to execvp, which is more efficient. Message du 27/06/11 14:23 De : Shlomi Fish A : pa...@laposte.net Copie à : Irfan Sayed , Perl Beginners Objet : Re: rmdir Hi Pangj, On Mon, 27 Jun 2011 14:07:51 +0100 pa...@laposte.net wrote: Won't system rm -rf /path/to/dir just work for you? 1. This is on Windows, so rm may not be available. perldoc -f system in general is not portable. 2. Better use the list form of system: system(rm, -fr, $path); With the string version, you're risking code injection: http://shlomif-tech.livejournal.com/35301.html Regards, Shlomi Fish Message du 27/06/11 13:59 De : Irfan Sayed A : Shlomi Fish Copie à : Perl Beginners Objet : Re: rmdir i did that but no luck is there any another way ? regards irfan From: Shlomi Fish To: Irfan Sayed Cc: Perl Beginners Sent: Monday, June 27, 2011 5:05 PM Subject: Re: rmdir Shlomi Fish (shlo...@shlomifish.org) added themselves to your Guest List | Remove them | Block them Une messagerie gratuite, garantie à vie et des services en plus, ça vous tente ? Je crée ma boîte mail www.laposte.net -- - Shlomi Fish http://www.shlomifish.org/ Why I Love Perl - http://shlom.in/joy-of-perl Chuck Norris writes understandable Perl code. Please reply to list if it's a mailing list post - http://shlom.in/reply. Une messagerie gratuite, garantie à vie et des services en plus, ça vous tente ? Je crée ma boîte mail www.laposte.net -- To unsubscribe, e-mail: beginners-unsubscr...@perl.org For additional commands, e-mail: beginners-h...@perl.org http://learn.perl.org/ Ifran, Could you please post some code so people could actually see what you have tried or are trying. I know it seems simple and easy but clearly is is not as simple as it seems as you can't get it working so please do not assume that others will just suggest a fix for you. Oh, and I suggest you read the documentation a little bit on rmdir... as it holds some clues to what it is that you will want to be doing. Link to documentation http://perldoc.perl.org/functions/rmdir.html it mentions File::Path and rmtree as a solution to your problem. Regards, Rob
Re: rmdir
On Mon, Jun 27, 2011 at 3:49 PM, Irfan Sayed irfan_sayed2...@yahoo.comwrote:
exactly. some of the files have set the attribute as read only
and due to that module was unable to delete those
is there any module which will check if the file has read only attribute
and if yes remove that attribute??
plz suggest
--irfan
From: Shawn H Corey shawnhco...@gmail.com
To: beginners@perl.org
Sent: Monday, June 27, 2011 6:09 PM
Subject: Re: rmdir
On 11-06-27 08:29 AM, Irfan Sayed wrote:
even i tried windows del command
but it prompts for confirmation to delete the files
do u know how to suppress these prompts ? i did not find any switch which
allows you to suppress
It sounds like some of the files or directories have their read-only bit
set.
What is the output of this:
use File::Path;
my $errors = [];
rmtree( $dir, { error = \$errors });
print $_\n for @$errors;
BTW, I do believe the correct Windows command is: del /s
-- Just my 0.0002 million dollars worth,
Shawn
Confusion is the first step of understanding.
Programming is as much about organization and communication
as it is about coding.
The secret to great software: Fail early often.
Eliminate software piracy: use only FLOSS.
-- To unsubscribe, e-mail: beginners-unsubscr...@perl.org
For additional commands, e-mail: beginners-h...@perl.org
http://learn.perl.org/
Have a look at the following: Win32::File (to get and set file attributes on
Windows)
Re: @{$var1{$var2}}
On Wed, Jun 22, 2011 at 6:44 PM, josanabr john.sanab...@gmail.com wrote:
Hi,
I'm reading a program written in perl and I read this statement
--
To unsubscribe, e-mail: beginners-unsubscr...@perl.org
For additional commands, e-mail: beginners-h...@perl.org
http://learn.perl.org/
Without any more information I would have to say good, and what do you want
form the list? (it really does help if you formulate a question and ask what
it is that you want to know ;-)
I suspect hat you are wondering what this means right?
Lets dissect this a little:
Lets take the inner most thing ($var2) this is obviously a scalar (or a
reference to another variable (I'll explain why I am betting it is a scalar
in a bit))
Then we see the following: $var1{...} this is the way one accesses a
variable in a hash based on the key (the thing that goes between those
brackets). Usually the keys used in a has are scalars of course there is
nothing stopping anyone from using complex data structures as a key but it
is performance wise not the smartest thing to do.
The last bit then @{...} basically says treat what is in side the brackets
as an array (which is what one would do if one is expecting an array
reference to be returned from $var1's value associated with key $var2.
So what would the data structure look like?
{
Hash key 1 = \[
'Array value 1',
'Array value 2',
...
],
Hash key 2 = \[
'Array value 1',
'Array value 2',
...
],
...
}
Or in text form: $var1 is an hash containing keys associated with values
which are references to arrays.
I hope that explains things a little bit. :-)
Regards,
Rob
Re: malformed header from script. Bad header
On Mon, Jun 20, 2011 at 10:32 AM, Khabza Mkhize khabza@gmail.comwrote: I am not sure if this problem is cause by print Content-type: text/html, \n\n; The main problem I have commented print Content-type: text/html, \n\n; since is printing line from cookies i Used On Mon, Jun 20, 2011 at 9:57 AM, Khabza Mkhize khabza@gmail.com wrote: I am receiving the following error on my error log I thought it was caused by Meta Tag content. The program was working fine for a long time its just few day I got this error and now it seem is consistent. [Sun Jun 19 22:42:12 2011] [error] [client 98.126.251.234] malformed header from script. Bad header=p: tourview1.pl, this is the program that generate this error http://www.followme2africa.com/cgi-bin/followme/scripts/public/common/tourview1.pl?Aqui01-DSAFCPT2 Thank you Khabza Developer http://www.greenitweb.co.za Hi Khabza, I fear that following your link just provides the webpage (at least in my browser it does). I have no idea what your code is doing or if there is an error being thrown as I cannot see anything besides a normal looking website. Would it be possible for you to provide the list with the code that is throwing the error and how the code needs to be called to generate the error (does it always throw this error regardless of the variables it is provided with?) Regards, Rob
Re: Convert spreadsheet to jpeg
On Mon, Jun 20, 2011 at 9:57 PM, andrewmchor...@cox.net wrote: Hello I am not an expert in perl and so before I propose that a particular script be written I would likek to get an idea as to how hard the task would be. We have a large number (in my opinion) of excel spreadsheets that need to be concerted to jpeg format. The jpeg files are used when a document is created and the jpeg files are inserted. The spreadsheets are under configuration control and the current policy is that when a spreadsheet is updated the jpeg file is created (via a macro) and it too goes under CM control. I am considering proposing that a perl script could go through the directory structure and save each spreadsheet to a jpeg file and it would be more efficient and cost effective. Question: 1. How hard is it to write a perl script that will open a spreadsheet and save it to a jpeg file? 2,. Does this capability exist now? Thanks, Andrew -- To unsubscribe, e-mail: beginners-unsubscr...@perl.org For additional commands, e-mail: beginners-h...@perl.org http://learn.perl.org/ Hi Andrew, Opening a spreadsheet with perl is certainly a simple enough thing to do, converting to a JPEG is a different story as far as I know as this would require your perl code to be able to draw the excel documents content. As far as I am aware this is not possible but I might be wrong. Now you might be tempted to think that you could just execute the macro but that again would require perl to fully understand the way MS visual basic works and has access to all functions and methods that this visual basic does. I think to be honest that in this case it is probably easier to create a simple macro to open a specific directory or even a directory provided trough a popup box, then open each excel file run a fixed macro in there, safe the file and close the excel, rinse, repeat and you should have the same thing as your perl script is supposed to do. As you are by the sound of it creating another MS based document or maybe a PDF file which can be created out of a MS based document which is then printed to a PDF... again this can relatively easily be done with an VBA macro. I know not very perly of me but I am one that believes in using a spade to dig a hole and drill to drill one ;-) Regards, Rob
Re: virtual drive
On Wed, Jun 15, 2011 at 8:49 AM, Irfan Sayed irfan_sayed2...@yahoo.comwrote: Hi, is there any way or module in perl to create the virtual drive in windows lets say , i have to create M: mapped to c:\test so i can use command subst M: c:\test but still , is there any better way regards irfan Hi Ifran, There should be a better way I am certain there is an API in Windows that allows you to do this programatically. What you would then need to do is call the API directly and avoid the command line mess. I am not sure if this API is documented (I believe so as I vaguely remember reading it several years ago), if it is you will find that it usually comes down to making a simple call to the API, though this will be via a external library so it will require some work and of course this is not something that will be very portable or for that mater simple to write. So please do look at CPAN to see if there maybe is already a module for this (I could not find one having just had a quick look) If there is no module for this yet please do share your implementation of this API (if you decide to go the proper way) with the rest of us as it would be very interesting to see how this is done. Regards, Rob
Re: how to use regexp to match symbols
On Mon, Jun 13, 2011 at 2:05 PM, eventual eventualde...@yahoo.com wrote:
Hi,
I have a list of mp3 files in my computer and some of the file names
consists of a bracket like this darling I love [you.mp3
I wish to check them for duplicates using the script below, but theres
error msg like this Unmatched [ in regex; marked by -- HERE in m/only one
brace here[ -- HERE anything.mp3/ at Untitled1 line 13.
So how do I rewrite the regexp.
Thanks.
## script ###
#!/usr/bin/perl
use strict;
use warnings;
use File::Find;
my @datas = (test.mp3 , only one brace here[anything.mp3 ,
whatever.mp3);
while (@datas){
my $ref = splice @datas,0,1;
foreach (@datas){
if ($ref =~/$_/){
print $ref is a duplicate\n;
}else{
print $ref is not a duplicate\n;
}
}
}
Escape the special character by using a \ so in your case you would
say: only one brace here\[anything.mp3 which the regular expression engine
will translate to: only one brace here[anything.mp3 instead of only one
brace hereOpen a caracter groupanything.mp3 which would mean you never
close the group and thus the regular expression is invalid and will throw an
error.
Regards,
Rob
Re: Check if words are in uppercase?
On Thu, Jun 9, 2011 at 9:59 AM, Beware mathieu.hed...@gmail.com wrote:
Hi all,
i've a question on my perl script.
In my script i read a file line per line, and check if keywords are in
uppercase. To do that, i've an array filled with all used keywords.
On each line, i check all keywords with a foreach loop.
Well, this is my code :
my $lines = 0;
while ( SOURCE )
{
# cut '\n'
chomp($_);
#List of keywords
my @keywords = (all, wait, for);
#Check all keyword
foreach $item (@keywords)
{
# keywords detected
if ( /$item\b/i and !/\s*--/)
{
# remove keywords already in uppercase
my $temp = $_;
my $item_maj = uc($item);
$temp =~ s/$item_maj//g;
# check if any keywords
if ( $temp =~ /$item\b/i )
{
print keywords is lowercase line : .$lines.\n;
last;
}
}
}
$lines++;
}
close ( SOURCE );
Well, thanks for your answer
--
To unsubscribe, e-mail: beginners-unsubscr...@perl.org
For additional commands, e-mail: beginners-h...@perl.org
http://learn.perl.org/
Why make you life so hard?
Lets assume you will want some debug logging to know what where and how
often you replaced things...
while ( $line =~ /\b(?'keyword'keyword1|keyword2|keyword3|etc...)\b/i ) {
print debug information ($+{keyword} contains the matched keyword);
$line =~ /$+{keyword}/\U$+{keyword}\E/;
}
This will do the same as your for loop but it will use a single regular
expression that gets used only once if only a single keyword is present in
the line and never more often then the number of keywords in the line being
processed.
If you want to use an external array with keywords simply use that by doing
the following:
my $keywords = join '|', @keywords;
while ( $line =~ /\b(?'keyword'$keywords)\b/i ) { ... }
Regards,
Rob
Re: how do i push a hashref into another hashref
On Tue, Jun 7, 2011 at 8:47 AM, Agnello George agnello.dso...@gmail.comwrote:
HI
I got the following hashref
my $selet_domU_data = $DBH-selectall_hashref(select
ram,ip,application,hosting,assigned_to,rdom0id from domU_info where
server_name='$domU_server' ,'server_name' );
my $select_all_website = $DBH-selectall_hashref(select
website_id,website_name from websites_name ,'website_id');
now i need to push $select_all_website into $selet_domU_data
my %hash1 = %$select_all_website;
foreach (keys %$selet_domU_data) {
push (@{$selet_domU_data-{$_}}, { rets = %hash1 );
}
print Dumper ([$selet_domU_data]);
i also tried a combination of many other things but does not seem to work
thanks in advanced
--
Regards
Agnello D'souza
Hi Angello,
Could you maybe draw what you want the result to look like?
You are saying you have a hashref called: $selet_domU_data and one
called: $select_all_website right. Now both of them seem to be the result of
a database handle executing the query that you showed behind them. So both
of them will contain a hashref with in there a key (server_name, website_id
respectively) and all values fetched for these keys.
So eacy of them will look like this:
{
HASH1_Key1 = { Column1 = '...', Column2 = '...', }
HASH1_Key2 = { Column1 = '...', Column2 = '...', }
...
}
and
{
HASH2_Key1 = { Column1 = '...', Column2 = '...', }
HASH2_Key2 = { Column1 = '...', Column2 = '...', }
...
}
Combining them will end up with:
{
HASH1_Key1 = { Column1 = '...', Column2 = '...', }
HASH1_Key2 = { Column1 = '...', Column2 = '...', }
...
