Bug#917700: dimbl: diff for NMU version 0.15-2.1
Control: tags 917700 + patch Control: tags 917700 + pending Dear maintainer, I've prepared an NMU for dimbl (versioned as 0.15-2.1) and uploaded it to DELAYED/14. Please feel free to tell me if I should cancel it. cu Adrian -- "Is there not promise of rain?" Ling Tan asked suddenly out of the darkness. There had been need of rain for many days. "Only a promise," Lao Er said. Pearl S. Buck - Dragon Seed diff -Nru dimbl-0.15/debian/changelog dimbl-0.15/debian/changelog --- dimbl-0.15/debian/changelog 2018-01-24 14:15:46.0 +0200 +++ dimbl-0.15/debian/changelog 2019-01-28 09:19:32.0 +0200 @@ -1,3 +1,10 @@ +dimbl (0.15-2.1) unstable; urgency=medium + + * Non-maintainer upload. + * Update the build dependencies. (Closes: #917700) + + -- Adrian Bunk Mon, 28 Jan 2019 09:19:32 +0200 + dimbl (0.15-2) unstable; urgency=medium * Team upload. diff -Nru dimbl-0.15/debian/control dimbl-0.15/debian/control --- dimbl-0.15/debian/control 2018-01-24 14:15:46.0 +0200 +++ dimbl-0.15/debian/control 2019-01-28 09:19:23.0 +0200 @@ -7,8 +7,8 @@ Build-Depends: debhelper (>= 11~), pkg-config, libxml2-dev, - libticcutils2-dev | libticcutils-dev, - libtimbl4-dev | libtimbl-dev + libticcutils-dev, + libtimbl-dev Standards-Version: 4.1.3 Vcs-Browser: https://salsa.debian.org/science-team/dimbl.git Vcs-Git: https://salsa.debian.org/science-team/dimbl.git
Processed: severity of 903751 is serious
Processing commands for cont...@bugs.debian.org: > severity 903751 serious Bug #903751 [src:basket] basket: please remove the extra libsoprano-dev build dependency Severity set to 'serious' from 'important' > thanks Stopping processing here. Please contact me if you need assistance. -- 903751: https://bugs.debian.org/cgi-bin/bugreport.cgi?bug=903751 Debian Bug Tracking System Contact ow...@bugs.debian.org with problems
Processed: dimbl: diff for NMU version 0.15-2.1
Processing control commands: > tags 917700 + patch Bug #917700 [src:dimbl] dimbl: FTBFS: build-dependency not installable: libtimbl4-dev Added tag(s) patch. > tags 917700 + pending Bug #917700 [src:dimbl] dimbl: FTBFS: build-dependency not installable: libtimbl4-dev Added tag(s) pending. -- 917700: https://bugs.debian.org/cgi-bin/bugreport.cgi?bug=917700 Debian Bug Tracking System Contact ow...@bugs.debian.org with problems
Bug#919058: My findings
Hmm, moving the files out of the original directory structure and trying from there works. This gets weirder and weirder.
Bug#919138: wpasupplicant: Fails to connect to some Wifi networks on version 2:2.7-3
Sure thing! Sadly doesn't seem to make a difference. I've included another log, this time starting from the time wpa_supplicant was brought back up to a little bit after I got the popup that the connection had failed. Thanks, Diff ‐‐‐ Original Message ‐‐‐ On Saturday, January 26, 2019 2:37 AM, Andrej Shadura wrote: > On Sun, 13 Jan 2019 at 04:18, Different55 differen...@protonmail.com wrote: > > > Package: wpasupplicant > > Version: 2:2.6-21 > > Severity: important > > Dear Maintainer, > > Running vanilla Debian Sid on my laptop here. Upgraded last night and when I > > woke up in the morning my Wifi had stopped working. It refused to connect > > to my > > home Wifi anymore, although my phone's hotspot still worked fine. > > Freshly reinstalled Debian Buster this evening, upgrade back to Sid and the > > Wifi failed shortly after the wpa_supplicant package was upgraded to version > > 2:2.7-3. Downgrading to wpasupplicant back to the version in Buster > > (2:2.6-21) > > returning things to a working state. > > I attached some relevant-looking bits from journalctl. > > Could you please test again with 2:2.7+git20190108+11ce7a1-2 from > experimental? Thanks! > > -- > > Cheers, > Andrej Jan 27 21:31:57 Empanada systemd[1]: Started WPA supplicant. Jan 27 21:31:57 Empanada wpa_supplicant[10450]: Successfully initialized wpa_supplicant Jan 27 21:31:57 Empanada NetworkManager[582]: [1548646317.3679] manager: NetworkManager state is now DISCONNECTED Jan 27 21:31:57 Empanada NetworkManager[582]: [1548646317.6609] sup-iface: failed to remove network: The name :1.742 was not provided by any .service files Jan 27 21:31:57 Empanada systemd[20774]: Stopping gnome-user-share WebDAV server... Jan 27 21:31:57 Empanada gsd-sharing[20946]: Failed to StopUnit service: GDBus.Error:org.freedesktop.systemd1.NoSuchUnit: Unit gnome-remote-desktop.service not loaded. Jan 27 21:31:57 Empanada dbus-daemon[570]: [system] Activating via systemd: service name='org.freedesktop.nm_dispatcher' unit='dbus-org.freedesktop.nm-dispatcher.service' requested by ':1.11' (uid=0 pid=582 comm="/usr/sbin/NetworkManager --no-daemon ") Jan 27 21:31:57 Empanada NetworkManager[582]: [1548646317.6901] supplicant: wpa_supplicant running Jan 27 21:31:57 Empanada NetworkManager[582]: [1548646317.6902] device (wls8): supplicant interface state: init -> starting Jan 27 21:31:57 Empanada systemd[1]: Starting Network Manager Script Dispatcher Service... Jan 27 21:31:57 Empanada systemd[20774]: Stopping Rygel DLNA/UPnP server... Jan 27 21:31:57 Empanada systemd[20774]: rygel.service: Succeeded. Jan 27 21:31:57 Empanada systemd[20774]: Stopped Rygel DLNA/UPnP server. Jan 27 21:31:58 Empanada dbus-daemon[570]: [system] Successfully activated service 'org.freedesktop.nm_dispatcher' Jan 27 21:31:58 Empanada systemd[1]: Started Network Manager Script Dispatcher Service. Jan 27 21:31:58 Empanada NetworkManager[582]: [1548646318.1466] sup-iface[0x55eefa7fecf0,wls8]: supports 5 scan SSIDs Jan 27 21:31:58 Empanada NetworkManager[582]: [1548646318.1489] device (wls8): supplicant interface state: starting -> ready Jan 27 21:31:58 Empanada NetworkManager[582]: [1548646318.1490] device (wls8): state change: unavailable -> disconnected (reason 'supplicant-available', sys-iface-state: 'managed') Jan 27 21:31:58 Empanada kernel: IPv6: ADDRCONF(NETDEV_UP): wls8: link is not ready Jan 27 21:31:58 Empanada dbus-daemon[570]: [system] Reloaded configuration Jan 27 21:31:58 Empanada nm-dispatcher[10462]: req:1 'down' [wls8]: new request (1 scripts) Jan 27 21:31:58 Empanada nm-dispatcher[10462]: req:1 'down' [wls8]: start running ordered scripts... Jan 27 21:31:58 Empanada nm-dispatcher[10462]: req:2 'connectivity-change': new request (1 scripts) Jan 27 21:31:58 Empanada systemd[20774]: gnome-user-share-webdav.service: Succeeded. Jan 27 21:31:58 Empanada systemd[20774]: Stopped gnome-user-share WebDAV server. Jan 27 21:31:59 Empanada nm-dispatcher[10462]: req:2 'connectivity-change': start running ordered scripts... Jan 27 21:32:01 Empanada wpa_supplicant[10450]: dbus: fill_dict_with_properties dbus_interface=fi.w1.wpa_supplicant1.BSS dbus_property=RSN getter failed Jan 27 21:32:01 Empanada wpa_supplicant[10450]: dbus: wpa_dbus_get_object_properties: failed to get object properties: (org.freedesktop.DBus.Error.Failed) failed to parse RSN IE Jan 27 21:32:01 Empanada wpa_supplicant[10450]: dbus: Failed to construct signal Jan 27 21:32:01 Empanada wpa_supplicant[10450]: dbus: fill_dict_with_properties dbus_interface=fi.w1.wpa_supplicant1.BSS dbus_property=RSN getter failed Jan 27 21:32:01 Empanada NetworkManager[582]: [1548646321.7146] policy: auto-activating connection 'Depeche Modem' (f5750ddc-91b1-4ec7-8ec8-bb7847056796) Jan 27 21:32:01 Empanada NetworkManager[582]: [1548646321.7158] device (wls8): Activation: starting connection 'Depeche Modem'
Bug#920597: marked as done (docker.io: Unable to start daemon: "containerd" executable file not found in PATH)
Your message dated Mon, 28 Jan 2019 03:20:43 + with message-id and subject line Bug#920597: fixed in docker.io 18.09.1+dfsg1-4 has caused the Debian Bug report #920597, regarding docker.io: Unable to start daemon: "containerd" executable file not found in PATH to be marked as done. This means that you claim that the problem has been dealt with. If this is not the case it is now your responsibility to reopen the Bug report if necessary, and/or fix the problem forthwith. (NB: If you are a system administrator and have no idea what this message is talking about, this may indicate a serious mail system misconfiguration somewhere. Please contact ow...@bugs.debian.org immediately.) -- 920597: https://bugs.debian.org/cgi-bin/bugreport.cgi?bug=920597 Debian Bug Tracking System Contact ow...@bugs.debian.org with problems --- Begin Message --- Package: docker.io Version: 18.09.1+dfsg1-2 Severity: serious X-Debbugs-CC: arnaud.rebill...@collabora.com Docker daemon is unable to start: Failed to start containerd: exec: "containerd": executable file not found in $PATH signature.asc Description: This is a digitally signed message part. --- End Message --- --- Begin Message --- Source: docker.io Source-Version: 18.09.1+dfsg1-4 We believe that the bug you reported is fixed in the latest version of docker.io, which is due to be installed in the Debian FTP archive. A summary of the changes between this version and the previous one is attached. Thank you for reporting the bug, which will now be closed. If you have further comments please address them to 920...@bugs.debian.org, and the maintainer will reopen the bug report if appropriate. Debian distribution maintenance software pp. Dmitry Smirnov (supplier of updated docker.io package) (This message was generated automatically at their request; if you believe that there is a problem with it please contact the archive administrators by mailing ftpmas...@ftp-master.debian.org) -BEGIN PGP SIGNED MESSAGE- Hash: SHA256 Format: 1.8 Date: Mon, 28 Jan 2019 10:16:28 +1100 Source: docker.io Binary: docker-doc docker.io docker.io-dbgsym golang-docker-dev golang-github-docker-docker-dev vim-syntax-docker Architecture: source all amd64 Version: 18.09.1+dfsg1-4 Distribution: unstable Urgency: medium Maintainer: Dmitry Smirnov Changed-By: Dmitry Smirnov Description: docker-doc - Linux container runtime -- documentation docker.io - Linux container runtime golang-docker-dev - Transitional package for golang-github-docker-docker-dev golang-github-docker-docker-dev - reusable Go packages included with Docker vim-syntax-docker - Docker container engine - Vim highlighting syntax files Closes: 920597 Changes: docker.io (18.09.1+dfsg1-4) unstable; urgency=medium . * Updated "containerd" executable name patch; renamed "containerd-shim" executable (Closes: #920597). Checksums-Sha1: 8a07c196d37ef4eb2a0bb3de718b9370aab45806 8933 docker.io_18.09.1+dfsg1-4.dsc 0583888c8cc1c2cc039067e2ce8063013265b9dc 40788 docker.io_18.09.1+dfsg1-4.debian.tar.xz b2ac09e69ba0350a69b3e42d39a8fae76f637743 974668 docker-doc_18.09.1+dfsg1-4_all.deb ae16e244d457d00fe4743542ea6941ec3690cb20 7012584 docker.io-dbgsym_18.09.1+dfsg1-4_amd64.deb aa732281def2092c8dc692f771d1c5b3151a36cb 25559 docker.io_18.09.1+dfsg1-4_amd64.buildinfo 358cc779624ef96b7e26facf867bb5b73e263233 53137976 docker.io_18.09.1+dfsg1-4_amd64.deb e19f34cc5ff67d6b205e12b7166b556bdced3d3d 20124 golang-docker-dev_18.09.1+dfsg1-4_all.deb 0fb9dd2d31629b4da69106a0c5b042ec2d0ef258 532584 golang-github-docker-docker-dev_18.09.1+dfsg1-4_all.deb a1b82a8670ca801d961ff80d37f49f5578bb6784 21292 vim-syntax-docker_18.09.1+dfsg1-4_all.deb Checksums-Sha256: e028aabcdff4b00fea95ed57da65966561d6c05c543713ddf5dfca75e55f3b99 8933 docker.io_18.09.1+dfsg1-4.dsc 30de40e854148ad70c507ea7696e32da09465fa776ee6816269ff08925e1a880 40788 docker.io_18.09.1+dfsg1-4.debian.tar.xz 4ddf75d5c66b1d1770ea2dbd8df520f0c777880ebf8f86b5c3e1694f192a15b1 974668 docker-doc_18.09.1+dfsg1-4_all.deb 889b70bc3755a9c30742cdc496f2086d7f0185313a7b1282f451f64857a422e4 7012584 docker.io-dbgsym_18.09.1+dfsg1-4_amd64.deb a831eecd67c4608839f92119f68da9f681430e6aa6d80740c8f66a6284d92725 25559 docker.io_18.09.1+dfsg1-4_amd64.buildinfo a55abb3b2343db054b593b44812dd72f648473c0768bc5de48ad5b5737d8dce8 53137976 docker.io_18.09.1+dfsg1-4_amd64.deb 01687e97044197abcdb30589cbd4fa3d59c913a7947760c54e2dda41f94f89c9 20124 golang-docker-dev_18.09.1+dfsg1-4_all.deb 147acca65656f7f25b00fa92212839f0fe75ae5f3a79855cf7d488be8406f1d6 532584 golang-github-docker-docker-dev_18.09.1+dfsg1-4_all.deb 005e9f05f5bc5a0bbf20e6afeb4e2ddb5e441a61a828478aacc95b1b753537c8 21292 vim-syntax-docker_18.09.1+dfsg1-4_all.deb Files: 658bd0028e1a4f9b92425f90cf1caecc 8933 admin optional docker.io_18.09.1+dfsg1-4.dsc 925a8d5bba407ecfeacaf85b5aea1ef3 40788 admin optional docker.io_18.09.1+dfsg1-4.debian.tar.xz 80b25c06b111421958ace24695c538f3 974668 doc
Bug#920597: Last docker.io update - not start
On Monday, 28 January 2019 2:26:00 AM AEDT Holger Schröder wrote: > sorry, is not solved. next problem. > > docker run -it -u0 --rm alpine:latest > docker: Error response from daemon: failed to start shim: exec: > "containerd-shim": executable file not found in $PATH: unknown. Apologies for troubles. I've fixed that in just uploaded 18.09.1+dfsg1-4. -- Regards, Dmitry Smirnov. --- Men can only be happy when they do not assume that the object of life is happiness. -- George Orwell signature.asc Description: This is a digitally signed message part.