HASH2_Key1 = { Column1 = '...', Column2 = '...', }
HASH2_Key2 = { Column1 = '...', Column2 = '...', }
...
}
right?
Well then it should be simple enough:
foreach my $key ( keys %{ $hashref_a } ) {
${ $hashref_b }{ $key } = ${ $hashref_a }{ $key };
}
Basically loop over one of the two hashs and shove all it's key value pairs
into the other and you are done. If you don't need the initial hashref
anymore don't forget to clear it so perl will not keep the hash in memory
for any longer then you absolutely need to. (after all you never know how
big that database might be)
Regards,
Rob
Re: fastq file modification help
On Mon, Jun 6, 2011 at 12:29 PM, Nathalie Conte n...@sanger.ac.uk wrote:
Hi,
I need to remove the first 52 bp sequences reads in a fastq file,sequence
is on line 2.
fastq file from wikipedia:A FASTQ file normally uses four lines per
sequence. Line 1 begins with a '@' character and is followed by a sequence
identifier and an /optional/ description. Line 2 is the raw sequence
letters. Line 3 begins with a '+' character and is /optionally/ followed by
the same sequence identifier (and any description) again. Line 4 encodes the
quality values for the sequence in Line 2, and must contain the same number
of symbols as letters in the sequence.
A minimal FASTQ file might look like this:
@SEQ_ID
GATTTTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAACTCACAGTTT
+
!''****+))%%%++)().1***-+*''))**55CCFCCC65
I have written this script to remove the first 52 bp on each sequence and
write this new line on newfile.txt document. It seems to do the job , but
what I need is to change my original bed file with the trimmed seuqence
lines and keep the other lines the same. I am not sure where to start to
modify the original fatsq.
this is my script to trim my sequence :
#!/software/bin/perl
use warnings;
use strict;
open (IN, /file.fastq) or die can't open in:$!;
open (OUT, newfile.txt) or die can't open out: $!;
while (IN) {
next unless (/^[A-Z]/);
my $new_line=substr($_,52);
print OUT $new_line;
}
thanks for any suggestions
Nat
--
The Wellcome Trust Sanger Institute is operated by Genome Research Limited,
a charity registered in England with number 1021457 and a company registered
in England with number 2742969, whose registered office is 215 Euston Road,
London, NW1 2BE.
--
To unsubscribe, e-mail: beginners-unsubscr...@perl.org
For additional commands, e-mail: beginners-h...@perl.org
http://learn.perl.org/
Hi Nathalie,
I am not 100% sure on this as I suspect that when modifying the original
file you also want to deal with that 4th line in which case I have no idea
how to deal with that as I do not understand what its purpose is
Anyway assuming that you are simply dealing with the 2nd line only life is a
whole lot simpler.
You know the number of characters you are removing is always 52 so that we
don't have to deal with that anymore. Now we can take various routes we
could take all characters from 52 till the end of the string (substr puts
the first character on position 0 not on position 1 ;-) or we could simply
cut out all characters before the 52nd. We could do the cutting using a
regular expression or we could use substr for this purpose (I have no idea
which one is faster please benchmark that if you are looking at a large
number of such operations to be executed it could save you a lot of time ;-)
Using substr to do all the work: my $new_line2 = substr $_, 0, 52, ;
Using a regular expression to do the work: my $new_line3 = $_; $new_line3 =~
s/[A-Z]{51}//;
Doing the counting thing...: my $new_line4 = substr $_, 52, length $_;
All 3 will provide you the result you are looking for I suspect that the
first one will be the fastest option, based on what little experience I have
with these types of opperations but please do prove this before you start
working on thousands of files...
Regards,
Rob
Re: timestamp with milisecond
On Fri, Jun 3, 2011 at 9:38 AM, Anirban Adhikary anirban.adhik...@gmail.com wrote: Hi List Is it possible to get the current time_stamp with milisecond format like HH:MI:SS:NNN DD:MM:(NNN is the milisecond) If yes then how can I achieve the same.. Thanks Regards in advance Anirban Adhikary. -- To unsubscribe, e-mail: beginners-unsubscr...@perl.org For additional commands, e-mail: beginners-h...@perl.org http://learn.perl.org/ Hi Anirban, Sure you can have a look at the following CPAN module: http://search.cpan.org/dist/Time-HiRes/HiRes.pm It will do exactly what you are looking for. Regards, Rob
Re: Parsing file
On Thu, Jun 2, 2011 at 1:28 PM, venkates venka...@nt.ntnu.no wrote:
On 6/2/2011 12:46 PM, John SJ Anderson wrote:
On Thu, Jun 2, 2011 at 06:41, venkatesvenka...@nt.ntnu.no wrote:
Hi,
I want to parse a file with contents that looks as follows:
[ snip ]
Have you considered using this module? -
http://search.cpan.org/dist/BioPerl/Bio/SeqIO/kegg.pm
Alternatively, I think somebody on the BioPerl mailing list was
working on another KEGG parser...
chrs,
j.
I am doing this as an exercise to learn parsing techniques so guidance
help needed.
Aravind
--
To unsubscribe, e-mail: beginners-unsubscr...@perl.org
For additional commands, e-mail: beginners-h...@perl.org
http://learn.perl.org/
This is a simple and ugly way of parsing your file:
use strict;
use warnings;
use Carp;
use Data::Dumper;
my $set = parse(ko);
sub parse {
my $keggFile = shift;
my $keggHash;
my $counter = 1;
open my $fh, '', $keggFile || croak (Cannot open file '$keggFile': $!);
while ( $fh ) {
chomp;
if ( $_ =~ m!///! ) {
$counter++;
next;
}
if ( $_ =~ /^ENTRY\s+(.+?)\s/sm ) { ${$keggHash}{$counter} = { 'ENTRY' =
$1 }; }
if ( $_ =~ /^NAME\s+(.*)$/sm ) {
my $temp = $1;
$temp =~ s/,\s/,/g;
my @names = split /,/, $temp;
push @{${$keggHash}{$counter}{'NAME'}}, @names;
}
}
close $fh;
print Dumper $keggHash;
}
The output being:
$VAR1 = {
'1' = {
'NAME' = [
'E1.1.1.1',
'adh'
],
'ENTRY' = 'K1'
},
'3' = {
'NAME' = [
'U18snoRNA',
'snR18'
],
'ENTRY' = 'K14866'
},
'2' = {
'NAME' = [
'U14snoRNA',
'snR128'
],
'ENTRY' = 'K14865'
}
};
Which to me looks sort of like what you are looking for.
The main thing I did was read the file one line at a time to prevent a
unexpectedly large file from causing memory issues on your machine (in the
end the structure that you are building will cause enough issues
when handling a large file.
You already dealt with the Entry bit so I'll leave that open though I
slightly changed the regex but nothing spectacular there.
The Name bit is simple as I just pull out all of them then then remove all
spaces and split them into an array, feed the array to the hash and hop time
for the next step which is up to you ;-)
I hope it helps you a bit, regards,
Rob
Re: regexp validation (arbitrary code execution) (regexp injection)
2011/6/1 Stanisław Findeisen s...@eisenbits.com
Suppose you have a collection of books, and want to provide your users
with the ability to search the book title, author or content using
regular expressions.
But you don't want to let them execute any code.
How would you validate/compile/evaluate the user provided regex so as to
provide maximum flexibility and prevent code execution?
--
Eisenbits - proven software solutions: http://www.eisenbits.com/
OpenPGP: E3D9 C030 88F5 D254 434C 6683 17DD 22A0 8A3B 5CC0
--
To unsubscribe, e-mail: beginners-unsubscr...@perl.org
For additional commands, e-mail: beginners-h...@perl.org
http://learn.perl.org/
Hi Stanisław,
From what you are saying I think you are looking for an option to take a
string and check it for any potential bad characters that would cause system
to execute unwanted code.
So a bit like this: In.*?forest$ is a safe string to feed into your
regular expression but: .*/; open my $fh, , $0; close $fh; $_ = ~/ is
an evil string causing you a lot of grief. At least that is how I understand
your question...
To be honest I am not sure if this is an issue as I suspect that the
following construction.
if ( $title =~ m/$userinput/ ) { do stuff... }
will give you any issues as far as I can remember the variable that you are
feeding here will not be treated as code by the interpreted but simply as a
matching instructions which would mean that what ever your user throws at it
perl will in the worst case return an failure to match.
But please don't take my word for it try it in a very simple test and see
what happens.
If you do have to ensure that a user cannot execute any code you could
simply prevent the user from entering the ; or smarter yet filter this out
from the user input, to prevent a smart user from feeding it to your code
via an method other then the front-end you provided. Without a means to
close the previous regular expression the user can not really insert
executable code into your regular expression. At least thats what I would
try but I am by no means an expert in the area and I suspect there might be
some people reading this and wondering why I didn't think of A, B or C if so
please do speak up people ;-)
Regards,
Rob
Re: Parsing file
On Thu, Jun 2, 2011 at 4:41 PM, venkates venka...@nt.ntnu.no wrote:
On 6/2/2011 2:44 PM, Rob Coops wrote:
On Thu, Jun 2, 2011 at 1:28 PM, venkatesvenka...@nt.ntnu.no wrote:
On 6/2/2011 12:46 PM, John SJ Anderson wrote:
On Thu, Jun 2, 2011 at 06:41, venkatesvenka...@nt.ntnu.no wrote:
Hi,
I want to parse a file with contents that looks as follows:
[ snip ]
Have you considered using this module? -
http://search.cpan.org/dist/BioPerl/Bio/SeqIO/kegg.pm
Alternatively, I think somebody on the BioPerl mailing list was
working on another KEGG parser...
chrs,
j.
I am doing this as an exercise to learn parsing techniques so guidance
help needed.
Aravind
--
To unsubscribe, e-mail: beginners-unsubscr...@perl.org
For additional commands, e-mail: beginners-h...@perl.org
http://learn.perl.org/
This is a simple and ugly way of parsing your file:
use strict;
use warnings;
use Carp;
use Data::Dumper;
my $set = parse(ko);
sub parse {
my $keggFile = shift;
my $keggHash;
my $counter = 1;
open my $fh, '', $keggFile || croak (Cannot open file '$keggFile':
$!);
while ($fh ) {
chomp;
if ( $_ =~ m!///! ) {
$counter++;
next;
}
if ( $_ =~ /^ENTRY\s+(.+?)\s/sm ) { ${$keggHash}{$counter} = { 'ENTRY'
=
$1 }; }
While trying a similar thing for DEFINITION record, instead of appending
current hash with ENTRY and NAME, the DEFINITION record replaces the
contents in the hash?
$VAR1 = {
'4' = {
'DEFINITION' = 'U18 small nucleolar RNA'
},
'1' = {
'DEFINITION' = 'alcohol dehydrogenase [EC:1.1.1.1]'
},
'3' = {
'DEFINITION' = 'U14 small nucleolar RNA'
},
'2' = {
'DEFINITION' = 'alcohol dehydrogenase (NADP+)
[EC:1.1.1.2]'
},
'5' = {
'DEFINITION' = 'U24 small nucleolar RNA'
}
};
code: in addition to what you had suggested -
if($_ =~ /^DEFINITION\s{2}(.+)?/){
${$keggHash}{$counter} = {'DEFINITION' = $1};
}
if ( $_ =~ /^NAME\s+(.*)$/sm ) {
my $temp = $1;
$temp =~ s/,\s/,/g;
my @names = split /,/, $temp;
push @{${$keggHash}{$counter}{'NAME'}}, @names;
}
}
close $fh;
print Dumper $keggHash;
}
The output being:
$VAR1 = {
'1' = {
'NAME' = [
'E1.1.1.1',
'adh'
],
'ENTRY' = 'K1'
},
'3' = {
'NAME' = [
'U18snoRNA',
'snR18'
],
'ENTRY' = 'K14866'
},
'2' = {
'NAME' = [
'U14snoRNA',
'snR128'
],
'ENTRY' = 'K14865'
}
};
Which to me looks sort of like what you are looking for.
The main thing I did was read the file one line at a time to prevent a
unexpectedly large file from causing memory issues on your machine (in the
end the structure that you are building will cause enough issues
when handling a large file.
You already dealt with the Entry bit so I'll leave that open though I
slightly changed the regex but nothing spectacular there.
The Name bit is simple as I just pull out all of them then then remove all
spaces and split them into an array, feed the array to the hash and hop
time
for the next step which is up to you ;-)
I hope it helps you a bit, regards,
Rob
What you do: ${$keggHash}{$counter} = {'DEFINITION' = $1};
Try the following: $keggHash}{$counter}{'DEFINITION'} = $1;
To make things a little clearer look at the following example.
my %hash;
$hash{'Key 1'} = { 'Nested Key 1' = 'Value 1' };
What you do is say: $hash{'Key 1'} = { 'Nested Key 2' = 'Value 2' }
What I do is: $hash{'Key 1'}{'Nested Key 2'} = 'Value 2'}
In your script you will end up with the following:
$VAR1 = {
'Key 1' = {
'Nested Key 2' = 'Value 2',
},
};
Where mine will result in:
$VAR1 = {
'Key 1' = {
'Nested Key 1' = 'Value 1',
'Nested Key 2' = 'Value 2',
},
};
Not that much different but you are basically over writting the value (
{NAME=[], ENTRY=''} ) associated with your key ($counter) with {
'DESCRIPTION' = ''}. If you instead add a new key to the hash that is
associated with your main key ($counter) then you will get the result you
are looking for.
Regards,
Rob
Re: Parsing file
On Thu, Jun 2, 2011 at 8:32 PM, venkates venka...@nt.ntnu.no wrote:
Hi,
Thanks a lot for the help, i had one more question. How can add diff values
from multiple lines to the same hash ref? for example in the snippet data
PATHWAY ko00010 Glycolysis / Gluconeogenesis
ko00071 Fatty acid metabolism
ko00350 Tyrosine metabolism
ko00625 Chloroalkane and chloroalkene degradation
ko00626 Naphthalene degradation
I want it to stored in the following manner:
2' = {
'PATHWAY' = {
'ko00010' = 'Glycolysis /
Gluconeogenesis'
'ko00071' = ' Fatty acid
metabolism'
},
};
Thanks,
Aravind
On 6/2/2011 5:06 PM, Rob Coops wrote:
On Thu, Jun 2, 2011 at 4:41 PM, venkatesvenka...@nt.ntnu.no wrote:
On 6/2/2011 2:44 PM, Rob Coops wrote:
On Thu, Jun 2, 2011 at 1:28 PM, venkatesvenka...@nt.ntnu.no wrote:
On 6/2/2011 12:46 PM, John SJ Anderson wrote:
On Thu, Jun 2, 2011 at 06:41, venkatesvenka...@nt.ntnu.nowrote:
Hi,
I want to parse a file with contents that looks as follows:
[ snip ]
Have you considered using this module? -
http://search.cpan.org/dist/BioPerl/Bio/SeqIO/kegg.pm
Alternatively, I think somebody on the BioPerl mailing list was
working on another KEGG parser...
chrs,
j.
I am doing this as an exercise to learn parsing techniques so
guidance
help needed.
Aravind
--
To unsubscribe, e-mail: beginners-unsubscr...@perl.org
For additional commands, e-mail: beginners-h...@perl.org
http://learn.perl.org/
This is a simple and ugly way of parsing your file:
use strict;
use warnings;
use Carp;
use Data::Dumper;
my $set = parse(ko);
sub parse {
my $keggFile = shift;
my $keggHash;
my $counter = 1;
open my $fh, '', $keggFile || croak (Cannot open file '$keggFile':
$!);
while ($fh ) {
chomp;
if ( $_ =~ m!///! ) {
$counter++;
next;
}
if ( $_ =~ /^ENTRY\s+(.+?)\s/sm ) { ${$keggHash}{$counter} = { 'ENTRY'
=
$1 }; }
While trying a similar thing for DEFINITION record, instead of
appending
current hash with ENTRY and NAME, the DEFINITION record replaces the
contents in the hash?
$VAR1 = {
'4' = {
'DEFINITION' = 'U18 small nucleolar RNA'
},
'1' = {
'DEFINITION' = 'alcohol dehydrogenase [EC:1.1.1.1]'
},
'3' = {
'DEFINITION' = 'U14 small nucleolar RNA'
},
'2' = {
'DEFINITION' = 'alcohol dehydrogenase (NADP+)
[EC:1.1.1.2]'
},
'5' = {
'DEFINITION' = 'U24 small nucleolar RNA'
}
};
code: in addition to what you had suggested -
if($_ =~ /^DEFINITION\s{2}(.+)?/){
${$keggHash}{$counter} = {'DEFINITION' = $1};
}
if ( $_ =~ /^NAME\s+(.*)$/sm ) {
my $temp = $1;
$temp =~ s/,\s/,/g;
my @names = split /,/, $temp;
push @{${$keggHash}{$counter}{'NAME'}}, @names;
}
}
close $fh;
print Dumper $keggHash;
}
The output being:
$VAR1 = {
'1' = {
'NAME' = [
'E1.1.1.1',
'adh'
],
'ENTRY' = 'K1'
},
'3' = {
'NAME' = [
'U18snoRNA',
'snR18'
],
'ENTRY' = 'K14866'
},
'2' = {
'NAME' = [
'U14snoRNA',
'snR128'
],
'ENTRY' = 'K14865'
}
};
Which to me looks sort of like what you are looking for.
The main thing I did was read the file one line at a time to prevent a
unexpectedly large file from causing memory issues on your machine (in
the
end the structure that you are building will cause enough issues
when handling a large file.
You already dealt with the Entry bit so I'll leave that open though I
slightly changed the regex but nothing spectacular there.
The Name bit is simple as I just pull out all of them then then remove
all
spaces and split them into an array, feed the array to the hash and hop
time
for the next step which is up to you ;-)
I hope it helps you a bit, regards,
Rob
What you do: ${$keggHash}{$counter} = {'DEFINITION' = $1};
Try the following: $keggHash}{$counter}{'DEFINITION'} = $1;
To make things a little clearer look at the following example.
my %hash;
$hash{'Key 1'} = { 'Nested Key 1' = 'Value 1' };
What you do is say: $hash{'Key 1'} = { 'Nested Key 2' = 'Value 2' }
What I do is: $hash
Re: whats the purpose of use Data::Dumper;
On Wed, Jun 1, 2011 at 6:07 PM, eventual eventualde...@yahoo.com wrote:
use Data::Dumper;
Hi,
Can someone give me a few examples on the purpose of use Data::Dumper;
I tried reading but I could not understand.
Thanks
use Data::Dumper;
simply tells perl to load the Data::Dumper module. You can then use the
module to well dump data. :-)
Try the following, create a complex data structure something like this:
use Data::Dumper;
my $complex = [ { 'value1' = 'key1', 'value2' = [ 1, 2, 3, 4, 5 ] },
'Array value 2', '03', [ 'String 1', 'String 2', 'String 3' ], ];
print Dumper $complex;
and you will see something like this:
$VAR1 = [
{
'value1' = 'key1',
'value2' = [
1,
2,
3,
4,
5
]
},
'Array value 2',
'03',
[
'String 1',
'String 2',
'String 3'
]
];
Now it might seem silly at first but if you are dealing with large and
complex data structures that have a mix of arrays, hashs, strings,
references to data structures etc.. then you will soon come to love the
Data::Dumper for its very helpful output.
If you are not sure about loading external modules in perl please have a
look at: http://perl-begin.org/tutorials/perl-for-newbies/part3/ which will
give you a good beginner guide to what modules are and what they are used
for etc.
Regards,
Rob
Re: Can't call method findnodes on unblessed reference; not using OO Perl
On Wed, May 18, 2011 at 10:37 PM, Kenneth Wolcott
kennethwolc...@gmail.comwrote:
Hi;
A colleague claims that he made no changes, code worked yesterday and
doesn't today.
He is not using OO Perl.
I have asked him for a small code snippet that reproduces the error (I'm
sure he is unwilling to show the entire code!).
We have rules requiring the standard use of use strict and use
warnings in all our Perl scripts.
We use Perl on Windows, Linux and Solaris (all his scripts are supposed to
run without modification on Linux and Windows).
He claims this: use strict; use warnings; use XML::XPath;
Trying to get value for:
$ha = $xPath-findnodes('//job');
Error:
Can't call method findnodes on unblessed reference at file_name line
line_number.
Output from Data::Dumper follows:
$VAR1 = {
'object' = [
{
'objectId' = 'job-21461',
'job' = {
'priority' = 'normal',
'status' = 'completed',
'outcome' = 'success',
'jobName' = 'DeleteBuilds-20091106',
'jobId' =
'21461',
'lastModifiedBy' = 'admin',
}
},
{
'objectId' = 'job-21473',
'job' = {
'priority' = 'normal',
'status' = 'completed',
'outcome' = 'success',
'jobName' = 'DeleteBuilds-20091107',
'jobId' = '21473',
'lastModifiedBy' = 'admin',
}
},
]
}
Hi Kenneth,
I think the error is clear on what is going wrong: *Error: Can't call method
findnodes on unblessed reference at file_name line line_number.*
*
*
When you colleague calls: $xPath-findnodes('//job');
Perl tels him that $xPath is not an blessed reference. In human speak it
means he at some point said $xPath = new XML::XPath-new(filename =filename
); and this call failed... or he might have assigned a value to $xPath
destroying XPath the object that it was holding before.
Now lets assume your colleague isn't that silly that he would reassign
$xPath my guess is that the file cannot be read, does not exist or maybe is
locked. I suspect that your colleague is not wrong the code didn't change
but the environment did and now the Perl script does not have rights to read
the file.
Hope that helps,
Rob
ps, you might want to besides the rules to always use strict and warnings
also implement a rule that before opening of a file one always checks if it
exists, and can be opened for the purposes you need it for (read only will
not do if you want to write to it) also enforce a simple check to see if the
new module::xyz call actually did what was expected from it.
Re: Can't call method findnodes on unblessed reference; not using OO Perl
On Wed, May 18, 2011 at 11:25 PM, Rob Dixon rob.di...@gmx.com wrote:
On 18/05/2011 21:37, Kenneth Wolcott wrote:
A colleague claims that he made no changes, code worked yesterday
and doesn't today.
He is not using OO Perl.
You say later that he uses XML::XPath. That is an object-oriented module.
I have asked him for a small code snippet that reproduces the error
(I'm sure he is unwilling to show the entire code!).
We have rules requiring the standard use of use strict and use
warnings in all our Perl scripts.
We use Perl on Windows, Linux and Solaris (all his scripts are
supposed to run without modification on Linux and Windows).
Hi Kenneth.
All of the above may or may not be a proper assessment of your
situation, but it has nothing to do with Perl. My assessment would be
that your manager isn't doing his job, but also that you are bringing a
personal conflict to a Perl list instead of to your manager. He is there
to resolve things like this, and you haven't told him the relevant facts.
He claims this: use strict; use warnings; use XML::XPath;
Until you have evidence otherwise, your colleague is telling the truth.
Trying to get value for:
$ha = $xPath-findnodes('//job');
You have shown no code for the derivation of $xPath, or the declaration of
$ha.
Error:
Can't call method findnodes on unblessed reference atfile_name line
line_number.
Why are you hiding line_number from us when we have no code? That
also makes sense with the rest of your mail, which shows that whatever
you have dumped is unblessed.
Output from Data::Dumper follows:
$VAR1 = {
'object' = [
{
'objectId' = 'job-21461',
'job' = {
'priority' = 'normal',
'status' = 'completed',
'outcome' = 'success',
'jobName' =
'DeleteBuilds-20091106',
'jobId' =
'21461',
'lastModifiedBy' = 'admin',
}
},
{
'objectId' = 'job-21473',
'job' = {
'priority' = 'normal',
'status' = 'completed',
'outcome' = 'success',
'jobName' =
'DeleteBuilds-20091107',
'jobId' = '21473',
'lastModifiedBy' = 'admin',
}
},
]
}
That looks fine, except that all you have printed is a hash of data. It
isn't blessed and so it isn't an object.
Please grow up and ask Perl questions. It looks to me as if you are as
silly as each other. I certainly wouldn't employ either of you.
I also wonder if you 'Kenneth Wolcott' and your friend are the same
person. Since your name sounds English you embarrass me: the vast
majority of Englishmen are far more professional than yourself.
Rob
--
To unsubscribe, e-mail: beginners-unsubscr...@perl.org
For additional commands, e-mail: beginners-h...@perl.org
http://learn.perl.org/
:-) Guess it is getting late in England as well then :-)
Anyway...
use strict;
use warnings;
use Ec;
use XML::XPath;
use Data::Dumper;
my $ec = Ec-new or die Can not create Ec object $!\n;
my $xPath;
$xPath = $ec-findObjects('job');
print Dumper($xPath);
#my $ha = $xPath-findnodes('//job');
#print Dumper($ha);
This makes no sense at all
use strict; # Good no complaints
use warnings; # Good no complaints
use Ec; # What is this a home brew module how is this relevant to the rest
of the code?
use XML::XPath; # XPath module
use Data::Dumper; # My all time favorite module
my $ec = Ec-new or die Can not create Ec object $!\n; # Creating a new Ec
object (what ever it might be) and storing this in $ec
my $xPath; # Declaring a variable called $xPath
$xPath = $ec-findObjects('job'); # Using the $ec variable to do something
and storing the returned value in the $xPath variable
print Dumper($xPath); # Dumping the $xPath variable looking at the above it
is a neat looking nested data structure
#my $ha = $xPath-findnodes('//job'); # Hang on a minute, now the $xPath
variable containing that data structure is used as an object and Perl goes
Bleh!!! not all that strange is it?
#print Dumper($ha);
Re: problem in creating a complex hash
It might not look nice but I would do the following:
#!/usr/local/bin/perl
use strict;
use warnings;
my $arrayref = [ [ [ 'user1', 'c'], [ 'user2', 'a'], [ 'user2', 'b' ],[
'user2', 'd' ],[ 'user3', 'a' ],[ 'user2', 'f' ] ] ];
my %hash;
foreach my $arrayreference ( @{${$arrayref}[0]} ) {
if ( ! defined $hash{${$arrayreference}[0]} ) {
$hash{${$arrayreference}[0]} = { group = [ ${$arrayreference}[1] ] };
} else {
push @{${$hash{${$arrayreference}[0]}}{group}}, ${$arrayreference}[1];
}
}
use Data::Dumper;
print Dumper %hash;
It prints:
$ perl test.pl
$VAR1 = 'user1';
$VAR2 = {
'group' = [
'c'
]
};
$VAR3 = 'user3';
$VAR4 = {
'group' = [
'a'
]
};
$VAR5 = 'user2';
$VAR6 = {
'group' = [
'a',
'b',
'd',
'f'
]
};
Which is I believe what you are after right?
Regards,
Rob
On Fri, May 13, 2011 at 12:11 PM, Agnello George
agnello.dso...@gmail.comwrote:
Hi All
I have a small issue in arranging data with a array ref .