Bug#919820: marked as done (mysql-connector-python: CVE-2019-2435)
Your message dated Mon, 28 Jan 2019 02:48:06 + with message-id and subject line Bug#919820: fixed in mysql-connector-python 8.0.14-1 has caused the Debian Bug report #919820, regarding mysql-connector-python: CVE-2019-2435 to be marked as done. This means that you claim that the problem has been dealt with. If this is not the case it is now your responsibility to reopen the Bug report if necessary, and/or fix the problem forthwith. (NB: If you are a system administrator and have no idea what this message is talking about, this may indicate a serious mail system misconfiguration somewhere. Please contact ow...@bugs.debian.org immediately.) -- 919820: https://bugs.debian.org/cgi-bin/bugreport.cgi?bug=919820 Debian Bug Tracking System Contact ow...@bugs.debian.org with problems --- Begin Message --- Source: mysql-connector-python Version: 8.0.11-1 Severity: grave Tags: security upstream Control: found -1 2.1.6-1 Hi, The following vulnerability was published for mysql-connector-python. CVE-2019-2435[0]: | Vulnerability in the MySQL Connectors component of Oracle MySQL | (subcomponent: Connector/Python). Supported versions that are affected | are 8.0.13 and prior and 2.1.8 and prior. Easily exploitable | vulnerability allows unauthenticated attacker with network access via | TLS to compromise MySQL Connectors. Successful attacks require human | interaction from a person other than the attacker. Successful attacks | of this vulnerability can result in unauthorized creation, deletion or | modification access to critical data or all MySQL Connectors | accessible data as well as unauthorized access to critical data or | complete access to all MySQL Connectors accessible data. CVSS 3.0 Base | Score 8.1 (Confidentiality and Integrity impacts). CVSS Vector: | (CVSS:3.0/AV:N/AC:L/PR:N/UI:R/S:U/C:H/I:H/A:N). If you fix the vulnerability please also make sure to include the CVE (Common Vulnerabilities & Exposures) id in your changelog entry. For further information see: [0] https://security-tracker.debian.org/tracker/CVE-2019-2435 https://cve.mitre.org/cgi-bin/cvename.cgi?name=CVE-2019-2435 [1] http://www.oracle.com/technetwork/security-advisory/cpujan2019-5072801.html#CVE-2019-2435 Please adjust the affected versions in the BTS as needed. Regards, Salvatore --- End Message --- --- Begin Message --- Source: mysql-connector-python Source-Version: 8.0.14-1 We believe that the bug you reported is fixed in the latest version of mysql-connector-python, which is due to be installed in the Debian FTP archive. A summary of the changes between this version and the previous one is attached. Thank you for reporting the bug, which will now be closed. If you have further comments please address them to 919...@bugs.debian.org, and the maintainer will reopen the bug report if appropriate. Debian distribution maintenance software pp. Sandro Tosi (supplier of updated mysql-connector-python package) (This message was generated automatically at their request; if you believe that there is a problem with it please contact the archive administrators by mailing ftpmas...@ftp-master.debian.org) -BEGIN PGP SIGNED MESSAGE- Hash: SHA256 Format: 1.8 Date: Sun, 27 Jan 2019 21:07:55 -0500 Source: mysql-connector-python Binary: python-mysql.connector python3-mysql.connector Architecture: source all Version: 8.0.14-1 Distribution: unstable Urgency: medium Maintainer: Sandro Tosi Changed-By: Sandro Tosi Description: python-mysql.connector - pure Python implementation of MySQL Client/Server protocol python3-mysql.connector - pure Python implementation of MySQL Client/Server protocol (Pytho Closes: 919820 Changes: mysql-connector-python (8.0.14-1) unstable; urgency=medium . [ Ondřej Nový ] * Convert git repository from git-dpm to gbp layout . [ Sandro Tosi ] * New upstream release, fix CVE-2019-2435; Closes: #919820 * debian/copyright - extend packaging copyright years - update upstream copyright years * debian/patches/support_alternative_mysqld_implementation.patch - refresh patch * debian/control - bump Standards-Version to 4.3.0 (no changes needed) Checksums-Sha1: bbe743d4875450c9f58fd77db2b6109fb24035a6 2347 mysql-connector-python_8.0.14-1.dsc cb8982fed0fd89c3f15e724f3059dd9e208073ab 12000443 mysql-connector-python_8.0.14.orig.tar.gz 7be2ff258ac2b9c7becf9b504724a06ec036fd82 5172 mysql-connector-python_8.0.14-1.debian.tar.xz c0851d2fb1d33a62746e13a754917403fbee67b2 9267 mysql-connector-python_8.0.14-1_amd64.buildinfo 2af93ab1dcad31e132c3b75a9269fe90a9063e27 167512 python-mysql.connector_8.0.14-1_all.deb 6e8245f136fc2cd04ac21d68d992cb3dda75b808 167660 python3-mysql.connector_8.0.14-1_all.deb Checksums-Sha256: 7516bb41696e491c4dd20114f4f755feb4aa7278654b891a1a74ffac4e5ed380 2347 mysql-connector-python_8.0.14-1.dsc ebe252ec11aa9b9c5cbeeecac760f1bc13308c8a4904782caa8a485fd01be8b1 12000443 mysql-connector-python_8.0.14.orig.tar.gz
Bug#917595: marked as done (umoci: FTBFS (cannot find package "github.com/fatih/color"))
Your message dated Mon, 28 Jan 2019 02:49:28 + with message-id and subject line Bug#917595: fixed in umoci 0.4.3+dfsg-1 has caused the Debian Bug report #917595, regarding umoci: FTBFS (cannot find package "github.com/fatih/color") to be marked as done. This means that you claim that the problem has been dealt with. If this is not the case it is now your responsibility to reopen the Bug report if necessary, and/or fix the problem forthwith. (NB: If you are a system administrator and have no idea what this message is talking about, this may indicate a serious mail system misconfiguration somewhere. Please contact ow...@bugs.debian.org immediately.) -- 917595: https://bugs.debian.org/cgi-bin/bugreport.cgi?bug=917595 Debian Bug Tracking System Contact ow...@bugs.debian.org with problems --- Begin Message --- Package: src:umoci Version: 0.4.0+dfsg-1 Severity: serious Tags: ftbfs Dear maintainer: I tried to build this package in buster but it failed: [...] debian/rules build-arch dh build-arch --buildsystem=golang --with=golang dh_update_autotools_config -a -O--buildsystem=golang dh_autoreconf -a -O--buildsystem=golang dh_auto_configure -a -O--buildsystem=golang debian/rules override_dh_auto_build make[1]: Entering directory '/<>/umoci-0.4.0+dfsg' COMMIT=1 COMMIT_NO=1 /usr/bin/make doc make[2]: Entering directory '/<>/umoci-0.4.0+dfsg' go-md2man -in doc/man/umoci-unpack.1.md -out doc/man/umoci-unpack.1 go-md2man -in doc/man/umoci-raw-runtime-config.1.md -out doc/man/umoci-raw-runtime-config.1 go-md2man -in doc/man/umoci-config.1.md -out doc/man/umoci-config.1 go-md2man -in doc/man/umoci-ls.1.md -out doc/man/umoci-ls.1 go-md2man -in doc/man/umoci-remove.1.md -out doc/man/umoci-remove.1 [... snipped ...] src/github.com/openSUSE/umoci/oci/config/generate/save.go src/github.com/openSUSE/umoci/oci/config/generate/spec.go src/github.com/openSUSE/umoci/oci/config/generate/spec_test.go src/github.com/openSUSE/umoci/oci/layer/generate.go src/github.com/openSUSE/umoci/oci/layer/generate_test.go src/github.com/openSUSE/umoci/oci/layer/tar_extract.go src/github.com/openSUSE/umoci/oci/layer/tar_extract_test.go src/github.com/openSUSE/umoci/oci/layer/tar_generate.go src/github.com/openSUSE/umoci/oci/layer/tar_generate_test.go src/github.com/openSUSE/umoci/oci/layer/tar_unix.go src/github.com/openSUSE/umoci/oci/layer/unpack.go src/github.com/openSUSE/umoci/oci/layer/unpack_test.go src/github.com/openSUSE/umoci/oci/layer/utils.go src/github.com/openSUSE/umoci/oci/layer/utils_test.go src/github.com/openSUSE/umoci/pkg/fseval/fseval.go src/github.com/openSUSE/umoci/pkg/fseval/fseval_default.go src/github.com/openSUSE/umoci/pkg/fseval/fseval_rootless.go src/github.com/openSUSE/umoci/pkg/idtools/idtools.go src/github.com/openSUSE/umoci/pkg/idtools/idtools_test.go src/github.com/openSUSE/umoci/pkg/mtreefilter/mask.go src/github.com/openSUSE/umoci/pkg/mtreefilter/mask_test.go src/github.com/openSUSE/umoci/pkg/rootlesscontainers-proto/rootlesscontainers_generate.go src/github.com/openSUSE/umoci/pkg/system/mknod_linux.go src/github.com/openSUSE/umoci/pkg/system/mknod_linux_test.go src/github.com/openSUSE/umoci/pkg/system/utime_linux.go src/github.com/openSUSE/umoci/pkg/system/utime_linux_test.go src/github.com/openSUSE/umoci/pkg/system/xattr_linux.go src/github.com/openSUSE/umoci/pkg/unpriv/unpriv.go src/github.com/openSUSE/umoci/pkg/unpriv/unpriv_test.go src/github.com/openSUSE/umoci/pkg/unpriv/unpriv_utimes_test.go src/github.com/openSUSE/umoci/third_party/shared/util.go src/github.com/openSUSE/umoci/third_party/user/lookup.go src/github.com/openSUSE/umoci/third_party/user/lookup_unix.go src/github.com/openSUSE/umoci/third_party/user/user.go src/github.com/openSUSE/umoci/third_party/user/user_test.go cd obj-x86_64-linux-gnu && go install -gcflags=all=\"-trimpath=/<>/umoci-0.4.0\+dfsg/obj-x86_64-linux-gnu/src\" -asmflags=all=\"-trimpath=/<>/umoci-0.4.0\+dfsg/obj-x86_64-linux-gnu/src\" -v -p 1 github.com/openSUSE/umoci/cmd/umoci github.com/openSUSE/umoci/mutate github.com/openSUSE/umoci/oci/cas github.com/openSUSE/umoci/oci/cas/dir github.com/openSUSE/umoci/oci/casext github.com/openSUSE/umoci/oci/config/convert github.com/openSUSE/umoci/oci/config/generate github.com/openSUSE/umoci/oci/layer github.com/openSUSE/umoci/pkg/fseval github.com/openSUSE/umoci/pkg/idtools github.com/openSUSE/umoci/pkg/mtreefilter github.com/openSUSE/umoci/pkg/rootlesscontainers-proto github.com/openSUSE/umoci/pkg/system github.com/openSUSE/umoci/pkg/unpriv github.com/openSUSE/umoci/third_party/shared github.com/openSUSE/umoci/third_party/user src/github.com/apex/log/handlers/cli/cli.go:12:2: cannot find package "github.com/fatih/color" in any of: /usr/lib/go-1.10/src/github.com/fatih/color (from $GOROOT) /<>/umoci-0.4.0+dfsg/obj-x86_64-linux-gnu/src/github.com/fatih/color (from $GOPATH)
Bug#919473: marked as done (zapping: Settings schema 'net.sf.Zapping.plugins.teletext' does not contain a key named 'method')
Your message dated Mon, 28 Jan 2019 02:49:50 + with message-id and subject line Bug#919473: fixed in zapping 0.10~cvs6-16 has caused the Debian Bug report #919473, regarding zapping: Settings schema 'net.sf.Zapping.plugins.teletext' does not contain a key named 'method' to be marked as done. This means that you claim that the problem has been dealt with. If this is not the case it is now your responsibility to reopen the Bug report if necessary, and/or fix the problem forthwith. (NB: If you are a system administrator and have no idea what this message is talking about, this may indicate a serious mail system misconfiguration somewhere. Please contact ow...@bugs.debian.org immediately.) -- 919473: https://bugs.debian.org/cgi-bin/bugreport.cgi?bug=919473 Debian Bug Tracking System Contact ow...@bugs.debian.org with problems --- Begin Message --- Package: zapping Version: 0.10~cvs6-15 Severity: grave zapping doesn't start: $ zapping (zapping:3191): dbind-WARNING **: 13:01:17.865: Error retrieving accessibility bus address: org.freedesktop.DBus.Error.ServiceUnknown: The name org.a11y.Bus was not provided by any .service files (zapping:3191): GLib-GIO-ERROR **: 13:01:18.527: Settings schema 'net.sf.Zapping.plugins.teletext' does not contain a key named 'method' Trace/breakpoint trap -- System Information: Architecture: i386 Versions of packages zapping depends on: ii dconf-gsettings-backend [gsettings-backend] 0.30.1-2 ii libc62.28-5 ii libcairo21.16.0-2 ii libgdk-pixbuf2.0-0 2.38.0+dfsg-7 ii libglib2.0-0 2.58.2-3 ii libgtk-3-0 3.24.3-1 ii libjpeg62-turbo 1:1.5.2-2+b1 ii liblirc-client0 0.10.1-5 ii libpango-1.0-0 1.42.4-6 ii libpangocairo-1.0-0 1.42.4-6 ii libpng16-16 1.6.36-3 ii libpython2.7 2.7.15-5 ii libx11-6 2:1.6.7-1 ii libxext6 2:1.3.3-1+b2 ii libxinerama1 2:1.1.4-1 ii libxml2 2.9.4+dfsg1-7+b3 ii libxmu6 2:1.1.2-2 ii libxv1 2:1.0.11-1 ii libxxf86dga1 2:1.1.4-1+b3 ii libxxf86vm1 1:1.1.4-1+b2 ii libzvbi0 0.2.35-15 Versions of packages zapping recommends: pn gconf2 -- Jakub Wilk --- End Message --- --- Begin Message --- Source: zapping Source-Version: 0.10~cvs6-16 We believe that the bug you reported is fixed in the latest version of zapping, which is due to be installed in the Debian FTP archive. A summary of the changes between this version and the previous one is attached. Thank you for reporting the bug, which will now be closed. If you have further comments please address them to 919...@bugs.debian.org, and the maintainer will reopen the bug report if appropriate. Debian distribution maintenance software pp. Yavor Doganov (supplier of updated zapping package) (This message was generated automatically at their request; if you believe that there is a problem with it please contact the archive administrators by mailing ftpmas...@ftp-master.debian.org) -BEGIN PGP SIGNED MESSAGE- Hash: SHA512 Format: 1.8 Date: Fri, 25 Jan 2019 16:53:10 +0200 Source: zapping Architecture: source Version: 0.10~cvs6-16 Distribution: unstable Urgency: medium Maintainer: Debian QA Group Changed-By: Yavor Doganov Closes: 919473 Changes: zapping (0.10~cvs6-16) unstable; urgency=medium . * QA upload. * debian/patches/24-GConf-to-GSettings.patch: Assign each GSettings instance to its own unique variable; otherwise things get really messy when plugins are loaded (Closes: #919473). * debian/patches/27-zsfb-manpage.patch: New; build and install zapping_setup_fb's manpage conditionally based on the same AM_CONDITIONAL that is used for the binary. * debian/patches/series: Update. * debian/rules: Pass --disable-v4l --disable-bktr on GNU/Hurd; remove hurd-specific CPPFLAGS. (override_dh_auto_install): Conditionally move zapping_setup_fb to /usr/bin as it's only built on GNU/Linux architectures. * debian/control (Build-Depends): Remove freebsd-glue; that was a really stupid idea that I should be ashamed of. And I am. (Depends): Add gsettings-desktop-schemas -- the code loads one schema from this package which will be a hard error if it is not installed. (Standards-Version): Bump to 4.3.0; no changes needed. * debian/copyright: Update copyright years, add Jeremy Bicha. Checksums-Sha1: 4790602f3b639c038a83b85a1cd9de55f84ae809 2157
Bug#920662: orthanc-mysql: uses $(DEB_VERSION) as SOVERSION
Package: orthanc-mysql Version: 1.1-1 Severity: serious User: debian...@lists.debian.org Usertags: piuparts Hi, $ lintian orthanc-mysql_1.1-1+b1_amd64.deb W: orthanc-mysql: package-name-doesnt-match-sonames libOrthancMySQLIndex1.1-1+b1 libOrthancMySQLStorage1.1-1+b1 E: orthanc-mysql: ldconfig-symlink-missing-for-shlib usr/lib/libOrthancMySQLIndex.so.1.1-1+b1 usr/lib/libOrthancMySQLIndex.so.1.1-1 libOrthancMySQLIndex.so.1.1-1+b1 E: orthanc-mysql: ldconfig-symlink-missing-for-shlib usr/lib/libOrthancMySQLStorage.so.1.1-1+b1 usr/lib/libOrthancMySQLStorage.so.1.1-1 libOrthancMySQLStorage.so.1.1-1+b1 This is also reproducible with 2.0-1. Using $(DEB_VERSION) in the SONAME of the library is, well, insane. Since the library has a strange naming that makes it nearly impossible to be used as a regular shared library (and it seems to used rather as a plugin loaded via the .so extension, no no version weirdness involved), the question arises "why is it in/usr/lib nevertheless?" Andreas
Bug#920547: Crashes every few hours
Control: tag -1 moreinfo On Sat, 26 Jan 2019 20:03:49 + Toni wrote: > Package: src:linux > Version: 4.19.16-1 > Severity: critical > File: linux-image-4.19.0-2-amd64 Is this a new problem with version 4.19.16-1? Or did it happen with earlier versions as well? > my laptop lasts a few hours at most until becoming unresponsive, hot, > and refuses to do normal things. Eg. trying to create this bug report > and using sudo to read the kernel logs after about one hour of total > uptime, with two suspend/resume cycles in between, made the system > crash. "Crash" means that, in such a situation, I can only press the > power button until the system is completely off, but after that, I am > forced to immediately turn the system back on, so that the fans can do > their work, because otherwise, the CPU overheats. Pressing > Ctrl-Alt-Delete has no effect. > > Justification for "grave": I've experienced data loss in such > situations, and of course, having the entire system going down, with > potential hardware damage (sans human intervention) is probably as bad > as it can be. When you say "data loss", are you talking about data in memory or corruption of files that were saved and sync'd to disk? On x86 laptops thermal management is (by default) done by the system firmware (BIOS and management engine code). If you didn't override that, and yet the CPU overheats, this is the manufacturer's fault. Ben. > I've attached the dmesg from boot and some kernel logs for your perusal, > cleansed from private data. -- Ben Hutchings We get into the habit of living before acquiring the habit of thinking. - Albert Camus signature.asc Description: This is a digitally signed message part
Processed: Re: Crashes every few hours
Processing control commands: > tag -1 moreinfo Bug #920547 [src:linux] Crashes every few hours Added tag(s) moreinfo. -- 920547: https://bugs.debian.org/cgi-bin/bugreport.cgi?bug=920547 Debian Bug Tracking System Contact ow...@bugs.debian.org with problems
Bug#919971: marked as done (node-rollup-pluginutils: autopkgtestsuite failure)
Your message dated Sun, 27 Jan 2019 22:53:50 +
with message-id
and subject line Bug#919971: fixed in node-rollup-pluginutils 2.3.3-4
has caused the Debian Bug report #919971,
regarding node-rollup-pluginutils: autopkgtestsuite failure
to be marked as done.
This means that you claim that the problem has been dealt with.
If this is not the case it is now your responsibility to reopen the
Bug report if necessary, and/or fix the problem forthwith.
(NB: If you are a system administrator and have no idea what this
message is talking about, this may indicate a serious mail system
misconfiguration somewhere. Please contact ow...@bugs.debian.org
immediately.)
--
919971: https://bugs.debian.org/cgi-bin/bugreport.cgi?bug=919971
Debian Bug Tracking System
Contact ow...@bugs.debian.org with problems
--- Begin Message ---
Package: node-rollup-pluginutils
Version: 2.3.3-2
Severity: serious
Tags: patch
Hello, looks like the latest upload fails its autopkgtestsuite, since
some days/weeks.
See e.g.:
https://ci.debian.net/data/autopkgtest/unstable/amd64/n/node-rollup-pluginutils/1618356/log.gz
(Reading database ... 22971 files and directories currently installed.)
Removing autopkgtest-satdep (0) ...
autopkgtest [07:49:14]: test upstreamtestsuite: [---
find test/ -name '*.js' -and -not -name 'createFilter.test.js' -exec mocha {} \;
internal/modules/cjs/loader.js:583
throw err;
^
Error: Cannot find module '..'
at Function.Module._resolveFilename (internal/modules/cjs/loader.js:581:15)
at Function.Module._load (internal/modules/cjs/loader.js:507:25)
at Module.require (internal/modules/cjs/loader.js:637:17)
at require (internal/modules/cjs/helpers.js:22:18)
at Object.
(/tmp/autopkgtest-lxc.nqmg3_9p/downtmp/build.9cL/src/test/addExtension.test.js:2:22)
at Module._compile (internal/modules/cjs/loader.js:689:30)
at Object.Module._extensions..js (internal/modules/cjs/loader.js:700:10)
at Module.load (internal/modules/cjs/loader.js:599:32)
at tryModuleLoad (internal/modules/cjs/loader.js:538:12)
at Function.Module._load (internal/modules/cjs/loader.js:530:3)
at Module.require (internal/modules/cjs/loader.js:637:17)
at require (internal/modules/cjs/helpers.js:22:18)
at /usr/lib/nodejs/mocha/lib/mocha.js:231:27
at Array.forEach ()
at Mocha.loadFiles (/usr/lib/nodejs/mocha/lib/mocha.js:228:14)
at Mocha.run (/usr/lib/nodejs/mocha/lib/mocha.js:536:10)
at Object. (/usr/lib/nodejs/mocha/bin/_mocha:573:18)
at Module._compile (internal/modules/cjs/loader.js:689:30)
at Object.Module._extensions..js (internal/modules/cjs/loader.js:700:10)
at Module.load (internal/modules/cjs/loader.js:599:32)
at tryModuleLoad (internal/modules/cjs/loader.js:538:12)
at Function.Module._load (internal/modules/cjs/loader.js:530:3)
at Function.Module.runMain (internal/modules/cjs/loader.js:742:12)
at startup (internal/bootstrap/node.js:283:19)
at bootstrapNodeJSCore (internal/bootstrap/node.js:743:3)
internal/modules/cjs/loader.js:583
throw err;
^
I'm not sure which is the best approach to fix this issue, but at least
this approach works:
--- node-rollup-pluginutils-2.3.3/debian/tests/upstreamtestsuite 2018-12-31
02:23:05.0 +0100
+++ node-rollup-pluginutils-2.3.3/debian/tests/upstreamtestsuite 2019-01-20
22:46:52.0 +0100
@@ -1,2 +1,7 @@
#!/bin/sh
-make -f debian/rules test_package
+sed -i test/dataToEsm.test.js -e "s/( '..' )/('rollup-pluginutils')/g"
+sed -i test/attachScopes.test.js -e "s/( '..' )/('rollup-pluginutils')/g"
+sed -i test/addExtension.test.js -e "s/( '..' )/('rollup-pluginutils')/g"
+sed -i test/makeLegalIdentifier.test.js -e "s/( '..'
)/('rollup-pluginutils')/g"
+sed -i test/createFilter.test.js -e "s/( '..' )/('rollup-pluginutils')/g"
+make -f debian/rules test_package
This is something that basically reverts commit
b33024e405af90183a6e6a65ab3163f177932e5e
Thanks for having a look,
Gianfranco
--- End Message ---
--- Begin Message ---
Source: node-rollup-pluginutils
Source-Version: 2.3.3-4
We believe that the bug you reported is fixed in the latest version of
node-rollup-pluginutils, which is due to be installed in the Debian FTP archive.
A summary of the changes between this version and the previous one is
attached.
Thank you for reporting the bug, which will now be closed. If you
have further comments please address them to 919...@bugs.debian.org,
and the maintainer will reopen the bug report if appropriate.
Debian distribution maintenance software
pp.
Julien Puydt (supplier of updated node-rollup-pluginutils
package)
(This message was generated automatically at their request; if you
believe that there is a problem with it please contact the archive
administrators by mailing ftpmas...@ftp-master.debian.org)
-BEGIN PGP SIGNED MESSAGE-
Hash: SHA512
Format: 1.8
Date: Sun, 27 Jan 2019 19:41:28 +0100
Source: node-rollup-pluginutils
Binary:
Bug#919058: My findings
Hi, Repeating what I posted on bug 920408: I've posted this on the mate-utils issue you linked to: It doesn't have to use multicore. Going to the gsearchtool/help/pt directory and repeatedly saying itstool -m pt.mo ../C/index.docbook ../C/legal.xml will eventually cause an exception in itstool. So then the question becomes, what is this? an error in the input data (that shouldn't cause a crash of course), in itstool, in libxml2 or what? I've also opened an itstool issue on GitHub, containing my most recent findings: https://github.com/itstool/itstool/issues/36 /Lars
Bug#920337: python3-igraph: ships header in /usr/include/python3.7
Hello.
The attached patch works around this bug in python-igraph.
The issue should probably be fixed globally by adding 'm'
in package python3-stdlib-extensions
in filedebian/patches/3.7/distutils-install-layout.diff
in line'headers': '$base/include/python$py_version_short/$dist_name'
but I am not an expert in Python packaging, so I would like your
opinion before opening a bug against
python3-stdlib-extensions.
Ideally, the bug number would be added to a comment in debian/rules so
that we know when the work-around can be removed.
--- a/debian/compat
+++ /dev/null
@@ -1,1 +0,0 @@
-11
--- a/debian/control
+++ b/debian/control
@@ -4,7 +4,7 @@
Maintainer: Debian Python Modules Team
Uploaders: TANIGUCHI Takaki ,
Hugo Lefeuvre
-Build-Depends: debhelper (>= 11),
+Build-Depends: debhelper-compat (= 12),
dh-python,
libigraph-dev,
pkg-config,
@@ -17,6 +17,7 @@ Build-Depends: debhelper (>= 11),
python3-setuptools,
python3-texttable
Standards-Version: 4.3.0
+Rules-Requires-Root: no
Testsuite: autopkgtest-pkg-python
Homepage: http://igraph.org/python/
Vcs-Git: https://salsa.debian.org/python-team/modules/python-igraph.git
--- a/debian/rules
+++ b/debian/rules
@@ -3,11 +3,19 @@
export DEB_BUILD_MAINT_OPTIONS = hardening=+all
export PYBUILD_NAME=igraph
+# Work around #920337. The proper fix probably adds 'm'
+# in package python3-stdlib-extensions
+# in filedebian/patches/3.7/distutils-install-layout.diff
+# in line'headers': '$base/include/python$py_version_short/$dist_name'
+export PYBUILD_INSTALL_ARGS_python3 := \
+ --install-headers=/usr/include/python{version}m
+
%:
# Ensure that the embedded copy is never used.
rm -f vendor/texttable.py
dh $@ --with python2,python3 --buildsystem=pybuild
+# Disable the scripts= option in setup.cfg. See #664443.
override_dh_auto_install:
dh_auto_install
rm -f $(CURDIR)/debian/python-igraph/usr/bin/igraph
--- a/debian/watch
+++ b/debian/watch
@@ -1,3 +1,2 @@
-version=3
-https://pypi.debian.net/python-igraph/python-igraph-(.*)\.tar\.gz
-
+version=4
+https://pypi.debian.net/@PACKAGE@/@PACKAGE@@ANY_VERSION@@ARCHIVE_EXT@
Processed: Bug #920018 in systemd marked as pending
Processing control commands: > tag -1 pending Bug #920018 [systemd] Memory Leak in journald? Failed to write entry (23 items, 500 bytes), ignoring: Cannot allocate memory Added tag(s) pending. -- 920018: https://bugs.debian.org/cgi-bin/bugreport.cgi?bug=920018 Debian Bug Tracking System Contact ow...@bugs.debian.org with problems
Bug#919390: Bug #919390 in systemd marked as pending
Control: tag -1 pending Hello, Bug #919390 in systemd reported by you has been fixed in the Git repository and is awaiting an upload. You can see the commit message below and you can check the diff of the fix at: https://salsa.debian.org/systemd-team/systemd/commit/40df7df1f6c4812fa7b074c5d48dcfce6ce8a782 Backport upstream patch reverting interface renaming changes. Closes: #919390 (this message was generated automatically) -- Greetings https://bugs.debian.org/919390
Bug#920018: Bug #920018 in systemd marked as pending
Control: tag -1 pending Hello, Bug #920018 in systemd reported by you has been fixed in the Git repository and is awaiting an upload. You can see the commit message below and you can check the diff of the fix at: https://salsa.debian.org/systemd-team/systemd/commit/59be1833846225c29a5241fdc63e02ac9fa60a84 process-util: Fix memory leak Closes: #920018 (this message was generated automatically) -- Greetings https://bugs.debian.org/920018
Processed: Bug #919390 in systemd marked as pending
Processing control commands: > tag -1 pending Bug #919390 [udev] udev: network interface gets ID_NET_NAME even when NAME has been set by /etc/udev/rules.d/70-persistent-net.rules Ignoring request to alter tags of bug #919390 to the same tags previously set -- 919390: https://bugs.debian.org/cgi-bin/bugreport.cgi?bug=919390 Debian Bug Tracking System Contact ow...@bugs.debian.org with problems
Bug#920629: Bug#920629: volumecontrol.app: Cannot quit, blocks under some circumstances
Gürkan Myczko wrote: > Hi Yavor many thanks would you mind doing a pr for that on github? I don't have a GitHub account and don't plan to make one at least until it is possible to do it off the web, with one of the cli tools that are available. I can send you the modified .gorm file in private if you want, or a patch produced with "git format-patch" that you can apply directly with "git am".