$arrayref = [ [ [ 'user1, 'c'], [ 'user2', 'a'], [ 'user2', 'b' ],[
'user2', 'd' ],[ 'user3', 'a' ],[ 'user2', 'f' ] ] ];
i tried the following
my %sh ;
foreach my $i ( @$arrayref) {
push (@{$sh{$i-[0]}},{group = [$i-[1] } );
}
required hash
%sh = ( user1 = { group = [ c ] },
user2 = { group = [ a b d f] },
user3 = { group = [ a ] }
)
but i am not able to get it in this format .
Can some one please help me out
Thanks a lot
--
Regards
Agnello D'souza
--
To unsubscribe, e-mail: beginners-unsubscr...@perl.org
For additional commands, e-mail: beginners-h...@perl.org
http://learn.perl.org/
Re: help me with a parsing script please
You are almost there :-)
my ($helper1, $helper2);
my $counter = 1;
foreach my $line(@list){
chomp $line;
my @coordinates = split(/' '/, $region);
my $chromosome = $coordinates[0];
my $start = $coordinates[1];
my $end = $coordinates[2];
my $strand = $coordinates[3];
# Using a simple modulo operation (returns 1 if counter is an uneven
number and 0 otherwise
# you can simply decide the even and uneven lines on the uneven line
you capture the Chromosome and Start
# and on the even lines you capture the End and the Strand, as well as
printing out the result of the
# beginning of the previous line and the end of the current line.
#
# Using a for loop instead of a for each loop will result in a nicer
looking loop
# and it might (never actually tested this be a little bit faster as
well (benchmark that to be sure)
# which on large amounts of data as you are likely to be processing
might save you a
# decent bit of time.
if ( ! $counter % 2 ) { $helper1 = $chromosome $start; }
if ( $counter % 2 ) { $helper2 = $end $strand; print $helper1
$helper2\n; }
$counter++;
}
Hope that helps,
Rob
On Thu, May 12, 2011 at 11:23 AM, Nathalie Conte n...@sanger.ac.uk wrote:
HI,
I have this file format
chrstartendstrand
x 12241
x24481
1100124-1
1124148-1
Basically I would like to create a new file by grouping the start of the
first line (12) with the end of the second line (48) and so on
the output should look like this:
x 12481
1100148-1
I have this script to split and iterate over each line, but I don't know
how to group 2 lines together, and take the start of the firt line and the
end on the second line? could you please advise? thanks
unless (open(FH, $file)){
print Cannot open file \$file\\n\n;
}
my @list = FH;
close FH;
open(OUTFILE, grouped.txt);
foreach my $line(@list){
chomp $line;
my @coordinates = split(/' '/, $region);
my $chromosome = $coordinates[0];
my $start = $coordinates[1];
my $end = $coordinates[2];
my $strand = $coordinates[3];
...???
--
The Wellcome Trust Sanger Institute is operated by Genome Research Limited,
a charity registered in England with number 1021457 and a company registered
in England with number 2742969, whose registered office is 215 Euston Road,
London, NW1 2BE.
--
To unsubscribe, e-mail: beginners-unsubscr...@perl.org
For additional commands, e-mail: beginners-h...@perl.org
http://learn.perl.org/
Re: special character regex match
Ok let me try to understand the question.
You have a form (on an HTML page or inside an application, command line or
graphics?), this form contains a textarea that should not allow users to
freely enter text but the input should be scanned for bad characters, if
those are found the user should recieve a warning.
Regardless of the format the backend handling will be the same because you
have to assume a user will find a way to work around any frontend
limitations you impose and send the bad characters directly to your
backend application.
So lets see what we can do with characters:
/
%
$
###
space
use strict;
use warnings;
use Data::Dumper;
print Dumper check_input( '/' );
print Dumper check_input( '%' );
print Dumper check_input( '$' );
print Dumper check_input( '##' );
print Dumper check_input( ' ' );
print Dumper check_input( 'abcdefghijklmnopqrstuvwxyz' );
print Dumper check_input( 'ABCDEFGHIJKLMNOPQRSTUVWXYZ' );
print Dumper check_input( '1234567890' );
print Dumper check_input( '!@^*()_+-=' );
print Dumper check_input( 'a A' );
sub check_input {
my $input = shift; # Take the input from @_
return 1 unless ( $input =~ /\/|%|\$|\#\#|\s/g ); # Return 1 if the input
is free of the bad characters
return 0; # Return 0 the input contained a Bad character
}
I think that should do the trick... but as Rob D. said your question is not
very clear so it might not be what you are looking for at all.
Regards,
Rob
On Thu, May 5, 2011 at 12:28 PM, Rob Dixon rob.di...@gmx.com wrote:
On 05/05/2011 10:56, Agnello George wrote:
Hi
I got a form with and users and insert in textarea words like :
/word_word2/wordword_word.txt
/word1_word/wordword_word2.txt
/word_word/word2word_word.txt
but they should not be able to type the following in the text area
/
%
$
###
space
unless ( $files =~ /^\s+$/ || /[\_\/\@\$\#]/) {
print yes ;
}
I'm sorry, but I don't understand what your question is?
Rob
--
To unsubscribe, e-mail: beginners-unsubscr...@perl.org
For additional commands, e-mail: beginners-h...@perl.org
http://learn.perl.org/
Re: inteligent DBI
Even if it is not possible at the moment you could always overwrite this
function and make it work this way... I suspect it might be quite a bit of
work, but certainly not impossible. After all you are programming anything
you can think of can be done the only question is if it is worth the effort
to do this.
Personally I would simply create a function for this:
sub insert {
my ( $query, $bind_params ) = @_;
my $sth = $dbh-prepare( $query );
$sth-bind_param( @{$bind_params} );
$sth-execute
.
Return the results to the caller
}
Something like that should do the trick (the code above will most likely not
work but I assume you will understand where I am going with this...
Working with Perl in companies you will often see wrappers for DBI that do
things like what you are looking for or that provide other methods of
returning result sets (XML or JSON rather then Perl data structures) stuff
like that. I my self like to use a wrapper that simplifies the DBI interface
a bit so I basically create a DB object that offers me things like insert,
delete, update, execute, select, etc. This wrapper offers log4perl logging
capability and allows me to debug specific statements which means I can by
simply switching on tracing see exactly what query is being send to the
database. That helps a lot certainly if you are dealing with MySQL and their
rather useless way of reporting errors in a query. It also is a great way of
preventing SQL injection issues as you only need to deal with those kinds of
troubles once in the wrapper.
Personally I can say that a good wrapper around a relatively complex module
such as DBI can help a lot in saving time when you end up working with it
over and over again in different projects. The only thing is that if you are
going to be working in a larger team make sure that all team members buy
into the same wrapper and you do not end up with 12 implementations of a DBI
wrapper that all do slightly different things as you all optimized a
slightly different bit of your daily work. ;-)
Regards,
Rob
On Thu, Apr 7, 2011 at 11:01 AM, marcos rebelo ole...@gmail.com wrote:
Probably it is impossible, but it would be really usefull.
I'm doing something like:
my $sth = $dbh-prepare('INSERT INTO my_table(field_1) VALUES (?)');
$sth-bind_param( 1, 'pippo', { 'ora_type' = SQLT_BIN } );
$sth-execute;
since I need to pass a parameter in the bind_param
I would really like to do something like:
$dbh-do( 'INSERT INTO my_table(field_1) VALUES (?)', [ 'pippo', {
'ora_type' = SQLT_BIN } ] )
is there a way to do this?
maybe with some DBIx
Best Regards
Marcos Rebelo
--
Marcos Rebelo
http://www.oleber.com/
Milan Perl Mongers leader https://sites.google.com/site/milanperlmongers/
Webmaster of http://perl5notebook.oleber.com
--
To unsubscribe, e-mail: beginners-unsubscr...@perl.org
For additional commands, e-mail: beginners-h...@perl.org
http://learn.perl.org/
Re: Is CDB_File good for CDB in readonly
Hi Ram, CBD or Berkely DB is optimized for reading, it is meant to deal with large volumes of simple non-relational basic data, so no images blobs, globs or any of that stuff... besides that it will be fast very very fast. To give you an example in the past I used to work on a Berkely DB driven DHCP server for a ISP. The system held some 1.2 million leases for customer systems and their modems. The system had a response times in the sub millisecond range for every query, of course this was while being written to by the backend systems provisioning new customers and updating others with new leases or new subscription types. With 10M records you might not find the response time a little slower (not sure never tried that) but with todays systems and the amount of memory available I have a feeling you will not really notice the response times drop to much (if at all) Anyway, another option might be to do all of this in memory and rather then spend your time messing about with disks or even SSD's you could simply read the CBD once into memory and then work from there. I would not start of with that only bother with something like that if you get in trouble with response times, but it will certainly help a awful lot. As a last point have a look at the internals of the CBD module you are using, if this is pure Perl you will most likely want to redo that in a compiled language like C/C++, just to get that bit extras speed out of it. I hope that helps, even though there is no real Perl in here my mail I think it can still be useful. Regards, Rob On Mon, Apr 4, 2011 at 8:47 AM, Ramprasad Prasad ramprasad...@gmail.comwrote: I have a CDB database with 1 Million to 10 Million records .. This is just a key where the app needs to lookup if an entry exists or not. I dont need the value. My app will be looking up the key_exists() almost 100 times a second What is the fastest way of implementin this I have a few questions 1) Is CDB the best way of storing such data 2) Is CDB_File optimized for readonly lookups 3) Is it recommended to have an in memory hash .. If memory is not an issue ? -- Thanks Ram http://www.netcore.co.in/ n http://pragatee.com
Re: perl dd
On Mon, Mar 28, 2011 at 10:18 AM, a b testa...@gmail.com wrote: Hi, I want to know if any module for dd in perl is available. Any pointers will a great help Thanks, a b Have you tried having a look at search.cpan.org? Oh, by the way what does dd stand for? Acronyms are great and all but unless you are asking the guy next to you working with the same acronyms on a daily basis it is unlikely that others will know what it is that you are talking about. Regards, Rob
Re: perl dd
I had a quick look but I can only see people making system calls using system() or exec() etc... which sort of makes sense as there is no such command on pretty much any system except for *nix systems. I think you might simply have to write your own implementation or simply rely on system calls to get this done. IT will mean though that you code will not be very portable as it will only work on *nix systems and not on pretty much anything else. Regards, Rob On Mon, Mar 28, 2011 at 11:05 AM, a b testa...@gmail.com wrote: Hey Rob, Yes, you are right Thanks to mention this out. I was referring to unix dd command. was wondering if we have any module already available. i didn't found on cpan Thx a b On Mon, Mar 28, 2011 at 2:05 PM, Rob Coops rco...@gmail.com wrote: On Mon, Mar 28, 2011 at 10:18 AM, a b testa...@gmail.com wrote: Hi, I want to know if any module for dd in perl is available. Any pointers will a great help Thanks, a b Have you tried having a look at search.cpan.org? Oh, by the way what does dd stand for? Acronyms are great and all but unless you are asking the guy next to you working with the same acronyms on a daily basis it is unlikely that others will know what it is that you are talking about. Regards, Rob
Re: Using regex special characters from a string
Hi Ben,
Not sure I get your point... but this is what it sounds like to me.
I have a script, and I want to feed it a special thing to let it know that
any character (A-Z or a-z does upper lower case matter?) is valid, but I
also want to use other characters at the same time. So ./script.pl -s ABC is
valid but also ./script.pl -s ABany characterDEF is valid.
In most operating systems this is done by the * or the ? character *
representing 1 or infinite characters an ? 1 character.
So to keep with the general style of things and keep the learning curve as
low as possible you could just say that * you do not use because this would
cause an infinite number of possible characters, combinations and
permutations which is kind of pointless unless you want the script never to
return any real results. So only ? then so something like this
./script.pl-s l??p would result in the words leap, loop, pool etc...
So all you need to do is simply say in case I see the character ? treat this
as [a-z] or [a-zA-Z] in your regex and you should be fine. A if ( $character
eq '?' ) { $character = '[a-zA-Z]'; } should do the trick.
I guess I am thinking to simple here or simply misunderstanding the problem
as it seems simple enough. It would work if you could for instance post a
bit of example code so the list can see what you are up to, sometimes a few
lines of code can say more then a thousand words ;-)
Regards,
Rob
On Tue, Mar 8, 2011 at 9:42 PM, Ben Lavery ben.lav...@gmail.com wrote:
Hi all,
I have a script which takes a string of alphabetic characters as an
argument, generates all combinations of the characters and all permutations
of the combinations, then looks up each result in a list of valid words, if
the result is a valid word it gets stored in an array.
I would like to be able to specify any alphabetic character from the
command line. Is there a clean way of doing this? I thought that I could
search the string for such characters and cycle through all legal
combinations, but this does seem particularly clean...
I've had a look about and found lots of things about using wildcards from
the command line that the shell deals with, but nothing about using a
wildcard or otherwise inside a script which was declared on the command
line...
Many thanks for your time,
Ben
--
To unsubscribe, e-mail: beginners-unsubscr...@perl.org
For additional commands, e-mail: beginners-h...@perl.org
http://learn.perl.org/
Re: multidimensional array check
Hi Vito,
Ok so lets give this a try...
First lets deal with comparing the arrays then we can get to the size issues
and memory usage etc...
You have the data in an array which is good but not all that nice as after
all it will make for a lot of work if you want to compare two arrays (you
end up having to compare all elements in array 1 with all elements in array
2 which means with 100 elements in each array already 100x100 = 1
comparisons which if your data sets grow will only get worse.
So lets use a hash instead as this allows for a key value and used in a
intelligent way will save you a lot of comparing. Here is what I would do:
use strict;
use warnings;
my @G1 = ([alfa , 10], [beta , 11]);
my @L1 = ([alfa , 10], [gamma , 12]);
my @unique;
my @overlap;
my %hash;
foreach my $result ( @G1 ) {
my $key = join '*|*', @{$result}; # Makes [alfa, 10] into alfa*|*10
# @{$result} tells perl that $result contains an array
otherwise this whole trick would not work ;)
$hash{ $key }++;
}
# We now see in %hash the following key value pairs alfa*|*10 = 1 and
beta*|*11 = 1
# all that is left is adding to the the other array and we will find the
over lap automatically
# Since we will never use @G1 again we can drop this
undef @G1; # Basically sets @G1 to undef and lets perl know we will never
use this data again so it is free to clean up the memory
foreach my $result ( @L1 ) {
my $key = join *|*, @{$result}; #makes [alfa, 10] into alfa*|*10
# @{$result} tells perl that $result contains an array
otherwise this whole trick would not work ;)
$hash{ $key }++;
}
# %hash will now contain alfa*|*10 = 2 and beta*|*11 = 1
# finding out which once are unique is easy we simply remove all that have a
value greater then 1
# Since we will never use @L1 again we can drop this
undef @L1; # Basically sets @L1 to undef and lets perl know we will never
use this data again so it is free to clean up the memory
foreach my $key ( keys %hash ) {
if ( $hash{ $key } == 1 ) { # This key only appeared once
my @array = split ( /\*\|\*/, $key ); # Pull the key apart into the two
values (or 200k values if you have that many columns o course)
# Now we add this to the @unique array
push @unique, [@array];
} else { # This is where we deal with the over lapping results
my @array = split /\*\|\*/, $key; # Pull the key apart into the two values
(or 200k values if you have that many columns o course)
# Now we add this to the @overlap array
push @overlap, [@array];
}
}
use Data::Dumper;
print Overlap\n;
print Dumper @overlap;
print Unique\n;
print Dumper @unique;
Thats easy enough right? Of course the perl purists will say use map, etc
but that would hide a bit to much about the logic of what is going on from a
beginner of course you should know that this ca all be done a lot faster and
more efficient etc. But for a beginner it is more important that you
understand the logic of it all then that you know the fancy tricks without
understanding how they work.
Anyway I think this is what you are looking for... A DB link is always a
hard thing to get approved I know that one besides depending on the location
of the databases you might not gain all that much by having the database
deal with this for you due to network latency and such things. If you did
want to do this on the DB level look at the oracle MINUS command for the
easiest way to implement this though there are others of course ;-)
I hope this helps you a bit, regards,
Rob
On Fri, Mar 4, 2011 at 12:30 PM, mammoccio vito.pasc...@gmail.com wrote:
First of all, thank for u support! Really !
The most efficient way would be to arrange to have the Oracle database
engine do most of the comparisons. I am not enough of a database expert
to
recommend ways to do this.
I agree with u , but it's something that is not possible without a
dblink, that's why I'm here to write some code :)
The fastest way to do this in Perl would be to save the results of one
query
in memory in a data structure of some type, either an array or a hash.
Then,
as the results from the second query are fetched, compare against the
copy
in memory and save what differs (you have not explained how to decide
when
the two results differ).
That's exactly what I was trying to do,and u are right probably I was
not so clear about how to decide when the two results differ.
Let's try to put some light on:
The results of the first query will be an array something like this:
@G1 = ([alfa , 10] ,
[beta , 11]);
Similar the second query will give this kind of array:
@L1 = ([alfa , 10],
[gamma , 12]);
And finally the third query:
@G2 = (gamma);
G1 and G2 are two query on the same db and same schema too.
L1 is on another db server and of course on a different schema.
So what I need is to discharge the results that I found in all the three
queries and take only
Re: multidimensional array check
You are now talking about the finer points of the DBI module... :-)
The simplest way of doing what you want is this:
my $tbl_ary_ref = $query_handle-fetchall_arrayref;
Here though you will need a bit of background as this does exactly what you
are looking for but with a twist. I'll try to explain...
In perl every value you store no mater if it is a scalar ($x = 1) an array
(@x = [0]) or an hash (%x = { 'key' = 1}) they all are stored in your
computers memory. And when you say my $y = $x; what perl will do is make a
copy of $x and call that $y. Now you are taking twice as much memory which
is not a problem if $x has a value of '1' but if $x contains the collected
works of 19th century poets then this can be quite expensive in terms of
memory usage.
So there is another way to achieve the same instead of saying my $y = $x;
you can say my $y = \$x; what perl does in this case is fill $y with a
reference to $x. This reference tells perl where in the memory $x is stored.
this way you save a lot of memory and still have two variables with
identical values in them. Now I suspect that you are already thinking wait a
moment if $y only points to $x and I change something in $x will this not
influence $y, and you are right. For what we are going to be doing this is
not that important but it is good to know for trouble shooting strange
behavior in your future scripts. ;-)
Of course what you can do with scalars you can do with arrays and hash's as
well just as easy.
So what $tbl_ary_ref will contain results as a reference to array which
contains references to arrays for each row so basically [ [column 1,
column 2], [column 1, column 2]]. The only thing is you will need to
access this data...
Remember the comment I made about the @{$result} comment in my previous
email thats how it is done, perl sees only the reference so what we did
there is we told perl that it should treat this $result as an array.
So in your case to get to the actual value of column 1 on row 5 of the
result set you would write something like this:
my $row_ref = ${ $tbl_ary_ref }[4]; # Get to the right row (number 4 as perl
arrays start counting at 0 not at 1)
my $column_value = ${ $row_ref }[0]; # Using ${}[0] notation as @{}[0] just
like @array[0] will result in a warning though it will still work for
compatibility reasons
or of course if you want to be fancy:
my $value ${ ${ $tbl_ary_ref }[4] }[0]; # This will provide the same result
as above but is far less readable and not all that desirable because of it
A last point that you will want to know when you start working with
references is that you can always dereference something (basically make a
copy of what ever the reference is pointing to. So you can for instance do
this:
my @array = [ 'an array' ];
my $array_ref = \@array;
my @copy_array = @{$array_ref};
Doing this means that you can safely make changes to the @copy_array without
having to worry about making a mess of the array that $array_ref is pointing
to. It will how ever cause you to have that array in memory twice, so there
is a price to pay for that.
So you should now be able to retrieve the whole result set as a reference to
an array containing references to arrays. And I hope that
my ramblings explained a bit how you can use that reference to get to the
underlying values. If you combine all of that I think you'll be able to work
out the way to get your program to work the way you want it to.
By the way I would if I where you pick a slightly less complex task to learn
a programming language with next time, this one is though interesting
certainly not an easy one to use as a way to learn the language. :-)
Regards,
Rob
On Fri, Mar 4, 2011 at 3:25 PM, mammoccio vito.pasc...@gmail.com wrote:
Il 04/03/2011 13:26, Rob Coops ha scritto:
First of all, really tnx Rob! I really appreciate u way to teach (even
to folks with no programming background like me) the logic behind!
I know that maybe this is a silly question but how can I transform the
my @G1 = ([alfa , 10], [beta , 11]);
In something that take data from the oracle select statement ?
I mean I tried something like:
my @G1 = $query_handle-fetchrow_array
But it simply don't works
I was at this point before and I got no solution because I always see
example that using something like
while (my @G1 = $query_handle-fetchrow_array)
{ do something
};
and I didn't found a simply solution to put stuff in a array...
Sorry to bother with so silly question, but really I want to learn how
to do it!
--
Vito Pascali
ICT Security Manager
IT Senior System Administrator
vito.pasc...@gmail.com
Re: multidimensional array check
You are very right a really nice explanation of this you can find in the Advanced Perl Programming book by Oreilly see the link below http://oreilly.com/catalog/advperl/excerpt/ch01.html If you already went trough the other two then this is definitely a good one to read as it goes that extra step and provides you with a good insight of the underlying logic. On Fri, Mar 4, 2011 at 7:30 PM, Brian F. Yulga byu...@langly.dyndns.orgwrote: Rob Coops wrote: So you should now be able to retrieve the whole result set as a reference to an array containing references to arrays. And I hope that my ramblings explained a bit how you can use that reference to get to the underlying values. If you combine all of that I think you'll be able to work out the way to get your program to work the way you want it to. FWIW, I found your ramblings quite helpful, since I am working to get more comfortable with variables, arrays, and references, on my way to learning objects. Coming from a basic understanding of C, the reference variable concept sounds a lot like pointers in C. But, my Learning Perl and Intermediate Perl books do not use that terminology. Am I on a correct path to understanding by making this analogy? Thanks, Brian
Re: perl's threads
I have to agree I missed things a bit there :-( forks are simply a better way of dealing with threads then the default perl ithreads, the benefits forks offer goes far beyond the minimal drawbacks. By now the notes about modules that still insist on using threads rather then forks will for most users just be informative as the better solution has been available for long enough for most module maintainers to switch. On Thu, Feb 10, 2011 at 11:05 AM, Dr.Ruud rvtol+use...@isolution.nl wrote: On 2011-02-09 14:03, Rob Coops wrote: But any developer that tells you that threads are not worth the trouble they cause or anything along those lines is clearly an experienced programmer who unfortunately has not realized yet that the computer world has changed incredibly over the past few years. Rob, from your reply I understand that you didn't pick up that it is about the forking/threading difference. (So it is not about doing things in parallel or not, as you seem to think.) This discussion is about why threads are (mostly) wrong, and forks are (basically) right, when it comes to parallelization. -- Ruud -- To unsubscribe, e-mail: beginners-unsubscr...@perl.org For additional commands, e-mail: beginners-h...@perl.org http://learn.perl.org/
Re: perl's threads
Just adding a little to this discussion then. :-) Threads regardless of the language are meant to do multiple things in parallel. For instance I'm at the moment working on a tool that extracts vast amounts of data from a web service as the calls to that service are pretty much independent and the data on my side is first stored in a database before further processing (using separate tables for each of the calls) there is very little point in doing these actions sequential. After all both the database and the webservice are fully capable of handling hundreds or even thousands of requests at a time without fail so why not run things in parallel? I found that even with a minimal amount of data I can speed up the process a lot by simply creating an object that deals with the database and using this as a base class to build the various API calling objects on. Each object then is fully self contained deals with the retrieval of its own data massaging that in a format that fits in its own tables and uses its parents code to deal with the database insertion. It depends on your intended usage of threads, if you are thinking along the lines of a multi threaded process that operates on shared data, where the threads are constantly sharing outcomes and using the results other threads have produced to continue their processing so they can supply the yet other threads with data... think again. Though of course possible in Perl it is also an very very complex thing to do and the performance will simply not be there at least not when comparing to other solutions. But as said for simple parallel and independent actions using threads in Perl is not such a bad idea. The idea that threads are always bad regardless of programming language or are bad i many languages is simply not true. Threads certainly have a place in programming and in many if not all programing languages. With the many core processors of to day and tomorrow threads will become a much more important and useful tool in the programmers arsenal. The main thing is that for a very long time programmers have had very little real use for threads as most computers had a single core with 1 or in later years 2 threads per core. That simple fact has convinced many programmers that threads are not all that they are hyped up to be. After all you are still waiting on the hardware to become available and if you run more then 2 threads at a time the time the processor needs for switching between threads removes many of the performance benefits threads could offer. Now though that one sees processors that can handle up to 32 threads and soon even 128 threads at a time multiple threads will prove to be a lot more useful then most programmers have given them credit for. As the processor does not need to do all the switching between threads and can simply continue working on the thread without interruption the additional speed that literally processing in parallel can bring will be very noticeable. The main problem that developers will find in terms of raw performance is the I/O of these systems which will not be able to provide data fast enough to keep the threads from having to wait for data to become available. Of course the old monster of how do you deal with multiple threads that do need to exchange data will be back on the table and certainly if you are doing funky stuff such as AI where many different inputs are processed at the same time and all can and should to an extend influence each other then you will spend many nights waking up screaming in the middle of the night as you got tangled in the multiple thread nightmare again. As for Perl the threads implementation on it offers is not to bad and quite convenient for the simpler parallel run scenario. For serious performance in the multi threaded arena Perl is simply not the tool for the job, it is as simple as that. But any developer that tells you that threads are not worth the trouble they cause or anything along those lines is clearly an experienced programmer who unfortunately has not realized yet that the computer world has changed incredibly over the past few years. 2011/2/9 Shlomi Fish shlo...@iglu.org.il On Tuesday 08 Feb 2011 10:05:47 Dr.Ruud wrote: On 2011-02-07 11:30, Shlomi Fish wrote: Threads work pretty well in C, though they are extremely tricky to get right for non-trivial programs That they work pretty well is probably about user experience of some heavily interactive system. But only if the user accepts crashes and deadlocks now and then. What I meant by work pretty well, is that they are lightweight, cheap, perform well, and can often increase performance. The tricky to get right misses the point that systems based on threads have no proper math to back them up. [citation needed]. I believe I've seen some mathematical models of threads, and you can prove the lack of deadlocks/livelocks/etc. in a model of the system mathematically. But like you said, if one
Re: Need Help with Perl Mobile Environment
On Tue, Jan 25, 2011 at 8:46 AM, Khabza Mkhize khabza@gmail.com wrote: Can you please help with where to find information about Perl mobile version I need to develop Accommodation Booking Website that will run on Smart phone, Iphone And Blackberry. Please send me a links with relevant information regards Khabazela Green IT Web http://www.greenitweb.co.za -- To unsubscribe, e-mail: beginners-unsubscr...@perl.org For additional commands, e-mail: beginners-h...@perl.org http://learn.perl.org/ Hi Khabazela, As you will not be running Perl on the mobile but on the server side you should be fine. The way it is normally done you use CGI for all your server side jobs such as keeping track of sessions, entering data in databases or other content stores, sending out mails etc, etc, etc. The end user gets to see a nice page with html, css and javascript that does all the funky ajax stuff (which calls your server side script written in perl) to spice things up a bit. It is no different then creating something like this with PHP, VB, J2EE or any other server side language. Even the techniques used to communicate between the javascript on the customer side and the code on the server side will be the same. So much so that you can use things like jQuery or GWT on the client side and implement the server side in Perl without the user noticing the difference. There are lots of examples but looking at what you are building I would advise having a look at a lot of the security related examples as well things that explain how your side can be hacked sessions taken over and information from users copied as most examples you will find online seem to completely ignore the security aspect of building a website which in your case could cause serious problems. Regards, Rob
Re: Capture nth element of a file
On Fri, Jan 21, 2011 at 5:43 PM, jet speed speedj...@googlemail.com wrote:
Hi All,
I need some help with the blow.