Bug#920606: marked as done (transifex-client: Depends: python3-six (= 1.11.0) but 1.12.0-1 is to be installed)
Your message dated Sun, 27 Jan 2019 21:35:18 + with message-id and subject line Bug#920606: fixed in transifex-client 0.13.5-2 has caused the Debian Bug report #920606, regarding transifex-client: Depends: python3-six (= 1.11.0) but 1.12.0-1 is to be installed to be marked as done. This means that you claim that the problem has been dealt with. If this is not the case it is now your responsibility to reopen the Bug report if necessary, and/or fix the problem forthwith. (NB: If you are a system administrator and have no idea what this message is talking about, this may indicate a serious mail system misconfiguration somewhere. Please contact ow...@bugs.debian.org immediately.) -- 920606: https://bugs.debian.org/cgi-bin/bugreport.cgi?bug=920606 Debian Bug Tracking System Contact ow...@bugs.debian.org with problems --- Begin Message --- Package: transifex-client Version: 0.13.5-1 Severity: serious The following packages have unmet dependencies: transifex-client : Depends: python3-six (= 1.11.0) but 1.12.0-1 is to be installed --- End Message --- --- Begin Message --- Source: transifex-client Source-Version: 0.13.5-2 We believe that the bug you reported is fixed in the latest version of transifex-client, which is due to be installed in the Debian FTP archive. A summary of the changes between this version and the previous one is attached. Thank you for reporting the bug, which will now be closed. If you have further comments please address them to 920...@bugs.debian.org, and the maintainer will reopen the bug report if appropriate. Debian distribution maintenance software pp. Hans-Christoph Steiner (supplier of updated transifex-client package) (This message was generated automatically at their request; if you believe that there is a problem with it please contact the archive administrators by mailing ftpmas...@ftp-master.debian.org) -BEGIN PGP SIGNED MESSAGE- Hash: SHA256 Format: 1.8 Date: Sun, 27 Jan 2019 20:58:59 + Source: transifex-client Binary: transifex-client Architecture: source all Version: 0.13.5-2 Distribution: unstable Urgency: medium Maintainer: Debian Python Modules Team Changed-By: Hans-Christoph Steiner Description: transifex-client - Command line interface for Transifex Closes: 920606 Changes: transifex-client (0.13.5-2) unstable; urgency=medium . [ Ondřej Nový ] * Convert git repository from git-dpm to gbp layout . [ Hans-Christoph Steiner ] * Standards-Version: 4.3.0: remove get-orig-source * add autopkgtest smoke test * patch to allow using Debian's python3-six version (Closes: #920606) Checksums-Sha1: 1a769da8440c9f270cfff250dd3def4b13537464 1857 transifex-client_0.13.5-2.dsc d89dd4466309b369f2fd692866dccb1c9fcc52df 4832 transifex-client_0.13.5-2.debian.tar.xz 9c7ca9ee4d2049dd5ceab4e5b8dde9499220b107 166820 transifex-client_0.13.5-2_all.deb 925891969091d90171b97e4a10b426b9637db314 6515 transifex-client_0.13.5-2_amd64.buildinfo Checksums-Sha256: faeb06ae9d795228e48f9ff1e2acaa0ad096b830bf1cdc0b87db76ecf8157c7d 1857 transifex-client_0.13.5-2.dsc 4d0d8704a4e509498ad30c8d86906347b90eb30c5572305e19a078292ae000ae 4832 transifex-client_0.13.5-2.debian.tar.xz b1c4d6ce36b45f86cbb591c11b4fce542b5550e2a56f07cb3a1d361a10332b99 166820 transifex-client_0.13.5-2_all.deb b7413f43a0cb83ab37596c53e77a799db2dee97bfdb54fc944c591e0a22e964a 6515 transifex-client_0.13.5-2_amd64.buildinfo Files: afd4ffdf7808d23a1f4295e0b35db077 1857 devel optional transifex-client_0.13.5-2.dsc 8985c33d1349047609adba31543fc9c1 4832 devel optional transifex-client_0.13.5-2.debian.tar.xz 7b5a848d85daf4baaf87e49479f1c350 166820 devel optional transifex-client_0.13.5-2_all.deb 998a40e613772cc23f5d40e49e0dda4e 6515 devel optional transifex-client_0.13.5-2_amd64.buildinfo -BEGIN PGP SIGNATURE- Version: GnuPG v1 Comment: GPG for Android - https://guardianproject.info/code/gnupg/ iQEcBAEBCAAGBQJcTh12AAoJED4XeBe6G5v6PLcH/iN55NIv6jpCdCQ8YKpk261x UCMBt0jz74nxUUUHB1Yw5xmYlPPLEe6q9ka9unwbnPOQlTi+25UV2P4PoWoDsMnx 68fgY51m3Z1vypkffxbR8i9+d48LH/XW83o0m0/R4ewQjNq1jyT9Hiwf3NpY17nD IoLQ9fQZPNQwzWTx5vN0G31rPv/q9Y99cQVbBYYRr1rxooxGlgtg5RZbSQaDeNIZ kJhVMND7uL0FmvTYAFntyhiirtHIu6hf7Apd+G1CtDXS4K+s/MjlC6vZ0xsfhAdW 2WQjk82OefONtsq/J+eWXVbrLL+HnSAaiTYw8a4KUCzN6JJGiXcDdFZEF7c9s1g= =sGAq -END PGP SIGNATURE End Message ---
Bug#901952: can affect packaged with old source tarballs
Hans-Christoph Steiner writes: > this also goes the other way, where tarballs created in tar 1.30 fail to > work in pristine-tar when tar 1.29 is installed: Unfortunately, the nature of pristine-tar is such that it's somewhat brittle in the face of upstream changes to tar. I don't think it's unreasonable to expect someone working on a package to have a version of tar installed that's at least as new as the one used to create the package. And as long as we have the work-around of temporarily installing an older version of tar to recover source packages created with older archives, none of this should rise to the level of release criticality for the tar package itself in my mind. Having said that, I just forwarded this bug upstream and hope we'll get some useful advice. Bdale signature.asc Description: PGP signature
Bug#901952: marked as forwarded (xdelta: expected from file (/tmp/pristine-tar.SljdkfANnj/recreatetarball) of length 7557120 bytes)
Your message dated Mon, 28 Jan 2019 10:05:17 +1300 with message-id <87fttdke0i@gag.com> has caused the report #901952, regarding xdelta: expected from file (/tmp/pristine-tar.SljdkfANnj/recreatetarball) of length 7557120 bytes to be marked as having been forwarded to the upstream software author(s) bug-...@gnu.org (NB: If you are a system administrator and have no idea what this message is talking about, this may indicate a serious mail system misconfiguration somewhere. Please contact ow...@bugs.debian.org immediately.) -- 901952: https://bugs.debian.org/cgi-bin/bugreport.cgi?bug=901952 Debian Bug Tracking System Contact ow...@bugs.debian.org with problems --- Begin Message --- Hi. A couple Debian users have reported issues using our packaging of tar 1.30 to unpack source packages made with 1.29 and prior stored in git repos using pristine-tar, due to an unfortunate side-effect of http://git.savannah.gnu.org/cgit/tar.git/commit/?id=dee7e3f16e74e07504bb8f4d80426005fe4364ae My thanks to Eric Prestemon for figuring out which commit was at fault, and for his diagnosis and thoughts documented at http://tech.prestemon.com/debugging/2018/08/09/debian-bug-901952.html Is it expected / correct that --unquote and --verbatim-files-from no longer work together? I'm trying to figure out the least obnoxious patch that would enable recovery of pristine-tar archives created with 1.29 and older using 1.30. If this was an unexpected side-effect and there's already an upstream commit I can pull and/or you're willing to suggest a suitable patch, that'd be awesome. Independently, I'd be pleased to have your opinions on Eric's suggestion that pristine-tar switch to using --null in the future (which I don't have control over but could make suggestions to the maintainer about). Regards, Bdale signature.asc Description: PGP signature --- End Message ---
Bug#920648: ntopng: missing libssl-dev dependency
Package: ntopng User: ubuntu-de...@lists.ubuntu.com Usertags: origin-ubuntu disco ubuntu-patch Version: 3.8+dfsg1-2 Severity: serious Tags: patch Hello, I'm filing this bug as serious, even if the build failure is not experienced in Debian builds, just by luck. Problem is that the embedded mongoose library, directly uses ssl features, but the package lacks of a libssl-dev dependency For some luck, mariadb-default pulls libssl-dev and this is why you are not experiencing the build failure, but this is a bug since mariadb might drop that dependency in the future, or people might have a default, different sql implementation on their system. Trivial patch: diff -Nru ntopng-3.8+dfsg1/debian/changelog ntopng-3.8+dfsg1/debian/changelog --- ntopng-3.8+dfsg1/debian/changelog 2019-01-26 08:36:22.0 + +++ ntopng-3.8+dfsg1/debian/changelog 2019-01-27 19:36:30.0 + @@ -1,3 +1,9 @@ +ntopng (3.8+dfsg1-2ubuntu1) disco; urgency=medium + + * Build depend on libssl-dev too, used in the build process (Closes: #-1) + + -- Gianfranco Costamagna Sun, 27 Jan 2019 20:36:30 +0100 + ntopng (3.8+dfsg1-2) unstable; urgency=medium * Fix missing space in postinst migration script (Closes: #920281). diff -Nru ntopng-3.8+dfsg1/debian/control ntopng-3.8+dfsg1/debian/control --- ntopng-3.8+dfsg1/debian/control 2019-01-22 01:55:35.0 + +++ ntopng-3.8+dfsg1/debian/control 2019-01-27 19:36:28.0 + @@ -20,6 +20,7 @@ libpcap-dev, librrd-dev, libsqlite3-dev, + libssl-dev, libzmq3-dev, node-source-map, node-uglify, Example of build failure: https://launchpadlibrarian.net/408670618/buildlog_ubuntu-disco-amd64.ntopng_3.8+dfsg1-2_BUILDING.txt.gz g++ -g -Wall -I/<>/ntopng-3.8+dfsg1 -I/<>/ntopng-3.8+dfsg1/include -I/usr/local/include -D_FILE_OFFSET_BITS=64 -I/usr/include/hiredis -I/usr/include/hiredis -I/<>/ntopng-3.8+dfsg1/third-party/mongoose -I/usr/include/json-c -I/usr/include/ndpi -I/usr/include/lua5.3 -I/usr/include/mysql -Wdate-time -D_FORTIFY_SOURCE=2 -I/<>/ntopng-3.8+dfsg1 -I/<>/ntopng-3.8+dfsg1/include -I/usr/local/include -I/<>/ntopng-3.8+dfsg1/third-party/http-client-c/src/ -I/usr/include/openssl -DDATA_DIR='"/usr/share"' -I/<>/ntopng-3.8+dfsg1/third-party/libgeohash -I/<>/ntopng-3.8+dfsg1/third-party/patricia -g -O2 -fdebug-prefix-map=/<>/ntopng-3.8+dfsg1=. -fstack-protector-strong -Wformat -Werror=format-security -c src/HTTPserver.cpp -o src/HTTPserver.o In file included from src/HTTPserver.cpp:25: src/../third-party/mongoose/mongoose.c:362:10: fatal error: openssl/ssl.h: No such file or directory #include ^~~ compilation terminated. make[2]: *** [Makefile:145: src/HTTPserver.o] Error 1 make[2]: Leaving directory '/<>/ntopng-3.8+dfsg1' dh_auto_build: make -j1 returned exit code 2 make[1]: *** [debian/rules:21: override_dh_auto_build] Error 2 make[1]: Leaving directory '/<>/ntopng-3.8+dfsg1' make: *** [debian/rules:11: build] Error 2 dpkg-buildpackage: error: debian/rules build subprocess returned exit status 2 thanks for caring, Gianfranco
Bug#901952: can affect packaged with old source tarballs
this also goes the other way, where tarballs created in tar 1.30 fail to work in pristine-tar when tar 1.29 is installed: https://salsa.debian.org/python-team/modules/libcloud/-/jobs/115815
Bug#919390: Bug #919390 in systemd marked as pending
Hi Martin, On Sun, Jan 27, 2019, 17:37 Martin Pitt Hello Felipe, > > Felipe Sateler [2019-01-26 0:04 +]: > > Bug #919390 in systemd reported by you has been fixed in the > > Git repository and is awaiting an upload. You can see the commit > > message below and you can check the diff of the fix at: > > > > > https://salsa.debian.org/systemd-team/systemd/commit/ca9bf5fdd69e1f6bb137d905f90225de7fc057e4 > > > > > > Pick patch proposed upstream to reduce journald memory usage > > > > Closes: #919390 > > This should have been #920018. I was about to do the cherry-picks, but I'm > really confused here. Where *did* your two commits land? They are clearly > not > on master, and there are no other (recent) branches. Even trying to show > the > SHA directly doesn't work (no such object). > > Did you force-unpush them? Or was this an unnamed branch somehow? Should I > pick > them from the salsa web UI and push them to master (and fixing the bug > number > while I'm at it), and upload? > I picked the patches, but before I uploaded I had to leave. I also accidentally pushed those picks to the wrong branch (adding salsa CI integration), and then unpushed them. I am not on my pc now so if you can upload the fixes that would be cool. Sorry about the confusion. We should probably restrict the notification hook to themaster branch. Saludos, Felipe Sateler
Bug#920018: Please give this bug attention.
Hello Nye, Nye Liu [2019-01-23 14:16 -0800]: > Please apply https://github.com/systemd/systemd/pull/11527 It's in the pipeline now, I need to sort out some git paperwork issue with Felipe. But either way, I'll upload the fix tomorrow. (Sorry, just back from meeting/devconf.cz week with essentially ignoring all email) Martin
Processed: bug 920476 is forwarded to https://github.com/mumble-voip/mumble/issues/3585, tagging 920476
Processing commands for cont...@bugs.debian.org:
> forwarded 920476 https://github.com/mumble-voip/mumble/issues/3585
Bug #920476 {Done: Christopher Knadle } [mumble]
security issue: DoS due to changing # of allowed users in root channel
Set Bug forwarded-to-address to
'https://github.com/mumble-voip/mumble/issues/3585'.
> tags 920476 + upstream
Bug #920476 {Done: Christopher Knadle } [mumble]
security issue: DoS due to changing # of allowed users in root channel
Added tag(s) upstream.
> thanks
Stopping processing here.
Please contact me if you need assistance.