I have a an input file with the below data
1835
1836
1837
1838
1839
183A
183B
183C
183D
#!/usr/bin/perl
use strict;
use warnings;
my $filename;
$filename = input.txt ;
open (FILE, $filename ) or die Could not open $filename: $!;
while (FILE) {
chomp;
print $_ \n;
}
I can successfully read the file with this, what i want to achive is to
capture every 4 th element of the input file into a variable ex: $A.
that would be
1838
183C
Any help would be much appreciated.
Regds
Sj
Using a simple counter would do the trick...
#!/usr/bin/perl
use strict;
use warnings;
my $filename;
my $counter = 0;
my $A;
$filename = input.txt ;
open (FILE, $filename ) or die Could not open $filename: $!;
while (FILE) {
chomp;
$counter++;
next unless ($counter == 4);
push @{$A}, $_ . \n;
}
use Data::Dumper;
print Dumper $A;
Re: Capture nth element of a file
On Fri, Jan 21, 2011 at 5:57 PM, Rob Coops rco...@gmail.com wrote:
On Fri, Jan 21, 2011 at 5:43 PM, jet speed speedj...@googlemail.comwrote:
Hi All,
I need some help with the blow.
I have a an input file with the below data
1835
1836
1837
1838
1839
183A
183B
183C
183D
#!/usr/bin/perl
use strict;
use warnings;
my $filename;
$filename = input.txt ;
open (FILE, $filename ) or die Could not open $filename: $!;
while (FILE) {
chomp;
print $_ \n;
}
I can successfully read the file with this, what i want to achive is to
capture every 4 th element of the input file into a variable ex: $A.
that would be
1838
183C
Any help would be much appreciated.
Regds
Sj
Using a simple counter would do the trick...
#!/usr/bin/perl
use strict;
use warnings;
my $filename;
my $counter = 0;
my $A;
$filename = input.txt ;
open (FILE, $filename ) or die Could not open $filename: $!;
while (FILE) {
chomp;
$counter++;
next unless ($counter == 4);
$counter=0; # Of course you should not forget to reset your counter ;-)
push @{$A}, $_ . \n;
}
use Data::Dumper;
print Dumper $A;
Re: Strategy for diagnosing context-sensitive bug
On Tue, Dec 7, 2010 at 2:21 PM, Rob Dixon rob.di...@gmx.com wrote:
On 07/12/2010 09:24, Jonathan Pool wrote:
Are you familiar with the perl debugger?
Thanks much for your reply. I haven't used the debugger, partly
because its documentation describes it as an interactive tool and
it's not clear to me how that works in my context. The script is
executed by httpd in response to a browser form submission, which
includes a file upload.
Alternatively you could take a look at the Tie::Watch module to do
asimilar thing without using the debugger.
I could look into using this. On the other hand, to get access to
the variable's value one can use warn to write to the error log, and
yet
that blocks the problem from occurring, so I can imagine that any other
method that reads the value and writes it somewhere will do the same.
I would like to see the Perl source to be able to be more helpful
to you.
The current script where the error occurs is at
http://panlex.svn.sourceforge.net/viewvc/panlex/perl/plxu.cgi?revision=27view=markup
The error occurs at line 1297.
So the line in question is
@res = (split /\n\n/, ($in{res} = (NmlML ($in{res}))), -1);
and, although I can see no proper reason why it should make any difference
in this case, I recommend removing the ampersand from the function call: it
is bad practice in anything but very old Perl. I would also prefer to lose a
few parentheses, purely for the sake of readability. So please try this:
@res = split(/\n\n/, $in{res} = NmlML($in{res}), -1);
Cheers,
Rob
--
To unsubscribe, e-mail: beginners-unsubscr...@perl.org
For additional commands, e-mail: beginners-h...@perl.org
http://learn.perl.org/
Hi Jonathan,
I have had situation with a very old perl (5.4 or something like that) where
on a certain line I would get an error thrown every single time, but if I
added a few lines to the script even empty lines the error would not occur
at all no mater what the data was that I put in. This was in combination
with Apache httpd, since the whole thing was hosted with the cheapest web
host available on the web at the time I dismissed this as a error in their
setup and didn't bother figuring it out. I mean if a few empty lines can
resolve the problem why bother spending a lot of time on identifying a
seemingly random error.
At the time I was fairly new to perl and was quite sure that my lack of
knowledge was the thing that caused the problem in the first place but now
that I see your problem description I am not so sure anymore... who knows
there might be certain cases where perl + apache + certain commands in
certain combinations cause these inexplicable problems to occur. Could you
just for fun add a few empty lines (say 50 or so) just before the line 1297
and see if you then get the same error on line 1347? If not then your
problem is 100% identical to the problem I was facing several years ago and
maybe just maybe it was not my lack of perl knowledge or the bad hosting
provider that was at fault.
The biggest problem I have with CGI scripts is that they are so hard to
debug, it really comes down to pushing data to the error log or some other
file you are using to keep track of what is going on in the application, but
simply stepping trough the script and seeing where the problem comes from is
not an option which I feel is a really big gap in a developers options to
properly resolve reported bug in an application.
Regards,
Rob
Re: Read logfile to variable hash
On Wed, Dec 1, 2010 at 10:24 AM, Dennis Jakobi roec...@googlemail.comwrote:
Hi there,
I have the following problem:
I want to read a logfile in which every line follows this rule:
value1:value2:value3...
But the number of values differs. Sometimes a line has 2 values (the
minimum) and sometimes 3 or more values. Now I want to push these
values into a hash that follows that form:
$hash-{value1}-{value2}...
This is what I have so far:
sub readLog {
my $self = shift;
my $logfile = getFilename();
open LOG, $logfile;
foreach my $line (LOG) {
my @values = split /\:/, $line;
... # at this point I don't know what to do :(
}
}
Greetings
Dennis
--
To unsubscribe, e-mail: beginners-unsubscr...@perl.org
For additional commands, e-mail: beginners-h...@perl.org
http://learn.perl.org/
Hi Dennis
I know a weird question that you likely already thought about but still why
are you not using a combination of array and hash?
$hash-{value1} = [ value2, value3, value4, ... ]
It would save you a lot of headaches in looping over all values that are on
that one line because how are you going to easily handle a situation where
you have a hash of hashes with an undefined depth without having to jump to
a lot of difficult hoops to make it work properly?
Regards,
Rob
Re: finding duplicates in txt file
On Wed, Nov 10, 2010 at 1:58 PM, Natalie Conte n...@sanger.ac.uk wrote:
HI,
I have to find triplicates ProbeName $arg[8] in a txt file and
calculate a mean of their associated valueProbe $args[13]
At the end my txt file has to contain unique probeName and valueProbe .
This si my beginning of a script to pull out the probename and
valueProbe information , I must say after that I don't know where to
start to get duplicate and mean.
use strict;
use warnings;
my @files = glob('/file/*sed91.txt');
foreach my $file (@files) {
open (INFILE, $file) or die line15 $!;
open (OUTPUT, $file._output.txt) or die line16 $!;
while (my $line= INFILE){
my @args =split (/\t/, $line);
print OUTPUT $args[8] . \t . $args[13] .\n;
}
close OUTPUT;
close INFILE;
}
Thanks
Nat
--
The Wellcome Trust Sanger Institute is operated by Genome Research
Limited, a charity registered in England with number 1021457 and a
company registered in England with number 2742969, whose registered
office is 215 Euston Road, London, NW1 2BE.
Hi Natalie,
You managed to get the list of name and number, so far so good now the next
step.
First of all write on a piece of paper how you would do this same task when
presented with the list you are printing to OUTPUT.
I think you would so somehting like this:
Write doen all the unique names
For each unique name write down all the numbers associated with that name
Take all the numbers and calculate the mean value
So why not do exactly that:
Make a hash with all the names.
So now lets go over this list for each key you find any numbers associated
with this key (the key being your unique name) and add this to an array
which we save as the value of this key.
Now you should have an array that has as KEY - VALUE pairs: Unique name,
Array of values
Calculating the mean value given a list of numbers should be easy enough.
Of course you can compress this to a but less steps when programming but the
general idea is the same.
So your program woudl look like this.
my %final_hash;
while (my $line= INFILE) {
my @args =split (/\t/, $line);
print OUTPUT $args[8] . \t . $args[13] .\n;
if ( ! defined $final_hash{ $args[8] } ) {
# If the name has not been seen yet we assign it an array with one
value.
$final_hash{ $args[8] } = [ $args[13], ];
} else {
# If the name already exists then we simply add to the array we already
have.
$final_hash{ $args[8] } = push @{ $final_array{ $args[8] } }, $args[13];
}
}
# Now you calculate the mean value
foreach my $name ( keys %final_hash ) {
my @list_of_values = $final_hash{ $name };
my $mean;
...
# Up to you ;-)
...
print OUTPUT $name . \t . $mean . \n;
}
That should pretty much do the trick I would think...