--
920476: https://bugs.debian.org/cgi-bin/bugreport.cgi?bug=920476
Debian Bug Tracking System
Contact ow...@bugs.debian.org with problems
Bug#866436: marked as done (keysync: depends on obsolete python-imaging (replace with python3-pil or python-pil))
Your message dated Sun, 27 Jan 2019 20:43:32 + with message-id and subject line Bug#866436: fixed in keysync 0.2.2-2 has caused the Debian Bug report #866436, regarding keysync: depends on obsolete python-imaging (replace with python3-pil or python-pil) to be marked as done. This means that you claim that the problem has been dealt with. If this is not the case it is now your responsibility to reopen the Bug report if necessary, and/or fix the problem forthwith. (NB: If you are a system administrator and have no idea what this message is talking about, this may indicate a serious mail system misconfiguration somewhere. Please contact ow...@bugs.debian.org immediately.) -- 866436: https://bugs.debian.org/cgi-bin/bugreport.cgi?bug=866436 Debian Bug Tracking System Contact ow...@bugs.debian.org with problems --- Begin Message --- Package: src:keysync Version: 0.2.2-1 Severity: important Tags: sid buster User: d...@debian.org Usertags: imaging-pillow One or more binary packages built from this source depends on or recommends python-imaging, which is obsolete for some years now. Please build the source using the python-pil package. If your package doesn't need to be built with Python2, please consider using Python3 and depend on python3-pil. Planning to remove python-imaging for the buster release, so the severity of this issues might be raised. --- End Message --- --- Begin Message --- Source: keysync Source-Version: 0.2.2-2 We believe that the bug you reported is fixed in the latest version of keysync, which is due to be installed in the Debian FTP archive. A summary of the changes between this version and the previous one is attached. Thank you for reporting the bug, which will now be closed. If you have further comments please address them to 866...@bugs.debian.org, and the maintainer will reopen the bug report if appropriate. Debian distribution maintenance software pp. Hans-Christoph Steiner (supplier of updated keysync package) (This message was generated automatically at their request; if you believe that there is a problem with it please contact the archive administrators by mailing ftpmas...@ftp-master.debian.org) -BEGIN PGP SIGNED MESSAGE- Hash: SHA256 Format: 1.8 Date: Sun, 27 Jan 2019 19:34:52 + Source: keysync Binary: keysync Architecture: source all Version: 0.2.2-2 Distribution: unstable Urgency: medium Maintainer: Hans-Christoph Steiner Changed-By: Hans-Christoph Steiner Description: keysync- Syncs OTR identities between the different chat programs Closes: 820370 866436 Changes: keysync (0.2.2-2) unstable; urgency=medium . * Standards-Version: 4.3.0 no changes * switch imaging to pil (Closes: #866436) * switch to Section: utils (Closes: #820370) * W: dh_python2:479: Please add dh-python package to Build-Depends * update Vcs tags to point to salsa.debian.org Checksums-Sha1: f80451d391e862ede59170fb324469748c0359c9 1689 keysync_0.2.2-2.dsc 02b15af519b367ec3a5c0bd1d4b3cfa0fc0b6501 112532 keysync_0.2.2-2.debian.tar.xz 6098912088895833d83d94f918ebff435e304614 789640 keysync_0.2.2-2_all.deb 793accfb647acb7366383de0edac0f9104c0e9a6 6321 keysync_0.2.2-2_amd64.buildinfo Checksums-Sha256: 590d0f2991a95d8b440ecb2a705b318fb69b848069d67e5a733c613341333e7f 1689 keysync_0.2.2-2.dsc a20238ed66362a17f6964f1e0a27233d14644492d2c2791deec9524cfc1f093c 112532 keysync_0.2.2-2.debian.tar.xz 70e9df69c7f0966111b6cf19e44f915a119aad9f3d75721c7874c5efa76cecda 789640 keysync_0.2.2-2_all.deb e6cae4ee78d2a25564b0e16fa861e49173a327a84825da056bf251856d7af9ad 6321 keysync_0.2.2-2_amd64.buildinfo Files: f61979cfb67bf973a01dafbd4304b3ad 1689 utils optional keysync_0.2.2-2.dsc 30963d7431f42f10118996661fce6c25 112532 utils optional keysync_0.2.2-2.debian.tar.xz 88ae0bafd2f2eed93da42c50b5a85500 789640 utils optional keysync_0.2.2-2_all.deb d207dbca6b1c2e6d2362fdb999339e65 6321 utils optional keysync_0.2.2-2_amd64.buildinfo -BEGIN PGP SIGNATURE- Version: GnuPG v1 Comment: GPG for Android - https://guardianproject.info/code/gnupg/ iQEcBAEBCAAGBQJcTg75AAoJED4XeBe6G5v6aMUH/jATUxkDSdh4k3nfkaR+u/Wc gMm/dGnb3yT0bXS/EHtBf1zSNx7VtiCHZbpCyZQ5CyW1DigPDrimFr03ymnDGaV9 87mvtJSss0CmFqnsGMsoDn8xzxeca46Y8qYDhdC4g7zARrserBFgxwrWR4ykLb0q jhPCFyANCeOLc4wSru/BTxJEnnhLzSE7tDUkS2g9+Q/dYD1SXXx8qCa0AHSN8zfL OegLAwmLYjrgp3ReUdgx3vOkv++AzEcK4FsMngBHk8G7eK4K6V1JTadp2+qZSCVi WtPI1cscik48PQrbCY/gRy+nm3B5hymux/Qu23UgELYcqoA27NkGirKAt5dE2fc= =x0C2 -END PGP SIGNATURE End Message ---
Bug#919390: Bug #919390 in systemd marked as pending
Hello Felipe, Felipe Sateler [2019-01-26 0:04 +]: > Bug #919390 in systemd reported by you has been fixed in the > Git repository and is awaiting an upload. You can see the commit > message below and you can check the diff of the fix at: > > https://salsa.debian.org/systemd-team/systemd/commit/ca9bf5fdd69e1f6bb137d905f90225de7fc057e4 > > > Pick patch proposed upstream to reduce journald memory usage > > Closes: #919390 This should have been #920018. I was about to do the cherry-picks, but I'm really confused here. Where *did* your two commits land? They are clearly not on master, and there are no other (recent) branches. Even trying to show the SHA directly doesn't work (no such object). Did you force-unpush them? Or was this an unnamed branch somehow? Should I pick them from the salsa web UI and push them to master (and fixing the bug number while I'm at it), and upload? Thanks! Martin
Bug#920547: 4.19.16-1 Crashes every few hours
Hi Toni. I have an XPS 15 9570, which, I think, is basically the same machine, except yours uses an NVIDIA Quadro vs my GeForce GTX 1050Ti as a 2nd graphics card. A lot of problems with that secondary graphics card and linux. Are you attempting to use it via Bumblebee? See this thread (and links within the thread) - BIOS related: https://bugzilla.redhat.com/show_bug.cgi?id=1610727 I did my best to disable the NVIDIA card: https://wiki.archlinux.org/index.php/Dell_XPS_15_9570 One of my more recent "important" gnome-logs file is: 03:16:35 kernel: ath10k_pci :3b:00.0: firmware: failed to load ath10k/cal-pci-:3b:00.0.bin (-2) 03:16:35 kernel: firmware_class: See https://wiki.debian.org/Firmware for information about missing firmware 03:16:35 kernel: ath10k_pci :3b:00.0: firmware: failed to load ath10k/pre-cal-pci-:3b:00.0.bin (-2) 03:16:34 kernel: iTCO_wdt iTCO_wdt: can't request region for resource [mem 0x00c5fffc-0x00c5] 03:16:34 kernel: ACPI Error: Skip parsing opcode OpcodeName unavailable (20180531/psloop-542) 03:16:34 kernel: ACPI Error: Skip parsing opcode OpcodeName unavailable (20180531/psloop-542) 03:16:34 kernel: ACPI Error: AE_ALREADY_EXISTS, During name lookup/catalog (20180531/psobject-221) 03:16:34 kernel: ACPI BIOS Error (bug): Failure creating [\_SB.PCI0.XHC.RHUB.SS10._PLD], AE_ALREADY_EXISTS (20180531/dswload2-316) 03:16:34 kernel: ACPI Error: Skip parsing opcode OpcodeName unavailable (20180531/psloop-542) 03:16:34 kernel: ACPI Error: AE_ALREADY_EXISTS, During name lookup/catalog (20180531/psobject-221) 03:16:34 kernel: ACPI BIOS Error (bug): Failure creating [\_SB.PCI0.XHC.RHUB.SS10._UPC], AE_ALREADY_EXISTS (20180531/dswload2-316) 03:16:34 kernel: ACPI Error: Skip parsing opcode OpcodeName unavailable (20180531/psloop-542) 03:16:34 kernel: ACPI Error: AE_ALREADY_EXISTS, During name lookup/catalog (20180531/psobject-221) 03:16:34 kernel: ACPI BIOS Error (bug): Failure creating [\_SB.PCI0.XHC.RHUB.SS09._PLD], AE_ALREADY_EXISTS (20180531/dswload2-316) 03:16:34 kernel: ACPI Error: Skip parsing opcode OpcodeName unavailable (20180531/psloop-542) 03:16:34 kernel: ACPI Error: AE_ALREADY_EXISTS, During name lookup/catalog (20180531/psobject-221) 03:16:34 kernel: ACPI BIOS Error (bug): Failure creating [\_SB.PCI0.XHC.RHUB.SS09._UPC], AE_ALREADY_EXISTS (20180531/dswload2-316) 03:16:34 kernel: ACPI Error: Skip parsing opcode OpcodeName unavailable (20180531/psloop-542) 03:16:34 kernel: ACPI Error: AE_ALREADY_EXISTS, During name lookup/catalog (20180531/psobject-221) 03:16:34 kernel: ACPI BIOS Error (bug): Failure creating [\_SB.PCI0.XHC.RHUB.SS08._PLD], AE_ALREADY_EXISTS (20180531/dswload2-316) 03:16:34 kernel: ACPI Error: Skip parsing opcode OpcodeName unavailable (20180531/psloop-542) 03:16:34 kernel: ACPI Error: AE_ALREADY_EXISTS, During name lookup/catalog (20180531/psobject-221) 03:16:34 kernel: ACPI BIOS Error (bug): Failure creating [\_SB.PCI0.XHC.RHUB.SS08._UPC], AE_ALREADY_EXISTS (20180531/dswload2-316) 03:16:34 kernel: ACPI Error: Skip parsing opcode OpcodeName unavailable (20180531/psloop-542) 03:16:34 kernel: ACPI Error: AE_ALREADY_EXISTS, During name lookup/catalog (20180531/psobject-221) 03:16:34 kernel: ACPI BIOS Error (bug): Failure creating [\_SB.PCI0.XHC.RHUB.SS07._PLD], AE_ALREADY_EXISTS (20180531/dswload2-316) 03:16:34 kernel: ACPI Error: Skip parsing opcode OpcodeName unavailable (20180531/psloop-542) 03:16:34 kernel: ACPI Error: AE_ALREADY_EXISTS, During name lookup/catalog (20180531/psobject-221) 03:16:34 kernel: ACPI BIOS Error (bug): Failure creating [\_SB.PCI0.XHC.RHUB.SS07._UPC], AE_ALREADY_EXISTS (20180531/dswload2-316) 03:16:34 kernel: ACPI Error: Skip parsing opcode OpcodeName unavailable (20180531/psloop-542) 03:16:34 kernel: ACPI Error: AE_ALREADY_EXISTS, During name lookup/catalog (20180531/psobject-221) 03:16:34 kernel: ACPI BIOS Error (bug): Failure creating [\_SB.PCI0.XHC.RHUB.SS06._PLD], AE_ALREADY_EXISTS (20180531/dswload2-316) 03:16:34 kernel: ACPI Error: Skip parsing opcode OpcodeName unavailable (20180531/psloop-542) 03:16:34 kernel: ACPI Error: AE_ALREADY_EXISTS, During name lookup/catalog (20180531/psobject-221) 03:16:34 kernel: ACPI BIOS Error (bug): Failure creating [\_SB.PCI0.XHC.RHUB.SS06._UPC], AE_ALREADY_EXISTS (20180531/dswload2-316) 03:16:34 kernel: ACPI Error: Skip parsing opcode OpcodeName unavailable (20180531/psloop-542) 03:16:34 kernel: ACPI Error: AE_ALREADY_EXISTS, During name lookup/catalog (20180531/psobject-221) 03:16:34 kernel: ACPI BIOS Error (bug): Failure creating [\_SB.PCI0.XHC.RHUB.SS05._PLD], AE_ALREADY_EXISTS (20180531/dswload2-316) 03:16:34 kernel: ACPI Error: Skip parsing opcode OpcodeName unavailable (20180531/psloop-542) 03:16:34 kernel: ACPI Error: AE_ALREADY_EXISTS, During name lookup/catalog (20180531/psobject-221) 03:16:34 kernel: ACPI BIOS Error (bug): Failure creating [\_SB.PCI0.XHC.RHUB.SS05._UPC], AE_ALREADY_EXISTS (20180531/dswload2-316) 03:16:34 kernel: ACPI Error: Skip parsing opcode
Bug#920645: libgd2: CVE-2019-6977
Source: libgd2 Version: 2.2.5-5 Severity: grave Tags: security upstream Justification: user security hole Control: found -1 2.2.4-2+deb9u3 Control: found -1 2.2.4-2 Hi, The following vulnerability was published for libgd2. CVE-2019-6977[0]: | gdImageColorMatch in gd_color_match.c in the GD Graphics Library (aka | LibGD) 2.2.5, as used in the imagecolormatch function in PHP before | 5.6.40, 7.x before 7.1.26, 7.2.x before 7.2.14, and 7.3.x before 7.3.1, | has a heap-based buffer overflow. This can be exploited by an attacker | who is able to trigger imagecolormatch calls with crafted image data. If you fix the vulnerability please also make sure to include the CVE (Common Vulnerabilities & Exposures) id in your changelog entry. For further information see: [0] https://security-tracker.debian.org/tracker/CVE-2019-6977 https://cve.mitre.org/cgi-bin/cvename.cgi?name=CVE-2019-6977 [1] https://bugs.php.net/bug.php?id=77270 [2] https://gist.github.com/cmb69/1f36d285eb297ed326f5c821d7aafced Regards, Salvatore
Processed: libgd2: CVE-2019-6977
Processing control commands: > found -1 2.2.4-2+deb9u3 Bug #920645 [src:libgd2] libgd2: CVE-2019-6977 Marked as found in versions libgd2/2.2.4-2+deb9u3. > found -1 2.2.4-2 Bug #920645 [src:libgd2] libgd2: CVE-2019-6977 Marked as found in versions libgd2/2.2.4-2. -- 920645: https://bugs.debian.org/cgi-bin/bugreport.cgi?bug=920645 Debian Bug Tracking System Contact ow...@bugs.debian.org with problems
Processed: Re: Bug#883948: apparmor: xdg-user-dirs should have localized directory names
Processing control commands: > severity -1 minor Bug #883948 [apparmor] apparmor: xdg-user-dirs should have localized directory names Severity set to 'minor' from 'wishlist' > tag -1 + upstream Bug #883948 [apparmor] apparmor: xdg-user-dirs should have localized directory names Added tag(s) upstream. > forcemerge -1 918548 Bug #883948 [apparmor] apparmor: xdg-user-dirs should have localized directory names Bug #918548 [apparmor] About possibility to translate AppArmor tunables Severity set to 'minor' from 'serious' Marked as found in versions apparmor/2.11.1-4. Added tag(s) upstream. Bug #883948 [apparmor] apparmor: xdg-user-dirs should have localized directory names Marked as found in versions apparmor/2.13.2-3. Merged 883948 918548 -- 883948: https://bugs.debian.org/cgi-bin/bugreport.cgi?bug=883948 918548: https://bugs.debian.org/cgi-bin/bugreport.cgi?bug=918548 Debian Bug Tracking System Contact ow...@bugs.debian.org with problems
Bug#901952: can affect packaged with old source tarballs
I think this bug does qualify as RC since it can affect any source tarball that was created with an older version of tar. So it is not just that it comes from a different distro/release than buster, but it could be from a package that has a source tarball that hasn't changed since tar 1.30.
Bug#920548: marked as done (golang-1.12: CVE-2019-6486)
Your message dated Sun, 27 Jan 2019 19:50:07 + with message-id and subject line Bug#920548: fixed in golang-1.12 1.12~beta2-2 has caused the Debian Bug report #920548, regarding golang-1.12: CVE-2019-6486 to be marked as done. This means that you claim that the problem has been dealt with. If this is not the case it is now your responsibility to reopen the Bug report if necessary, and/or fix the problem forthwith. (NB: If you are a system administrator and have no idea what this message is talking about, this may indicate a serious mail system misconfiguration somewhere. Please contact ow...@bugs.debian.org immediately.) -- 920548: https://bugs.debian.org/cgi-bin/bugreport.cgi?bug=920548 Debian Bug Tracking System Contact ow...@bugs.debian.org with problems --- Begin Message --- Source: golang-1.12 Version: 1.12~beta2-1 Severity: grave Tags: security upstream Forwarded: https://github.com/golang/go/issues/29903 Hi, The following vulnerability was published for golang-1.12, which was already fixed for the released version 1.11.5 and 1.10.8 upstream. CVE-2019-6486[0]: | Go before 1.10.8 and 1.11.x before 1.11.5 mishandles P-521 and P-384 | elliptic curves, which allows attackers to cause a denial of service | (CPU consumption) or possibly conduct ECDH private key recovery | attacks. If you fix the vulnerability please also make sure to include the CVE (Common Vulnerabilities & Exposures) id in your changelog entry. For further information see: [0] https://security-tracker.debian.org/tracker/CVE-2019-6486 https://cve.mitre.org/cgi-bin/cvename.cgi?name=CVE-2019-6486 [1] https://github.com/golang/go/issues/29903 Regards, Salvatore --- End Message --- --- Begin Message --- Source: golang-1.12 Source-Version: 1.12~beta2-2 We believe that the bug you reported is fixed in the latest version of golang-1.12, which is due to be installed in the Debian FTP archive. A summary of the changes between this version and the previous one is attached. Thank you for reporting the bug, which will now be closed. If you have further comments please address them to 920...@bugs.debian.org, and the maintainer will reopen the bug report if appropriate. Debian distribution maintenance software pp. Dr. Tobias Quathamer (supplier of updated golang-1.12 package) (This message was generated automatically at their request; if you believe that there is a problem with it please contact the archive administrators by mailing ftpmas...@ftp-master.debian.org) -BEGIN PGP SIGNED MESSAGE- Hash: SHA256 Format: 1.8 Date: Sun, 27 Jan 2019 20:05:59 +0100 Source: golang-1.12 Architecture: source Version: 1.12~beta2-2 Distribution: unstable Urgency: medium Maintainer: Go Compiler Team Changed-By: Dr. Tobias Quathamer Closes: 920548 Changes: golang-1.12 (1.12~beta2-2) unstable; urgency=medium . * Refresh patch Reproducible BUILD_PATH_PREFIX_MAP. Thanks to Michael Stapelberg! * Add patch to fix CVE-2019-6486. (Closes: #920548) Checksums-Sha1: f7ee221e2c5ec216f82d516952d957e35d39fab5 2611 golang-1.12_1.12~beta2-2.dsc a08edb3d89002aee229007948d44d0e6328393bc 29832 golang-1.12_1.12~beta2-2.debian.tar.xz 9c570ec90b9b0338264a3a8dbc59640fd63f3afa 6494 golang-1.12_1.12~beta2-2_amd64.buildinfo Checksums-Sha256: ac07dfcf8611b0380c2d3b9f5428cfc57bd02f872415de9cd9935ce021d09315 2611 golang-1.12_1.12~beta2-2.dsc c8ff699bb540de782998690fe794d1d7ea2134b863030e8ff53634286ba70144 29832 golang-1.12_1.12~beta2-2.debian.tar.xz 233e7c738452f6ae5f935c4e8cb10eba83a50b63877f93236ed513601467518a 6494 golang-1.12_1.12~beta2-2_amd64.buildinfo Files: f2cf4915830e4b3db407a07fb88efeb4 2611 devel optional golang-1.12_1.12~beta2-2.dsc 07efc8e8120b611aa4eeb01b73b2ec6c 29832 devel optional golang-1.12_1.12~beta2-2.debian.tar.xz 2a696920cec8a351f096d043781dfa26 6494 devel optional golang-1.12_1.12~beta2-2_amd64.buildinfo -BEGIN PGP SIGNATURE- iQIzBAEBCAAdFiEE0cuPObxd7STF0seMEwLx8Dbr6xkFAlxOBk4ACgkQEwLx8Dbr 6xmzJBAAk+2ihr0j4Hq7aHFxM6Lqm+YHnqo+omz+DtETvvl3BEBs4cmF87F5eElU woUCAvvsW4XsEHxpVqbgrNSDBAZJXhO0dXoqmmGcEqKR1fjYLwBbUPkKOZeBx8Xd tbuAfIqNowXiwzo+eFYxLmz92cOUMbQU2MFncoiEQokWFMEA2JVatRpZ+CUSVZSL biDgkWRdQoUjInKVsaFnXKtlvhNLIWSkYASxA7hJwtYoH+PV6ksdNwrUuMJw8+SD zEfRuWuPmSXJKnJORIXz+T5iKsBVVAZR3g2rkydiVdaUyjRmxoitv9R1ueEF872P /CcrfiNBlNr7DSTj0L7Lh5hGlH3LOnaG7rYq2MTeV3QzCxI4/upicRaqO51lU+4X POts9Bn9VLhHVES9LKb4t0IVLC4reATnz23NE+mniLSdK5/nmP+QiIkZCUQSf9w5 BNPiFgaTcXasiNEx54r4IO8rcsZrV6uo+5o9gbkLhds9aHdzKnSKwDrZT5Z2rO+w lGnramVvPttKvSAfNDKIxwbYlq4WbT9fUJ/tnAeq/JgL18/wLmUkYOZroGEslzxZ UYTD4G/MInIOP1mSduv3iYwzTVcdP/09woThcmQzlUiZvnyF4hzoHK5JJOa5aCND 0aoGb+wpgeUcacNuuKg7aYBHSxiWgK4pCumxt+E88dvEI8rTPHM= =58OR -END PGP SIGNATURE End Message ---
Bug#918548: [pkg-apparmor] Bug#918548: Bug#918548: About possibility to translate AppArmor tunables
Hi,
(Meta: here I'm wearing my "maintainer triaging a newly filed RC bug"
hat; once this is done, if the resulting severity is high enough, I'll
spend some time thinking about solutions.)