Regards,
Rob Coops
Re: using Net::SMTP unable to send out a mail
On Thu, Nov 4, 2010 at 9:50 AM, Agnello George agnello.dso...@gmail.comwrote: HI i wrote a small simple script using Net::smtp however my local MTA is not accepting the mail here is the script : = #!/usr/bin/perl use strict; use warnings; use Net::SMTP; use Getopt::Long; my $from = '' || 'sys...@server1.com' ; my $sub = '' || 'this is a testmail'; my $content = '' || 'this is a data'; my $to; my $relayhost = '' || 'localhost'; GetOptions( 'from|f=s' = \$from , 'to|t=s' = \$to, 'sub|s=s' = \$sub , 'content|c=s' = \$content, 'relayhost|h=s' = \$relayhost ); die 'usage: sendmemail.pl--to n...@email.com' unless( $to ); my $smtp = Net::SMTP-new($relayhost, Debug = 1, ); $smtp-mail($from); $smtp-to($to); $smtp-datasend(Subject: $sub); $smtp-datasend(\n); $smtp-datasend($content\n); $smtp-dataend(); $smtp-quit(); i am getting the following error while executing the script [r...@localhost scripts]# perl sendmemail.pl -t agnello.dso...@gmail.com Net::SMTP Net::SMTP(2.31) Net::SMTP Net::Cmd(2.29) Net::SMTP Exporter(5.62) Net::SMTP IO::Socket::INET(1.31) Net::SMTP IO::Socket(1.30_01) Net::SMTP IO::Handle(1.27) Net::SMTP=GLOB(0x8fc86ac) 220 localhost.localdomain ESMTP Postfix Net::SMTP=GLOB(0x8fc86ac) EHLO localhost.localdomain Net::SMTP=GLOB(0x8fc86ac) 250-localhost.localdomain Net::SMTP=GLOB(0x8fc86ac) 250-PIPELINING Net::SMTP=GLOB(0x8fc86ac) 250-SIZE 1024 Net::SMTP=GLOB(0x8fc86ac) 250-VRFY Net::SMTP=GLOB(0x8fc86ac) 250-ETRN Net::SMTP=GLOB(0x8fc86ac) 250-ENHANCEDSTATUSCODES Net::SMTP=GLOB(0x8fc86ac) 250-8BITMIME Net::SMTP=GLOB(0x8fc86ac) 250 DSN Net::SMTP=GLOB(0x8fc86ac) MAIL FROM:sys...@server1.com Net::SMTP=GLOB(0x8fc86ac) 250 2.1.0 Ok Net::SMTP=GLOB(0x8fc86ac) RCPT TO:agnello.dso...@gmail.com Net::SMTP=GLOB(0x8fc86ac) 250 2.1.5 Ok Net::SMTP=GLOB(0x8fc86ac) Subject: this is a testmail Net::SMTP=GLOB(0x8fc86ac) this is a data Net::SMTP=GLOB(0x8fc86ac) . Net::SMTP=GLOB(0x8fc86ac) 221 2.7.0 Error: I can break rules, too. Goodbye. Net::SMTP=GLOB(0x8fc86ac) QUIT Net::SMTP: Unexpected EOF on command channel at sendmemail.pl line 34 your help will be of much value . Thanks -- Regards Agnello D'souza Hi Agnello, Maybe have a short look at the following document: http://www.answersthatwork.com/Download_Area/ATW_Library/Networking/Network__3-SMTP_Server_Status_Codes_and_SMTP_Error_Codes.pdf And then in particulair the following section: *SMTP Error 221 : The server is ending the mail session –* *it is closing the conversation with the ISP as it has no more* *mail to send in this sending session.* *SMTP Status 221 is often misconstrued as an error* *condition, when it is in fact nothing of the sort. The mail* *server is simply telling you that it has processed everything* *it was given in this particular session, and it is now going* *back into waiting mode.* *Because SMTP status 221 is often misinterpreted, with* *some mail servers the Network Administrators have* *changed the default text of SMTP Reply 221 to something* *more meaningful and less alarming. For example, a typical* *SMTP reply 221 might say “221 Goodbye” or* *“221 Closing connection”, or the most irritating one we’ve* *seen “221 Bye”, Arrrgghh – can you blame anyone for* *thinking there might be a problem ? Of course not ! So* *some Network Administrators are these days being quite* *imaginative by changing the default text of SMTP reply 221* *to more user friendly messages like : “221 Thank you for* *your business” (I love that one!), or “221 All messages* *processed successfully in this session, SMTP connection* *is closing”.* It looks to me like all is working fine as far as the sending of mail goes... the only reason you might not recieve the email I can think of is that your SMTP server would not be able to deliver the mail to the mailbox of the recieving party because it does not have access to the mailbox or because it cannot reach another mail relay that will be able to get the message delivered. In short you SMTP server configuration might need a tweak but as far as I can tell you are doign everything right on the perl end. Regards, Rob
Re: Extract Javascript
On Thu, Oct 14, 2010 at 7:48 PM, bones288 bkneab...@gmail.com wrote: what should I look into for extracting javascript from a webpage: http://www.costofwar.com/ I want to periodically check the counter but I'll I can see is: script type=text/javascript src=/js/costofwar/costofwar-main.js/ script So I don't 'see' the changing counter number. Any ideas? -- To unsubscribe, e-mail: beginners-unsubscr...@perl.org For additional commands, e-mail: beginners-h...@perl.org http://learn.perl.org/ No need for perl here is is just a very simple java script that is included by using the relative path to the file to include. In short the full script can be found at: http://www.costofwar.com/js/costofwar/costofwar-main.js Have a look at a basic explanation about javascript and you will see how this woks or just click on the link in this email ;-) Regards, Rob
Re: split log file
On Thu, Oct 14, 2010 at 4:54 PM, yo RO lyn...@gmail.com wrote: Hello I need to split a log file per days I have a file in txt format and I want to create a file with all data from one day in one file I will give example I have this imput 3_21_2010;11:12\\trafic info 3_21_2010;11:34\\trafic info 3_21_2010;13:21\\trafic info 3_22_2010;11:12\\trafic info 3_22_2010;11:34\\trafic info 3_22_2010;13:21\\trafic info 3_22_2010;11:12\\trafic info 3_23_2010;11:34\\trafic info 3_23_2010;13:21\\trafic info 3_23_2010;13:21\\trafic info 3_24_2010;11:12\\trafic info 3_24_2010;11:34\\trafic info 3_24_2010;13:21\\trafic info I want to have in output 3 file file 1: name 3_21_2010.log contain 3_21_2010;11:12\\trafic info 3_21_2010;11:34\\trafic info 3_21_2010;13:21\\trafic info file 2 : 3_22_2010.log contain 3_22_2010;11:12\\trafic info 3_22_2010;11:34\\trafic info 3_22_2010;13:21\\trafic info 3_22_2010;11:12\\trafic info and like this please help help me with this -- To unsubscribe, e-mail: beginners-unsubscr...@perl.org For additional commands, e-mail: beginners-h...@perl.org http://learn.perl.org/ This is the trick I would use. 1. Read the directory containing the files and make an array of all files matching your file naming convention (use a regex for the check of the filename convention) 2. Now loop over the array in step one and make a hash using the month_day notation as the key and an array of filenames matching this month_day notation as the value 3. For each key in the array create a new file and open all files in the value array of that key and write their contents to the new file just created. (of course you will have to sort your array first to make sure that the logs are opened in the right order) 4. Optionally remove the old logs by simply unlinking them You could of course combine step 1 and 2 into a single pass the same goes for step 3 and 4 but breaking things down in small steps first and then once you get your head around it working out how to do this more efficient is usually easier to do. This sounds to much like a home work assignment to write it all out for you, if it is I am sure that most of this you have already dealt with in class it is just the combination of all the different elements that is the challenge. If it is not then I am sure that by looking up the basic steps one at a time (Read directory, regular expression, create hash, create/read file and unlink are the terms you want to search for) you will be able to figure it out. Regards, Rob
Re: perl real life exercise
On Fri, Oct 15, 2010 at 9:02 AM, Agnello George agnello.dso...@gmail.comwrote: HI Is there any site or any book other than learning perl where i would get real life exercises on perl scripting. Thanks -- Regards Agnello D'souza Hi Angello, What is your real life? I mean there are great books about graphics with perl and a few about algorithms I have seen a couple about bioinformatics, web development AJAX and I am sure that there is a lot more stuff out there for specific fields of real life application. First of all you will need to figure out what it is that you will want to do with perl in real life, then I am sure that you will find there is a few books on that particular subject. Personally I found the best way to get real life experience is by simply finding a challenge in real life and trying to use perl to overcome it. If you have sorted that out find a new one and solve it, as you go a long you will find much better ways to solve the challenges you struggled with originally. Of course finding modules on CPAN as suggested before and looking at how they deal with a real life problem can be very interesting but also certainly for a beginner very confusing as these modules often have been written by people with many years of experience and especially the better known and usually more used once have been written over a period of several years refining and improving the code along the way, so don't be discouraged if you end up scratching your head for a while trying to make sense of these things. Online tutorials usually range from bad to real bad and often do not bother with fundamental things like strict and warnings, let alone for webpage examples using taint and attempting to even at a very high level protect against SQL injection and other very simplistic attacks. So if you do anything only look at the initial challenge and the end result but please do not use the code as it usually is just horrible. There are a few good sites though, http://perl.com is an obvious location for very good articles about perl and its uses in real life. Another fun location is http://perlmonks.com where you can find people showing their solutions to real life problems or asking the community for help overcoming them, the site is often visited by some of the smartest people in the perl world so it certainly is a good place to ask questions and to try and answer those of others. I hope that helps a bit, just keep in mind coding perl is above all about having fun. Regards, Rob
Re: Out of Memory!
On Wed, Oct 13, 2010 at 8:42 AM, Panda-X exilepa...@gmail.com wrote: Hi List, My script is running on WinXP, Dos shell, which is a server program. It works fine, unless it will pops-up a Out of Memory! and stop running per each few days! Could someone tell me this error message is coming from Perl ? or from the Dos shell ? Thanks! ex Good question, most likely a program on your system is eating memory and not letting go. Over time you will run out of memory and you will get this message. The problem might be your script or well, anything else on your system that is running at the same time. Even though I do not doubt your programming skills I would suggest a simple test. Don't run your script for a few days and see if you get the same error. If so you are sure that it is not caused by your script, if you don't get the error then your script is the problem and you have some fun debugging to do. Normally perl is quite good in the cleaning up of unused resources memory or otherwise, but as a developer you can make it very hard for perl to keep the memory clean. You might be building an array, a hash or some other data element that never stops growing, or that you copy data from A to B to C and never really release any of them etc. Specially scripts that are supposed to run constantly will need you as a developer to pay special attention to keeping the memory foot print within reason... It might be a good idea to post the script to this list and ask people to help you out, often a mistake like this is not hard to spot and usually takes a few minor changes to help perl keep the memory footprint nice and small. I'm sure that there are debug options in perl that can help you with this as well I have never ended up using them as the few scripts that I did write that had to live forever didn't cause me any memory problems (a few other non-memory related once though) so I have no idea how to debug stuff like that with perl. Regards, Rob
Re: Out of Memory!
On Wed, Oct 13, 2010 at 10:41 AM, Panda-X exilepa...@gmail.com wrote:
2010/10/13 Rob Coops rco...@gmail.com
On Wed, Oct 13, 2010 at 8:42 AM, Panda-X exilepa...@gmail.com wrote:
Hi List,
My script is running on WinXP, Dos shell, which is a server program.
It works fine, unless it will pops-up a Out of Memory! and stop running
per each few days!
Could someone tell me this error message is coming from Perl ? or from
the
Dos shell ?
Thanks!
ex
Good question, most likely a program on your system is eating memory and
not letting go. Over time you will run out of memory and you will get this
message. The problem might be your script or well, anything else on your
system that is running at the same time.
Even though I do not doubt your programming skills I would suggest a
simple test. Don't run your script for a few days and see if you get the
same error. If so you are sure that it is not caused by your script, if you
don't get the error then your script is the problem and you have some fun
debugging to do.
Normally perl is quite good in the cleaning up of unused resources memory
or otherwise, but as a developer you can make it very hard for perl to keep
the memory clean. You might be building an array, a hash or some other data
element that never stops growing, or that you copy data from A to B to C and
never really release any of them etc. Specially scripts that are supposed to
run constantly will need you as a developer to pay special attention to
keeping the memory foot print within reason...
It might be a good idea to post the script to this list and ask people to
help you out, often a mistake like this is not hard to spot and usually
takes a few minor changes to help perl keep the memory footprint nice and
small.
I'm sure that there are debug options in perl that can help you with this
as well I have never ended up using them as the few scripts that I did write
that had to live forever didn't cause me any memory problems (a few other
non-memory related once though) so I have no idea how to debug stuff like
that with perl.
Regards,
Rob
Thank you very much!
The server script I am using is as a chat server, It carries message from
one user to another.
When the target user got their messages, the [array] will be deleted from
the HoH. ( see below )
I've turned on strict and warnings, as well $| = 1; everything besides
the struct below, and the daemon object, everything is my $localvars.
Overall to say, I have a heavy struct like this :
$MESG = {
usr1 = {
[$From, $to, $Time, $Context],
[$From, $to, $Time, $Context],
...
},
usr2 = {
[],
[],
...
}
}
In the script, I am using modules :
IO::Socket::INET::Daemon;
Devel::Size qw(total_size);
Then, I have this sub to check the struct ( an relative size )
sub DumpSize {
my $total_sz = 0 ;
foreach my $usr ( sort keys %$MESG ) {
my $size = 0 ;
print $usr: MESG= ;
print scalar ( @{$MESG-{$usr}} ) ;
print , LEN=;
foreach ( @{$MESG-{$usr}} ) {
$size += length $_ ;
$total_sz += length $_ ;
}print $size , TTZ=$total_sz , MEM=;
print total_size $MESG;
print TRF=;
print $COUNT;
print $/;
}
print $/ END $_[0] ;
print TimeStamp ( time ) ;
print ==$/$/;
}
This sub will turns out something like this :
END GET 2010/10/13 16:23:09 ==
usr1: MESG=2 , LEN=535 , TTZ=535 , MEM=1853 TRF=7223
usr2: MESG=1 , LEN=175 , TTZ=710 , MEM=1853 TRF=7223
usr3: MESG=2 , LEN=339 , TTZ=1049 , MEM=1853 TRF=7223
END GET 2010/10/13 16:23:27 ==
usr2: MESG=2 , LEN=535 , TTZ=535 , MEM=1275 TRF=7224
usr3: MESG=1 , LEN=175 , TTZ=710 , MEM=1275 TRF=7224
END GET 2010/10/13 16:24:43 ==
usr2: MESG=1 , LEN=171 , TTZ=171 , MEM=2200 TRF=7227
usr3: MESG=2 , LEN=535 , TTZ=706 , MEM=2200 TRF=7227
usr5: MESG=2 , LEN=346 , TTZ=1052 , MEM=2200 TRF=7227
usr6: MESG=1 , LEN=171 , TTZ=1223 , MEM=2200 TRF=7227
This sub will be called every time a user Send or Get a mesg.
MESG is how much messages in the inbox of the user
LEN is the Totel text length for the user,
TTZ is the total text length in server,
MEM is the $MESG struct size
TRF is how many rounds of Get / Send happened.
From my observation, the Out of Memory error could happen anytime, where
the MEM size was never over 10K.
Any clues ?
So let me get this right have one structure $MESG that stores all messages
for all users for as long as they have not fetched the messages... so if a
user sends 1 message your structure will contain one line with usr1 = { [ ]
} and if this same user sends another message $message will contain usr1 =
{ [ ], [ ] } and so on.
I assume that once a message is retrieved the message is removed from the
$MESG structure, if not that is an very
Re: Problem with foreach loop
On Mon, Sep 27, 2010 at 9:19 AM, HACKER Nora nora.hac...@stgkk.at wrote:
Hello list,
Could someone please explain why this test script:
my @arr1 = qw(one two three);
my @arr2 = qw(1 2 3);
foreach my $arr1 ( @arr1 ) {
print Arr1: $arr1\n;
foreach my $arr2 ( @arr2 ) {
print Arr2: $arr2\n;
if ( $arr2 eq '2' ) {
shift @arr1;
}
}
}
produces that result:
oracle:/opt/data/magna/wartung/work/nora ./test.pl
Arr1: one
Arr2: 1
Arr2: 2
Arr2: 3
Arr1: three
Arr2: 1
Arr2: 2
Arr2: 3
whereas I had expected the output to be like this:
oracle:/opt/data/magna/wartung/work/nora ./test.pl
Arr1: one
Arr2: 1
Arr2: 2
Arr2: 3
Arr1: two # why not?
Arr2: 1 # why not?
Arr2: 2 # why not?
Arr1: three
Arr2: 1
Arr2: 2
Arr2: 3
Thanks in advance!