Jamie Strandboge:
> I don't have all the context since the bug only has part of the thread, but I
> can say two things:
FTR the thread started there:
https://lists.debian.org/msgid-search/0ff6099c-f34c-927d-ad08-6e308091d...@gmail.com
> On Mon, 07 Jan 2019, Ian Jackson wrote:
>> To the AppArmor maintainers:
>>
>> I have filed this as `serious' not to try to force you to fix this,
>> but because this bug seems like it will cause AppArmor to work badly
>> for many people and I felt you would want me to be sure
>> you noticed.
ACK, thank you Ian!
>> So please adjust the severity as you like.
Will do while merging with #883948.
>> I hope everyone finds my intervention helpful.
It's definitely been helpful to bump this on my radar.
In passing: Vincas is part of the AppArmor team in Debian and an
upstream AppArmor committer. So I would hope he feels legitimate to
raise issues within the AppArmor upstream and Debian teams. Now,
seniority and other factors definitely create power imbalances, so I'm
glad to see other people weighing in, sharing their views, and
supporting Vincas' request in a perhaps slightly more pressing manner
than he would dare to :)
> As for the seriousness of the bug, I'll let the Debian apparmor devs decide
> but
> will say that this issue has been known for many years in Ubuntu where
> apparmor
> is on by default and the current upstream mechanisms have proved 'ok enough'.
I concur: if the resulting UX is good enough for Ubuntu and for
openSUSE, given neither of them have a clever solution to this
problem¹, then I suspect it'll be good enough for Debian users
as well.
> I'll speculate and say this probably has something to do with the fact that
> the
> @{XDG_*_DIR} variables aren't widely used in system-shipped policy and what is
> left is sysadmin created policy and if the sysadmin is writing the policy, the
> man page is likely consulted.
Debian Code Search suggests² that these variables are indeed only used
in files shipped by src:apparmor, namely: the user-download and
user-write abstractions, which are themselves used³ in:
- src:qutebrowser, where it's an example profile shipped in the
upstream source, but not installed by the Debian binary packages.
- usr.bin.pidgin, shipped by apparmor-profiles-extra (i.e.
using Pidgin is not enough to have it: one must consciously opt-in
for this additional policy); I guess this is about sending and
receiving files, for those chat protocols that support it; this
profile has been as-is since the first upload, 4.5 years ago, and
AFAIK nobody complained.
- a few "extra" profiles shipped by the apparmor-profiles package,
which is also opt-in; that package labels these profiles as
experimental and does not enable them by default.
If I got my codesearch query wrong, I'll be happy to stand corrected.
Last data point: no practical consequence of this (very real) issue
has been reported to the BTS since AppArmor was enabled by default in
testing/sid, 14 months ago. The only person who mentioned it was
Vincas, i.e. an experienced AppArmor policy developer, who has dived
deep enough into the policy to notice the problem.
⇒ This problem should affect no Debian user but those who consciously
opt in for stricter AppArmor policy than the default one; and even for
those who do opt in, the impact is pretty limited in scope and
severity. I think this problem currently affects AppArmor policy
developers more than users.
[1] https://bugs.debian.org/883948#20 and https://bugs.debian.org/883948#25
[2] https://codesearch.debian.net/search?q=%40%7BXDG_
[3]
https://codesearch.debian.net/search?q=abstractions%2Fuser-%28download%7Cwrite%29
Cheers,
--
intrigeri
Processed: Bug #920548 in golang marked as pending
Processing control commands: > tag -1 pending Bug #920548 [src:golang-1.12] golang-1.12: CVE-2019-6486 Added tag(s) pending. -- 920548: https://bugs.debian.org/cgi-bin/bugreport.cgi?bug=920548 Debian Bug Tracking System Contact ow...@bugs.debian.org with problems
Bug#920548: Bug #920548 in golang marked as pending
Control: tag -1 pending Hello, Bug #920548 in golang reported by you has been fixed in the Git repository and is awaiting an upload. You can see the commit message below and you can check the diff of the fix at: https://salsa.debian.org/go-team/compiler/golang/commit/24d42f6edede7b7cced1d1ced96b8e11b977e380 Add patch to fix CVE-2019-6486. Closes: #920548 (this message was generated automatically) -- Greetings https://bugs.debian.org/920548
Bug#919971: Bug #919971 in node-rollup-pluginutils marked as pending
Control: tag -1 pending Hello, Bug #919971 in node-rollup-pluginutils reported by you has been fixed in the Git repository and is awaiting an upload. You can see the commit message below and you can check the diff of the fix at: https://salsa.debian.org/js-team/node-rollup-pluginutils/commit/92334dee1bb37d15ea7471e61d0f41b73396ad5e Fix autopkgtest following Gianfranco Costamagna (Closes: #919971) (this message was generated automatically) -- Greetings https://bugs.debian.org/919971
Processed: Bug #919971 in node-rollup-pluginutils marked as pending
Processing control commands: > tag -1 pending Bug #919971 [node-rollup-pluginutils] node-rollup-pluginutils: autopkgtestsuite failure Added tag(s) pending. -- 919971: https://bugs.debian.org/cgi-bin/bugreport.cgi?bug=919971 Debian Bug Tracking System Contact ow...@bugs.debian.org with problems
Bug#917686: lightproof: FTBFS: warning [/<>/lightproof_ru_RU-0.3.4.oxt]: zipfile is empty
Hi, On Sun, Jan 27, 2019 at 09:12:58PM +0200, Adrian Bunk wrote: > > Jup, replacing python3 with python3.6 makes this work > > For some reason the problem seems to be 32bit-only now: > https://tests.reproducible-builds.org/debian/rb-pkg/unstable/amd64/lightproof.html Not really. Still fails in a simple apt-get -b source lightproof in sid/amd64. Regards, Rene
Bug#920639: solfege: Does not start
Package: solfege
Version: 3.23.4-4
Severity: grave
Justification: renders package unusable
Dear mantainer,
trying to run solfege I get this error:
leandro@tricheco:~$ solfege
Traceback (most recent call last):
File "/usr/bin/solfege", line 58, in
import solfege.startup
File "/usr/share/solfege/solfege/startup.py", line 45, in
from solfege.mainwin import MainWin, SplashWin
File "/usr/share/solfege/solfege/mainwin.py", line 28, in
i = webbrowser._tryorder.index("x-www-browser")
AttributeError: 'NoneType' object has no attribute 'index'
-- System Information:
Debian Release: buster/sid
APT prefers testing
APT policy: (500, 'testing'), (50, 'unstable')
Architecture: amd64 (x86_64)
Kernel: Linux 4.19.0-2-amd64 (SMP w/4 CPU cores)
Locale: LANG=it_IT.utf8, LC_CTYPE=it_IT.utf8 (charmap=UTF-8),
LANGUAGE=it_IT.utf8 (charmap=UTF-8)
Shell: /bin/sh linked to /bin/dash
Init: systemd (via /run/systemd/system)
LSM: AppArmor: enabled
Versions of packages solfege depends on:
ii freepats 20060219-1
ii gir1.2-gtk-3.03.24.4-1
ii python3 3.7.1-3
ii python3-gi3.30.4-1
ii python3-gi-cairo 3.30.4-1
ii sensible-utils0.0.12
ii timidity 2.14.0-8
Versions of packages solfege recommends:
ii csound 1:6.12.2~dfsg-3
solfege suggests no packages.
-- no debconf information
Processed: tagging 916606
Processing commands for cont...@bugs.debian.org: > tags 916606 + patch Bug #916606 [lbreakout2] lbreakout2: randomly pauses ingame without external actions Added tag(s) patch. > thanks Stopping processing here. Please contact me if you need assistance. -- 916606: https://bugs.debian.org/cgi-bin/bugreport.cgi?bug=916606 Debian Bug Tracking System Contact ow...@bugs.debian.org with problems
Bug#918434: golint: FTBFS (failing tests)
Santiago, On 06/01/2019 00:14, Santiago Vila wrote: > I tried to build this package in buster but it failed: I have investigated the issue. It seems to be due either to changes in golang or in the x/tools package, I will do some more tests, and hope to fix it soon. -- Martín Ferrari (Tincho)
Bug#917686: lightproof: FTBFS: warning [/<>/lightproof_ru_RU-0.3.4.oxt]: zipfile is empty
On Sun, Dec 30, 2018 at 04:11:29PM +0100, Rene Engelhard wrote:
> retitle 917686 lightproof: FTBFS: "zipfile is empty" with python 3.7 ("Key
> Error")
> thanks
>
> Hi,
>
> On Sun, Dec 30, 2018 at 12:37:55PM +0100, Rene Engelhard wrote:
> > On Sat, Dec 29, 2018 at 10:43:37PM +0100, Lucas Nussbaum wrote:
> > > Relevant part (hopefully):
> > [...]
> >
> > Unfortunately not. This is the relevant part:
> >
> > for cfg in `find src -name "*.cfg"`; do \
> > python3 make.py $cfg; \
> > done
> > make.py:37: DeprecationWarning: The SafeConfigParser class has been renamed
> > to ConfigParser in Python 3.2. This alias will be removed in future
> > versions. Use ConfigParser directly instead.
> > fArgs = cp.SafeConfigParser()
> > /usr/lib/python3.7/zipfile.py:1470: UserWarning: Duplicate name:
> > 'META-INF/manifest.xml'
> > return self._open_to_write(zinfo, force_zip64=force_zip64)
> > make.py:37: DeprecationWarning: The SafeConfigParser class has been renamed
> > to ConfigParser in Python 3.2. This alias will be removed in future
> > versions. Use ConfigParser directly instead.
> > fArgs = cp.SafeConfigParser()
> > Traceback (most recent call last):
> > File "/usr/lib/python3.7/sre_parse.py", line 1021, in parse_template
> > this = chr(ESCAPES[this][1])
> > KeyError: '\\w'
> [...]
> > python3.7 strikes again?
>
> Jup, replacing python3 with python3.6 makes this work
For some reason the problem seems to be 32bit-only now:
https://tests.reproducible-builds.org/debian/rb-pkg/unstable/amd64/lightproof.html
> Regards,
>
> Rene
cu
Adrian
--
"Is there not promise of rain?" Ling Tan asked suddenly out
of the darkness. There had been need of rain for many days.
"Only a promise," Lao Er said.