Regards,
Nora
Ok, for starters your output is different from the above listed example. The
actual output is:
Arr1: one
Arr2: 1
Arr2: 2
Arr1: two
Arr2: 2
Arr1: three
Arr2: 3
Which makes a lot of sense, you after all start you loop printing Arr1[0]
then in that same loop you print Arr2[0] and Arr2[1] at which point you
shift Arr2; and leave the inner loop, now you are at the end of your main
loop so you print Arr[1] and again start a new inner loop printing Arr[0]
(which thanks to your shift now is equal to 2 and because this is the case
your if statement again shifts Arr2 and ends the inner loop, back in the
main loop there is nothing more to do so we start the loop again this time
printing Arr1[2] and we enter the inner loop printing Arr2[0] which now is
3 so the if statement never becomes true and we exit the inner loop, the
main loop has come to the end of the array as well so we exit that and the
code ends.
There is nothing weird about what is happening here. I think that you are
using a few different scripts to test different things and by now your
output and your actual script do not match which causes most of the
confusion.
I found the best way to actually get your head around the most complex loops
is to write/draw them out and get an actual picture of what is happening. If
you look at most modelling technique this is exactly what they do, it is the
best way for a humans brain to process what is going on. ;-)
Anyway to get the result you want you should simply pop your second array
when you encounter a 3 and in that case of course not print...
foreach my $arr1 ( @arr1 ) {
print Arr1: $arr1\n;
foreach my $arr2 ( @arr2 ) {
if ( $arr2 eq '3' ) {
pop @arr2;
} else {
print Arr2: $arr2\n;
}
}
}
That will result in:
Arr1: one
Arr2: 1
Arr2: 2
Arr1: two
Arr2: 1
Arr2: 2
Arr1: three
Arr2: 1
Arr2: 2
Regards,
Rob
Re: Can't call method get_value....
On Thu, Aug 5, 2010 at 9:52 AM, sync jian...@gmail.com wrote:
Hi, guys:
i have a perl script that supposed to add users to ldap . when i run the
script it get:
Can't call method get_value on an undefined value at ./add_user.pl
Any help will be appreciated?
The following message is my perl script message and my perl version is
5.8.8 on CentOS 5.4 x86_64.
t...@xxx ~: cat add_user.pl
--
#!/usr/bin/perl
use strict;
use Net::LDAP;
die Usage is adduser.pl [username] [realname]\n if length(@ARGV) != 1;
my $username = $ARGV[0];
my $realname = $ARGV[1];
my $ldap = Net::LDAP-new('localhost');
my $mesg = $ldap-bind;
my $mesg = $ldap-search(
base = ou=People,dc=example,dc=com,
filter = (uid=$username),
);
$mesg-code die $mesg-error;
my $searchResults = $mesg-count;
die Error! Username already exists! unless $searchResults == 0;
#print $searchResults;
$mesg = $ldap-search(
base = ou=People,dc=example,dc=com,
attrs = ['uidNumber'],
);
my @entries = $mesg-sorted('uidNumber');
my $entry = pop @entries;
my $newuid = $entry-get_value( 'uidNumber');
$newuid++;
my $result = $ldap-add (uid=$username,ou=People,dc=example,dc=com,
attr = [ 'cn' = $realname,
'uid' = $username,
'uidNumber' = $newuid,
'mail'= '$usern...@example.com',
'homeDirectory' = '/home/$username',
'objectclass' = ['person',
'inetOrgPerson', 'posixAccount']
]
);
$mesg = $ldap-unbind;
Ok, so the line that is causing this error is: my $newuid =
$entry-get_value( 'uidNumber');
Which is the only get_value call you make. This must mean that entry is
simply empty or at least doesn't contain what you expected it to contain.
What you are doing is first a search for anything with uidNumber in
the: ou=People,dc=example,dc=com
base. Rather then checking for error values or even verifying that anything
actually was returned you instantly call: my @entries =
$mesg-sorted('uidNumber');
For all we know @entries might be completely empty.
I would add some checking here and there, first check to see that there
where no error's after your search. Then make sure that at least some
results was returned. If this is the case then sort your search results and
then after all of that, take one entry and first of all dump it all to
STDOUT or to a log file (for debugging such a little bit of code STDOUT
should de just fine. If that looks like an entry that you expected to see
then try and call get_value and I can promise you that it will work just
fine.
Regards,
Rob
Re: add newline
On Tue, Aug 3, 2010 at 12:26 PM, Sharan Basappa sharan.basa...@gmail.comwrote:
In my program, I am building a text file f that also contains newlines
irst into an array.
I push every line to the array, but how do I add new lines to this text?
Regards,
Sharan
--
To unsubscribe, e-mail: beginners-unsubscr...@perl.org
For additional commands, e-mail: beginners-h...@perl.org
http://learn.perl.org/
Hi Sharan,
There are several options (it is perl after all :-)
First you could when you are adding a value to the array also add the
newline character:
push (@myarray, $value . \n);
Second you could of course add the line feeds as seperate array values:
push (@myarray, $value);
push (@myarray, \n);
Third you could of course when you are printing the values from the array
add the linefeeds:
print join(\n, @myarray);
or
foreach my $value ( @myarray ) {
print $value . \n;
or
print $value;
print \n;
}
There are a few more options but these are the most common once you will see
around the perl world. It really depends on what you want to do with you
array. If you only use the array to print the output I would advise using
the join option as that is certainly the most efficient memory wise and at
least feeling wise the fastest way of working (though I have not verified
this) the second option is just silly and likely quite slow and memory
inefficient.
If you are using the array as a form of log file you might want to have a
look at
log4perlhttp://search.cpan.org/~mschilli/Log-Log4perl-1.29/lib/Log/Log4perl.pmon
cpan. Which is a much more industrial strength solution then
reinventing
the wheel is likely to be.
Regards,
Rob
Re: Extract data from BEncoded .torrent files
On Sun, Jul 25, 2010 at 9:24 PM, NisargaYoga steven.harn...@gmail.comwrote: Hi - Total newbie and my first post so please tell me if I'm doing anything wrong. My first real Perl project - looking for some conceptual guidance. The project involves processing of BEncoded .torrent files downloaded from an rtorrent seedbox. Bottom line is I want to cycle through about 150 files in a directory and extract two data pieces from each file: the name of the torrent file and another statistic. The data could be saved in .csv files. Specifically the object is to extract on a weekly basis the number of bytes that the seedbox has uploaded for each torrent (about 150 active torrents), in order to detect torrents that have minimal activity, so they can be deleted later (manually). All work will be done on either my PC or my Linux box (not on the hosted seedbox server). In rtorrent, active torrents are stored at /var/www2/ rtorrent2/.rtsession/ I downloaded all active .torrent files to my desktop PC via FTP. I can see the contents of each torrent using BEncode Editor. Besides the normal .torrent information, a torrent taken from the .rtsession directory has an additional node for data specific to its status in the seedbox. I don't see a way to attaching a sample file, but I saved one in this directory: http://www.nisargayoga.org/hidden/ the file name is my- downloaded-active.torrent When opened with BEncode Editor (before the nodes are expanded) the bottom node is labeled rtorrent (d)[23] has it [23] elements, I don't know what the (d) means When this node is expanded, the second node from the bottom is total_uploaded (i) = 212151318 this is the statistic I need, plus the name, which is in an earlier node. The node with the name is info (d)[6] -- name (b)[77] So to recap, the project is to cycle through all BEncoded .torrent files in a directory, extract 2 pieces of data from each and write the output to a .csv file, one row per torrent, 2 data items per row. There must be a half-dozen ways to do this but you could help me by pointing me in the right direction. All suggestions welcome. Thanks very much. -- To unsubscribe, e-mail: beginners-unsubscr...@perl.org For additional commands, e-mail: beginners-h...@perl.org http://learn.perl.org/ Hi, I have never attempted to work with BEncoded files but a simple search on CPAN shows that other have (quite a few of them actually). I would advise you to have a look at their work and if at all possible reuse the modules they have made available for this type of work. After all it makes very little sense to reinvent the wheel doesn't it? So go to: http://search.cpan.org and look for BEncode. The first module I found looks very prommising: http://search.cpan.org/~aristotle/Bencode-1.4/lib/Bencode.pm it encodes and decodes files to and from Perl hashs by the look of it (just looked at the first example. I think that might just be what you are looking for. ;-) Rob
Re: hash arrays
On Mon, Jul 26, 2010 at 2:09 PM, Sharan Basappa sharan.basa...@gmail.comwrote:
Folks,
I am reusing a code for some enhancements. According to my
understanding, it is a record with
some unique string as key and then hash array as the value.
I iterate through the array and print as follows:
foreach my $key (keys %{$abc})
{
print $key ${$abc}{$key} \n;
}
I get values such like:
val_0001 HASH(0x186c0060)
val_0002 HASH(0x187ea490)
val_0003 HASH(0x18655bc0)
val_0004 HASH(0x1880fc60)
Can someone tell me how to get the actual value instead of HASH* as above?
Regards,
Sharan
--
To unsubscribe, e-mail: beginners-unsubscr...@perl.org
For additional commands, e-mail: beginners-h...@perl.org
http://learn.perl.org/
Hi Sharan,
When you do: print $key ${$abc}{$key} you get this output: val_0001
HASH(0x186c0060) so that basically means that the value associated with:
val_0001 is a hash.
So if we do something along the lines of:
foreach my $key (keys %{$abc})
{
my %hash = %{$abc}{$key};
foreach my $key2 ( keys %value ) {
print $key\t$key2\t$value{$key2}\n;
}
}
You should get something like this:
val_0001 key_0001 value_0001
val_0001 key_0002 value_0002
val_0001 key_0003 value_0003
val_0002 key_0001 value_0001
etc
Of course you should decide if this is really needed if you are only
interested in finding out what is inside $abc for debugging purposes for
instance you might just want to make your life easy and simply use
Data::Dumper to push content to the screen.
For all you know that HASH(0x186c0060) might contain a value that is it self
an array which contains a list of hashes with arrays as values etc... for
just seeing what is in there it is often better to simply use Data::Dumper
as it has been written to deal with all those possibilities so you don't
have to worry about them.
Regards,
Rob
Re: Calling Exit from within a subroutine
On Wed, Jul 21, 2010 at 5:00 AM, Babale Fongo bfo...@googlemail.com wrote:
I call several subroutines within my program. The program is design in a
way that I don't expect my subroutines to return to the caller but to exit
once they have executed.
At the moment I don't have exit or return at the end of my subroutines.
mysub(); # will the sub return here? If yes what happen if I don't capture
it and act?
.
...
reset of the code
sub mysub{
do this
don that
...
# I don't call exit or return
}
I understand a sub will normally implicitly return the last thing it
evaluation, but what happens if I don't act on what has been returned to
the
caller? Will be programme stall because it doesn't know what to do next or
will it exit?
Mimi
Hi Mimi,
You program will happily continue doing what you want it doens't care that
you don't deal with the return value.
So if you have code like this:
do some stuff;
do some more;
call_a_sub();
do some other stuff;
Your program will execute the first two lines, then do what ever the sub
call_a_sub() wants it to do and return to do some other stuff without you
having to worry about a return value. Keep in mind though that $_ has likely
be altered by you sub. ;-)
There always good reasons not to bother with return values but in most
cases I would still say it is a sign of sloppy programming.
For the simple reason that you expect a sub to do something what ever it is.
If this something fails you should, even if your code doesn't care about the
result, inform the end user of this fact... you would not be the first
programmer that writes a program that seems to totally at random do this one
thing or fail to do this without any apparent reason... a simple: Failed to
execute something message written to STDERR if nothing else is just one of
those things that makes the end users life a million times easier.
Rob
Re: Compare file/dir size
On Tue, Jul 20, 2010 at 1:51 PM, HACKER Nora nora.hac...@stgkk.at wrote:
Hi,
My aim is to compare two directories on different servers, whereas one
is the FTP'ed copy of the other, by checking whether both directories
are of exactly the same size. I tried to accomplish that with
Filesys::DiskUsage, but unfortunately the two dirs are always of
different size because the .. differs. Also, I couldn't find a way to
restrict the 'du' only to certain files In the dir (e.g. du $dir/*.Z),
obviously it works with dirs only...!?
Any hints appreciated :-)
Kind regards,
Nora
Hi Nora,
My solution to this would be to simply open the directory and read the files
then using the individual files (easy enough to filter on extensions or what
ever else you like) compare the file sizes.
Opening a directory is as simple as opening a file:
opendir( handle, dir name) or die $!;
while( defined ( my $file = readdir handle ) {
next unless $file =~ /^backup.*\.bak$/ # filter out all files that do not
start with backup and end in .bak
my $filesize = -s $file;
# Or if you are of the OO pursvation
use File::stat;
my $filesize = stat($file)-size;
}
Do the same with the other directory and compare the results (I would use a
hash for each directory with the filename as key and the size as value then
it is easy to compare the two and find all differences between the two
directories. ;-)
Regards,
Rob
Re: Perl stat script ... ???
On Mon, Jul 19, 2010 at 7:50 AM, newbie01 perl newbie01.p...@gmail.comwrote: Hi all, Does anyone know if someone had written a Perl stat script that mimics the Linux' stat command? I want to be able to use the stat command on Solaris, unfortunately, I just found out that that command is not available on Solaris and HP-UX so am thinking a Perl script should be the way to go then instead so I can have it on any UNIX's flavours. Any suggestion will be very much appreciated. Thanks in advance. I would say have a go at finding a module like this on cpan ( http://search.cpan.org) as I'm sure others have run into this problem before. I have worked with both Solaris and HP-UX for a combined total of nearly 10 years now and I have never really needed this. There are alternative HP-UX and Solaris commands that offer very similar functionality. I have to agree that stat is a nice solution but don't be tricked into the typical Windows user trap when they switch to *nix. You will have to learn to work with new tools and applications on the new platform this is just the way life works ;-) Also if you have install rights I'm quite sure that in a third party repository you will be able to find stat for HP-UX/Solaris as it is as I said before quite a handy tool.