Pearl S. Buck - Dragon Seed
Bug#891722: marked as done (sqwebmail-de FTBFS: applying patches fails)
Your message dated Sun, 27 Jan 2019 18:51:15 + with message-id and subject line Bug#891722: fixed in sqwebmail-de 6.0.0-1 has caused the Debian Bug report #891722, regarding sqwebmail-de FTBFS: applying patches fails to be marked as done. This means that you claim that the problem has been dealt with. If this is not the case it is now your responsibility to reopen the Bug report if necessary, and/or fix the problem forthwith. (NB: If you are a system administrator and have no idea what this message is talking about, this may indicate a serious mail system misconfiguration somewhere. Please contact ow...@bugs.debian.org immediately.) -- 891722: https://bugs.debian.org/cgi-bin/bugreport.cgi?bug=891722 Debian Bug Tracking System Contact ow...@bugs.debian.org with problems --- Begin Message --- Source: sqwebmail-de Version: 5.5.1-3 Severity: serious Tags: buster sid https://tests.reproducible-builds.org/debian/rb-pkg/unstable/amd64/sqwebmail-de.html ... debian/rules override_dh_auto_build make[1]: Entering directory '/build/1st/sqwebmail-de-5.5.1' mkdir htmltree cp -a /usr/lib/courier/sqwebmail/html/en-us/ htmltree rm htmltree/en-us/ISPELLDICT echo -n default > htmltree/en-us/ISPELLDICT # patch files - except TIMEZONELIST filterdiff -x */TIMEZONELIST < `ls *diff ` | (cd htmltree/en-us; patch -p1 ) patching file ISPELLDICT patching file LANGUAGE patching file LANGUAGE_PREF patching file LOCALE patching file abooklist.html patching file acl.html patching file attachments.html patching file autoresponder.html patching file calendarlogin.inc.html patching file empty.html patching file eventacl.html patching file eventdaily.html patching file eventdelete.html patching file eventmonthly.html patching file eventnotifydelete.txt patching file eventnotifynew.txt patching file eventnotifysubject.txt patching file eventshow.html patching file eventweekly.html patching file expired.html patching file filter.html patching file folder.html patching file folders.html patching file gpg.html Hunk #3 FAILED at 80. Hunk #4 FAILED at 127. Hunk #5 succeeded at 123 (offset -16 lines). Hunk #6 succeeded at 132 (offset -16 lines). Hunk #7 succeeded at 153 (offset -16 lines). Hunk #8 FAILED at 181. Hunk #9 succeeded at 183 (offset -16 lines). Hunk #10 succeeded at 191 (offset -16 lines). 3 out of 10 hunks FAILED -- saving rejects to file gpg.html.rej patching file gpgcreate.html patching file gpgerr.html patching file index.html Hunk #2 succeeded at 18 with fuzz 2. patching file invalid.html patching file keyimport.html patching file ldaplist.html patching file ldapsearch.html patching file login.html patching file loginform.inc.html patching file navbar.inc.html patching file navbar2.inc.html patching file navbar3.inc.html patching file newevent.html patching file newmsg.html patching file preferences.html patching file print.html patching file printnocookie.html patching file printredirect.html patching file quickadd.html patching file readmsg.html patching file redirect.html patching file spellchk.html make[1]: *** [debian/rules:20: override_dh_auto_build] Error 1 --- End Message --- --- Begin Message --- Source: sqwebmail-de Source-Version: 6.0.0-1 We believe that the bug you reported is fixed in the latest version of sqwebmail-de, which is due to be installed in the Debian FTP archive. A summary of the changes between this version and the previous one is attached. Thank you for reporting the bug, which will now be closed. If you have further comments please address them to 891...@bugs.debian.org, and the maintainer will reopen the bug report if appropriate. Debian distribution maintenance software pp. Willi Mann (supplier of updated sqwebmail-de package) (This message was generated automatically at their request; if you believe that there is a problem with it please contact the archive administrators by mailing ftpmas...@ftp-master.debian.org) -BEGIN PGP SIGNED MESSAGE- Hash: SHA256 Format: 1.8 Date: Sun, 27 Jan 2019 19:24:46 +0100 Source: sqwebmail-de Binary: sqwebmail-de Architecture: source Version: 6.0.0-1 Distribution: unstable Urgency: medium Maintainer: Willi Mann Changed-By: Willi Mann Description: sqwebmail-de - German translations for the SqWebMail webmail service Closes: 891722 Changes: sqwebmail-de (6.0.0-1) unstable; urgency=medium . * New "upstream" tarball (Updated translation for sqwebmail 6.0.0 (courier 1.0.5)) - fix build against latest courier-mta package, closes: #891722) * Depend on latest sqwebmail in debian (6.0.0+1.0.5) * Update Standards-Version (3.9.6 -> 4.3.0) * Update VCS-* fields * d/rules: also exclude ISPELLDICT from patching Checksums-Sha1: a1ec34f24ea9ec6e6df7417137b9b1965d734fcd 1899 sqwebmail-de_6.0.0-1.dsc be341017cbd5038674f99d17ef6276daebbf218f 29853 sqwebmail-de_6.0.0.orig.tar.gz ba2615ad5afc97faf030bfd3f2ca84ebc1e010f3 3984 sqwebmail-de_6.0.0-1.debian.tar.xz 9d330d6d0bd9a1b8746cc2c9f8ddfc72500fa8a0 6306
Bug#920629: [Debian GNUstep maintainers] Bug#920629: volumecontrol.app: Cannot quit, blocks under some circumstances
Hi Yavor many thanks would you mind doing a pr for that on github? I will happily make a 0.8 release... Gürkan > On Jan 27, 2019, at 18:14, Yavor Doganov wrote: > > Package: volumecontrol.app > Version: 0.7-1+b1 > Severity: grave > > The Quit menu item is greyed out and does not work. Selecting missing > controls (Bass/Treble for my card) makes the "Control missing" dialog > appear but you can't get rid of it. The app then becomes completely > unusable. > > There are multiple identical entries in the log: > > 2019-01-27 18:57:31.160 VolumeControl[17687:17687] Target NSMenu: > VolumeControl (Normal) does not respont to action terminate: > > Apart from the spelling error this message is correct. Note that as of > GUI 0.27.0 NSApplication -targetForAction:to:from: returns nil if the > target is not nil but it doesn't respond to the selector. > > I opened Volumecontrol.gorm and noticed that the connection is > terminate: (NSMenu) while it should be NSFirst. Changing the connection > makes the app behave as expected. I guess it would be easier to make a > new upstream release than to deal with binary patches... > > -- System Information: > Debian Release: buster/sid > APT prefers unstable-debug > APT policy: (500, 'unstable-debug'), (500, 'testing-debug'), (500, > 'unstable'), (500, 'testing') > Architecture: amd64 (x86_64) > Foreign Architectures: i386 > > Kernel: Linux 4.19.0-2-amd64 (SMP w/2 CPU cores) > Locale: LANG=bg_BG.UTF-8, LC_CTYPE=bg_BG.UTF-8 (charmap=UTF-8), > LANGUAGE=bg_BG.UTF-8 (charmap=UTF-8) > Shell: /bin/sh linked to /bin/dash > Init: systemd (via /run/systemd/system) > LSM: AppArmor: enabled > > Versions of packages volumecontrol.app depends on: > ii gnustep-back0.27 0.27.0-2 > ii gnustep-base-runtime 1.26.0-3 > ii gnustep-common [gnustep-fslayout-fhs] 2.7.0-4 > ii gnustep-gui-runtime0.27.0-3 > ii libasound2 1.1.7-2 > ii libc6 2.28-5 > ii libgnustep-base1.261.26.0-3 > ii libgnustep-gui0.27 0.27.0-3 > ii libobjc4 8.2.0-15 > > volumecontrol.app recommends no packages. > > volumecontrol.app suggests no packages. > > -- no debconf information > > ___ > Debian GNUstep maintainers mailing list > pkg-gnustep-maintain...@alioth-lists.debian.net > https://alioth-lists.debian.net/cgi-bin/mailman/listinfo/pkg-gnustep-maintainers
Processed: fixed 884632 in 1.19.0+dfsg-1
Processing commands for cont...@bugs.debian.org: > fixed 884632 1.19.0+dfsg-1 Bug #884632 [rtv] rtv crashes when viewing submission Marked as fixed in versions rtv/1.19.0+dfsg-1. > thanks Stopping processing here. Please contact me if you need assistance. -- 884632: https://bugs.debian.org/cgi-bin/bugreport.cgi?bug=884632 Debian Bug Tracking System Contact ow...@bugs.debian.org with problems
Bug#919778: [Debian-med-packaging] Bug#919778: Bug#919778: mash FTBFS on armhf when built on arm64 hardware
Ubuntu has a patch that might help. https://patches.ubuntu.com/m/mash/mash_2.0-2ubuntu2.patch
Bug#919219: abcm2ps: diff for NMU version 8.14.2-0.2
Dear maintainer,
I've prepared an NMU for abcm2ps (versioned as 8.14.2-0.2) and
uploaded it to DELAYED/10. Please feel free to tell me if I
should delay it longer.
It mostly fixes my previous the build with an explicit debhelper build
system (#919219).
Regards.
diff -Nru abcm2ps-8.14.2/debian/changelog abcm2ps-8.14.2/debian/changelog
--- abcm2ps-8.14.2/debian/changelog 2018-12-29 14:56:32.0 +0100
+++ abcm2ps-8.14.2/debian/changelog 2019-01-27 18:50:50.0 +0100
@@ -1,3 +1,13 @@
+abcm2ps (8.14.2-0.2) unstable; urgency=medium
+
+ * Non-maintainer upload.
+ * Drop obsolete README.Debian. Closes: #919514.
+ * Debhelper 12.
+ * Cherry-pick bad-ps-when-centered-or-right-aligned.diff from upstream CVS.
+ * Fix the build with an explicit debhelper build system. Closes: #919219.
+
+ -- Nicolas Boulenguez Sun, 27 Jan 2019 18:50:50 +0100
+
abcm2ps (8.14.2-0.1) unstable; urgency=medium
* Non-maintainer upload.
diff -Nru abcm2ps-8.14.2/debian/compat abcm2ps-8.14.2/debian/compat
--- abcm2ps-8.14.2/debian/compat 2018-12-29 14:56:32.0 +0100
+++ abcm2ps-8.14.2/debian/compat 1970-01-01 01:00:00.0 +0100
@@ -1 +0,0 @@
-11
diff -Nru abcm2ps-8.14.2/debian/control abcm2ps-8.14.2/debian/control
--- abcm2ps-8.14.2/debian/control 2018-12-29 14:56:32.0 +0100
+++ abcm2ps-8.14.2/debian/control 2019-01-27 18:39:38.0 +0100
@@ -3,7 +3,7 @@
Priority: optional
Maintainer: Anselm Lingnau
Build-Depends:
- debhelper (>= 11),
+ debhelper-compat (= 12),
libfreetype6-dev,
libpango1.0-dev,
pkg-config,
diff -Nru abcm2ps-8.14.2/debian/patches/bad-ps-when-centered-or-right-aligned.diff abcm2ps-8.14.2/debian/patches/bad-ps-when-centered-or-right-aligned.diff
--- abcm2ps-8.14.2/debian/patches/bad-ps-when-centered-or-right-aligned.diff 1970-01-01 01:00:00.0 +0100
+++ abcm2ps-8.14.2/debian/patches/bad-ps-when-centered-or-right-aligned.diff 2019-01-27 18:45:27.0 +0100
@@ -0,0 +1,16 @@
+Description: fix: bad PS output when centered or right aligned text with pango
+ Reported by Hudson Lacerda.
+Author: Jean-Francois Moine
+Origin: upstream https://github.com/leesavide/abcm2ps/commit/2eb380926b02edde530d4e1bfbe54d9f9ddf94fc
+
+--- a/subs.c
b/subs.c
+@@ -566,7 +566,7 @@
+ wi /= 2;
+ // w = (float) wi / PG_SCALE;
+ w = (float) wi / PANGO_SCALE;
+- a2b("-%.1f 0 RM ", w);
++ a2b(" -%.1f 0 RM", w);
+ break;
+ }
+ pg_line_output(line);
diff -Nru abcm2ps-8.14.2/debian/patches/series abcm2ps-8.14.2/debian/patches/series
--- abcm2ps-8.14.2/debian/patches/series 2018-12-29 14:56:32.0 +0100
+++ abcm2ps-8.14.2/debian/patches/series 2019-01-27 18:48:44.0 +0100
@@ -1 +1,2 @@
fix-loss-of-sep.diff
+bad-ps-when-centered-or-right-aligned.diff
diff -Nru abcm2ps-8.14.2/debian/README.Debian abcm2ps-8.14.2/debian/README.Debian
--- abcm2ps-8.14.2/debian/README.Debian 2018-12-29 14:56:32.0 +0100
+++ abcm2ps-8.14.2/debian/README.Debian 1970-01-01 01:00:00.0 +0100
@@ -1,9 +0,0 @@
-abcm2ps for Debian
---
-
-This is a Debianization of Jef Moine's abcm2ps package. It differs
-from the original in the following respects:
-
- - abcm2ps assumes A4 paper by default.
-
- -- Anselm Lingnau , Mon Jan 5 03:02:59 2004
diff -Nru abcm2ps-8.14.2/debian/rules abcm2ps-8.14.2/debian/rules
--- abcm2ps-8.14.2/debian/rules 2018-12-29 14:56:32.0 +0100
+++ abcm2ps-8.14.2/debian/rules 2019-01-27 18:39:38.0 +0100
@@ -4,4 +4,4 @@
export DEB_LDFLAGS_MAINT_APPEND := -Wl,--as-needed
%:
- dh $@
+ dh $@ --buildsystem=autoconf
Bug#920512: marked as done (syslog-ng: FTBFS with dpkg-buildpackage -A)
Your message dated Sun, 27 Jan 2019 18:06:21 + with message-id and subject line Bug#920512: fixed in syslog-ng 3.19.1-2 has caused the Debian Bug report #920512, regarding syslog-ng: FTBFS with dpkg-buildpackage -A to be marked as done. This means that you claim that the problem has been dealt with. If this is not the case it is now your responsibility to reopen the Bug report if necessary, and/or fix the problem forthwith. (NB: If you are a system administrator and have no idea what this message is talking about, this may indicate a serious mail system misconfiguration somewhere. Please contact ow...@bugs.debian.org immediately.) -- 920512: https://bugs.debian.org/cgi-bin/bugreport.cgi?bug=920512 Debian Bug Tracking System Contact ow...@bugs.debian.org with problems --- Begin Message --- Source: syslog-ng Version: 3.19.1-1 Severity: serious Justification: fails to build from source (but built successfully in the past) Hi, syslog-ng/experimental FTBFS during the binary-indep-only build, i.e. if built with dpkg-buildpackage -A: debian/rules build-indep make: 'build-indep' is up to date. fakeroot debian/rules binary-indep dh binary-indep --with autoreconf,systemd,python2 debian/rules build-indep make[1]: Entering directory '/build/syslog-ng-3.19.1' make[1]: 'build-indep' is up to date. make[1]: Leaving directory '/build/syslog-ng-3.19.1' dh_testroot -i dh_prep -i dh_installdirs -i debian/rules override_dh_auto_install make[1]: Entering directory '/build/syslog-ng-3.19.1' dh_auto_install -- \ pkgconfigdir=/usr/lib/x86_64-linux-gnu/pkgconfig \ PYSETUP_OPTIONS="--install-layout=deb \ --root=/build/syslog-ng-3.19.1/debian/tmp/" find . -name \*.la | xargs --no-run-if-empty rm make[1]: Leaving directory '/build/syslog-ng-3.19.1' dh_install -i dh_install: Cannot find (any matches for) "usr/share/syslog-ng/include/scl/default-network-drivers/*" (tried in ., debian/tmp) dh_install: syslog-ng-mod-extra missing files: usr/share/syslog-ng/include/scl/default-network-drivers/* dh_install: Cannot find (any matches for) "usr/share/syslog-ng/include/scl/ewmm/*" (tried in ., debian/tmp) dh_install: syslog-ng-mod-extra missing files: usr/share/syslog-ng/include/scl/ewmm/* dh_install: Cannot find (any matches for) "usr/share/syslog-ng/include/scl/graylog2/*" (tried in ., debian/tmp) dh_install: syslog-ng-mod-extra missing files: usr/share/syslog-ng/include/scl/graylog2/* dh_install: Cannot find (any matches for) "usr/share/syslog-ng/include/scl/loadbalancer/*" (tried in ., debian/tmp) dh_install: syslog-ng-mod-extra missing files: usr/share/syslog-ng/include/scl/loadbalancer/* dh_install: Cannot find (any matches for) "usr/share/syslog-ng/include/scl/osquery/*" (tried in ., debian/tmp) dh_install: syslog-ng-mod-extra missing files: usr/share/syslog-ng/include/scl/osquery/* dh_install: Cannot find (any matches for) "usr/share/syslog-ng/include/scl/windowseventlog/*" (tried in ., debian/tmp) dh_install: syslog-ng-mod-extra missing files: usr/share/syslog-ng/include/scl/windowseventlog/* dh_install: missing files, aborting make: *** [debian/rules:205: binary-indep] Error 25 The 'build-indep' target seems to be a no-op, not creating the stuff needed by the subsequent install target. cheers, Andreas syslog-ng_3.19.1-1_indep.log.gz Description: application/gzip --- End Message --- --- Begin Message --- Source: syslog-ng Source-Version: 3.19.1-2 We believe that the bug you reported is fixed in the latest version of syslog-ng, which is due to be installed in the Debian FTP archive. A summary of the changes between this version and the previous one is attached. Thank you for reporting the bug, which will now be closed. If you have further comments please address them to 920...@bugs.debian.org, and the maintainer will reopen the bug report if appropriate. Debian distribution maintenance software pp. Laszlo Boszormenyi (GCS) (supplier of updated syslog-ng package) (This message was generated automatically at their request; if you believe that there is a problem with it please contact the archive administrators by mailing ftpmas...@ftp-master.debian.org) -BEGIN PGP SIGNED MESSAGE- Hash: SHA256 Format: 1.8 Date: Sat, 26 Jan 2019 13:57:58 + Source: syslog-ng Architecture: source Version: 3.19.1-2 Distribution: unstable Urgency: medium Maintainer: syslog-ng maintainers Changed-By: Laszlo Boszormenyi (GCS) Closes: 920512 Changes: syslog-ng (3.19.1-2) unstable; urgency=medium . * Install SCL files from source (closes: #920512). * Make syslog-ng-mod-pacctformat linux-any. Checksums-Sha1: e90e7973e014e599d84736c64b50456002b2c5d2 4536 syslog-ng_3.19.1-2.dsc 9bca6308ea5820ee88149c62d8f6e06f0b3bc323 42472 syslog-ng_3.19.1-2.debian.tar.xz de75cba6bc607198438904fe1b338fba1b0c6c74 18283 syslog-ng_3.19.1-2_amd64.buildinfo Checksums-Sha256: 1ad67aba482ed5e0517b9acb6ed2b1c109026866e5a4a493992ae82f672cc70c 4536 syslog-ng_3.19.1-2.dsc
Bug#919778: [Debian-med-packaging] Bug#919778: mash FTBFS on armhf when built on arm64 hardware
tags 919778 help
forwarded 919778 https://github.com/marbl/Mash/issues/108
thanks
Hi,
thanks for reporting this issue!
I have forwarded this upstream but I'm afraid I won't be able to do much
about it in the near future. With the upcoming freeze in mind, and given
the fact that upstream doesn't seem to be too active about our recent
bug reports, TBH I would be tempted to remove support for the
architectures with missing builds from the mash package and file RM for
the old binary packages until there is a solution.
Some other packages depend on mash so I would like to see it in buster,
since (as always, in my own humble opinion) the problematic
architectures (arm, s390, mips) are not within the typical target
audience of mash.
Also tagging this as help -- so if there's anyone with expertise in this
kind of porting work, I would surely appreciate help :)
BTW Fabian, did you get any further with #918566 as this may be related?
Cheers
Sascha
On 19.01.19 15:42, Adrian Bunk wrote:
> Source: mash
> Version: 2.1-2
> Severity: serious
> Tags: ftbfs
>
> https://buildd.debian.org/status/fetch.php?pkg=mash=armhf=2.1-2=1545838322=0
>
> ...
>dh_auto_test -a
> make -j8 test VERBOSE=1
> make[1]: Entering directory '/<>'
> cd test ; ../mash sketch -o genomes.msh genome1.fna genome2.fna genome3.fna
> cd test ; ../mash sketch -r -I reads reads1.fastq reads2.fastq -o reads.msh
> Sketching genome1.fna...
> Sketching genome2.fna...
> Sketching genome3.fna...
> Bus error
> make[1]: *** [Makefile:94: test/reads.msh] Error 135
>
>
> Backtrace:
>
> #0 0x00638d2e in MurmurHash3_x64_128 (key=0xf523a009, len=len@entry=21,
> seed=, out=out@entry=0xf6b2dbd4)
> at src/mash/MurmurHash3.cpp:277
> #1 0x00635b4c in getHash (seq=, length=length@entry=21,
> seed=, use64=true)
> at src/mash/hash.cpp:23
> #2 0x00639a50 in addMinHashes (minHashHeap=...,
> seq=0xf523a008
> "AGCCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAGAGTGTCTGATAGCAGCTTCTGAACTGGTTACCTGCCGTGAGTAAATTATTGACTTAGGTCACTAAATACTTTAACCAATATAGGCATAGCGCACAGACAGATATTACAGAGTACACAACATCCATGAAACGCAT"...,
>
> length=, parameters=...) at src/mash/Sketch.cpp:601
> #3 0x0063a7d6 in sketchFile (input=0x692268) at src/mash/Sketch.cpp:1264
> #4 0x006400a0 in ThreadPool Sketch::SketchOutput>::thread (arg=0xffeea370)
> at src/mash/ThreadPool.hxx:182
> #5 0xf6cd2bbe in start_thread () from
> /lib/arm-linux-gnueabihf/libpthread.so.0
> #6 0xf6bc94dc in ?? () from /lib/arm-linux-gnueabihf/libc.so.6
>
>
>
> void MurmurHash3_x64_128 ( const void * key, const int len,
>const uint32_t seed, void * out )
> {
> const uint8_t * data = (const uint8_t*)key;
> ...
> const uint64_t * blocks = (const uint64_t *)(data);
> ...
>
>
> key=0xf523a009 is not properly aligned for that.
>
> ___
> Debian-med-packaging mailing list
> debian-med-packag...@alioth-lists.debian.net
> https://alioth-lists.debian.net/cgi-bin/mailman/listinfo/debian-med-packaging
>
signature.asc
Description: OpenPGP digital signature
Bug#920026: marked as done (python-greenlet-dev: ships header in /usr/include/python3.7/)
Your message dated Sun, 27 Jan 2019 17:17:32 + with message-id and subject line Bug#920026: fixed in python-greenlet 0.4.15-2 has caused the Debian Bug report #920026, regarding python-greenlet-dev: ships header in /usr/include/python3.7/ to be marked as done. This means that you claim that the problem has been dealt with. If this is not the case it is now your responsibility to reopen the Bug report if necessary, and/or fix the problem forthwith. (NB: If you are a system administrator and have no idea what this message is talking about, this may indicate a serious mail system misconfiguration somewhere. Please contact ow...@bugs.debian.org immediately.) -- 920026: https://bugs.debian.org/cgi-bin/bugreport.cgi?bug=920026 Debian Bug Tracking System Contact ow...@bugs.debian.org with problems --- Begin Message --- Package: python-greenlet-dev Version: 0.4.15-1 Severity: serious Hi, your package ships the header file(s): /usr/include/python3.7/greenlet/greenlet.h but /usr/include/python3.7 is a symlink to python3.7m in libpython3.7-dev. This may result in silent file overwrites or depending on the unpacking order /usr/include/python3.7 being a directory in some cases, separating the headers into two independent trees. These header files must be shipped in /usr/include/python3.7m/ instead. Please talk to the python maintainers to find a proper solution for handling the packaging of python header files in a future-proof way. Andreas --- End Message --- --- Begin Message --- Source: python-greenlet Source-Version: 0.4.15-2 We believe that the bug you reported is fixed in the latest version of python-greenlet, which is due to be installed in the Debian FTP archive. A summary of the changes between this version and the previous one is attached. Thank you for reporting the bug, which will now be closed. If you have further comments please address them to 920...@bugs.debian.org, and the maintainer will reopen the bug report if appropriate. Debian distribution maintenance software pp. Laszlo Boszormenyi (GCS) (supplier of updated python-greenlet package) (This message was generated automatically at their request; if you believe that there is a problem with it please contact the archive administrators by mailing ftpmas...@ftp-master.debian.org) -BEGIN PGP SIGNED MESSAGE- Hash: SHA256 Format: 1.8 Date: Sun, 27 Jan 2019 15:29:31 + Source: python-greenlet Architecture: source Version: 0.4.15-2 Distribution: unstable Urgency: medium Maintainer: Laszlo Boszormenyi (GCS) Changed-By: Laszlo Boszormenyi (GCS) Closes: 920026 Changes: python-greenlet (0.4.15-2) unstable; urgency=medium . * Correct Python 3 header installation directory (closes: #920026). * Mark python-greenlet-doc as Multi-Arch foreign. * Update Standards-Version to 4.3.0 . Checksums-Sha1: 430a9123df2e02b66a1bb279693ca4f185c9ce07 2304 python-greenlet_0.4.15-2.dsc 5114e2411dea096ddd169b2727cc16af5b8f7cce 7144 python-greenlet_0.4.15-2.debian.tar.xz c6817d5d6e6c499d47e94255d59d93562b56abe6 11265 python-greenlet_0.4.15-2_amd64.buildinfo Checksums-Sha256: 28dc856e74f12ddb84921ed40c190074a6ae83ba0c8ef781e969336a83431eb3 2304 python-greenlet_0.4.15-2.dsc 8cab9e1149a59cb7e313ad6a5546d02ca385845bd24c163956383b62c1b4e6e2 7144 python-greenlet_0.4.15-2.debian.tar.xz 82d99727ae45df9d7cbf6a5f4de1adb9bd1f37de3359ab9436a899c558382354 11265 python-greenlet_0.4.15-2_amd64.buildinfo Files: f7b3d6ce86c23793287612f41c5cb4d7 2304 python optional python-greenlet_0.4.15-2.dsc 8f47041eccd13bd2e0b7a2abf08af06a 7144 python optional python-greenlet_0.4.15-2.debian.tar.xz 5e946d331c56857e33c8fc65758d0f44 11265 python optional python-greenlet_0.4.15-2_amd64.buildinfo -BEGIN PGP SIGNATURE- iQIzBAEBCAAdFiEEfYh9yLp7u6e4NeO63OMQ54ZMyL8FAlxN4aUACgkQ3OMQ54ZM yL+1qRAAiz4r9pGcDZMbzqc37NNfCqrijrYftUIZhh8ndt0DiIwKuSgf4ozJx0Td PGtlRXqjoeByiitPRbT5+Th0y6CvwnEqQCIPs0M6wWUkVg7aXlqUwtGdh3Z3H9zH YEFuMNxQiipKXuC4iw6BpSz6mqxe9GYc5SQoItmHhbaLxNmcgzuLjfJRmseyoOHq bnG+53eN3hx2UocmNVUIhOZ7RF9DsGsRZ2X/t4yx6lL0fjH734zWlvc2mTToYJUH Tb4BHeEK6l1nm1OUUapFbwZMjx+ilELWFLzLFblC8DOZg3qQCOp6uVZrbvju91Os Ry62Wxkd6dGnAl/cN7whN1xhKjecdQR9EMz8VbNdlfyIxaR5Lqpp/rDQOyFVaKU0 qpJ0FHm04jMTSTqk8Gzim8oQcXkdxCxzqHEqeFmGwJNa0c2wdWpZ2rPahEJJlpkT ujx7JoPENWyrmY9o8old5YDvvRDlODlh26c7rkZNUCUhAkai0ud/K5bvPv1frAuD 5a/YBGJlPD6Tzb4V9xiA7qmzEWC0t4XzL7mkk6mjDpXeydlwPFe+H2hPni+8/K+b lheutLND78Xfe4lJwsXiD1EtXENZxKuiZR4uQpeSPjpjvA0nelIJ+lM/BV+GrA+9 9/zsTa6ETXYnkiXqF8NitOJ77TqtehUpSphF23hswcoPzuggEzM= =SomY -END PGP SIGNATURE End Message ---
Bug#920629: volumecontrol.app: Cannot quit, blocks under some circumstances
Package: volumecontrol.app Version: 0.7-1+b1 Severity: grave The Quit menu item is greyed out and does not work. Selecting missing controls (Bass/Treble for my card) makes the "Control missing" dialog appear but you can't get rid of it. The app then becomes completely unusable. There are multiple identical entries in the log: 2019-01-27 18:57:31.160 VolumeControl[17687:17687] Target NSMenu: VolumeControl (Normal) does not respont to action terminate: Apart from the spelling error this message is correct. Note that as of GUI 0.27.0 NSApplication -targetForAction:to:from: returns nil if the target is not nil but it doesn't respond to the selector. I opened Volumecontrol.gorm and noticed that the connection is terminate: (NSMenu) while it should be NSFirst. Changing the connection makes the app behave as expected. I guess it would be easier to make a new upstream release than to deal with binary patches... -- System Information: Debian Release: buster/sid APT prefers unstable-debug APT policy: (500, 'unstable-debug'), (500, 'testing-debug'), (500, 'unstable'), (500, 'testing') Architecture: amd64 (x86_64) Foreign Architectures: i386 Kernel: Linux 4.19.0-2-amd64 (SMP w/2 CPU cores) Locale: LANG=bg_BG.UTF-8, LC_CTYPE=bg_BG.UTF-8 (charmap=UTF-8), LANGUAGE=bg_BG.UTF-8 (charmap=UTF-8) Shell: /bin/sh linked to /bin/dash Init: systemd (via /run/systemd/system) LSM: AppArmor: enabled Versions of packages volumecontrol.app depends on: ii gnustep-back0.27 0.27.0-2 ii gnustep-base-runtime 1.26.0-3 ii gnustep-common [gnustep-fslayout-fhs] 2.7.0-4 ii gnustep-gui-runtime0.27.0-3 ii libasound2 1.1.7-2 ii libc6 2.28-5 ii libgnustep-base1.261.26.0-3 ii libgnustep-gui0.27 0.27.0-3 ii libobjc4 8.2.0-15 volumecontrol.app recommends no packages. volumecontrol.app suggests no packages. -- no debconf information
Bug#919583: [pkg-netfilter-team] Bug#919583: ebtables: broken symlinks: /sbin/ebtables{, -restore, -save} -> /usr/sbin/ebtables{, -restore, -save}
El dom., 27 ene. 2019 a las 10:03, Laurent Bigonville () escribió: > > An other solution is to remove this version check and just remove > unconditionally these symlinks in /sbin as they are not created by any other > packages (including iptables) > Hi Laurent, I can also confirm this bug and you're right about the proposed solutions. The last one is the solution chosen [1] and a new ebtables package is going to be uploaded soon solving this and others pending bugs. Thanks, Alberto [1] https://salsa.debian.org/pkg-netfilter-team/pkg-ebtables/commit/25138b75764caed8ecb95996532c23292cb591d6
Bug#911507: offlineimap: fails to load imaplib2
Hello, after your mail, I've reactivated the offlineimap script. Now all works fine. Thank you Best, Hans-Joachim signature.asc Description: OpenPGP digital signature
Bug#919736: marked as done (tj3: FTBFS (failing tests))
Your message dated Sun, 27 Jan 2019 16:08:14 +
with message-id
and subject line Bug#919736: fixed in tj3 3.6.0-6
has caused the Debian Bug report #919736,
regarding tj3: FTBFS (failing tests)
to be marked as done.
This means that you claim that the problem has been dealt with.
If this is not the case it is now your responsibility to reopen the
Bug report if necessary, and/or fix the problem forthwith.
(NB: If you are a system administrator and have no idea what this
message is talking about, this may indicate a serious mail system
misconfiguration somewhere. Please contact ow...@bugs.debian.org
immediately.)
--
919736: https://bugs.debian.org/cgi-bin/bugreport.cgi?bug=919736
Debian Bug Tracking System
Contact ow...@bugs.debian.org with problems
--- Begin Message ---
Package: src:tj3
Version: 3.6.0-5
Severity: serious
Tags: ftbfs
Dear maintainer:
I tried to build this package in buster but it failed:
[...]
debian/rules build-indep
dh build-indep --buildsystem=ruby --with ruby
dh_update_autotools_config -i -O--buildsystem=ruby
dh_auto_configure -i -O--buildsystem=ruby
dh_ruby --configure
debian/rules override_dh_auto_build
make[1]: Entering directory '/<>'
dh_auto_build
dh_ruby --build
dh_ruby --build
localehelper LANG=en_US.UTF-8 rake manual
mkdir -p manual/html
rake vim
rake help2man
mkdir -p man
make[1]: Leaving directory '/<>'
debian/rules override_dh_auto_test
make[1]: Entering directory '/<>'
rake spec
/usr/bin/ruby2.5 /usr/bin/rspec --pattern spec/\*_spec.rb
Run options: exclude {:ruby=>#}
..F.F...
Failures:
1) TaskJuggler::StatusSheetTest TaskJuggler::StatusSheetSender should have
matching status sheets in body and attachment
Failure/Error: bodySheet.should == attachedSheet
expected: "statussheet boss 2011-03-16-00:00-+ -
2011-03-23-00:00-+ {\r\n\r\n # Task: T1\r\n task t1 ... # # Work:
100%Remaining: 5.0d (10.0d) \r\n# author r2\r\n# }\r\n
}\r\n\r\n}\r\n"
got: "statussheet boss 2011-03-16-00:00-+ -
2011-03-23-00:00-+ {\n\n # Task: T1\n task t1 {\n ...:00-+\n#
# Work: 100%Remaining: 5.0d (10.0d) \n# author r2\n# }\n
}\n\n}\n" (using ==)
# ./spec/StatusSheets_spec.rb:234:in `block (4 levels) in
'
# ./spec/StatusSheets_spec.rb:231:in `each'
# ./spec/StatusSheets_spec.rb:231:in `block (3 levels) in
'
2) TaskJuggler::TimeSheets TaskJuggler::TimeSheetSender should have matching
timesheets in body and attachment
Failure/Error: bodySheet.should == attachedSheet
expected: "timesheet r1 2011-03-14-00:00-+ - 2011-03-21-00:00-+
{\r\n\r\n # Vacation time: 0.0%\r\n\r\...details\r\n # ->8-\r\n #
}\r\n\r\n # You have no future assignments for this project!\r\n}\r\n"
got: "timesheet r1 2011-03-14-00:00-+ - 2011-03-21-00:00-+
{\n\n # Vacation time: 0.0%\n\n # Tas... Some more details\n # ->8-\n #
}\n\n # You have no future assignments for this project!\n}\n" (using ==)
# ./spec/TimeSheets_spec.rb:220:in `block (4 levels) in
'
# ./spec/TimeSheets_spec.rb:217:in `each'
# ./spec/TimeSheets_spec.rb:217:in `block (3 levels) in
'
Finished in 24.83 seconds (files took 0.84252 seconds to load)
68 examples, 2 failures
Failed examples:
rspec ./spec/StatusSheets_spec.rb:230 # TaskJuggler::StatusSheetTest
TaskJuggler::StatusSheetSender should have matching status sheets in body and
attachment
rspec ./spec/TimeSheets_spec.rb:216 # TaskJuggler::TimeSheets
TaskJuggler::TimeSheetSender should have matching timesheets in body and
attachment
/usr/bin/ruby2.5 /usr/bin/rspec --pattern spec/\*_spec.rb failed
make[1]: *** [debian/rules:18: override_dh_auto_test] Error 1
make[1]: Leaving directory '/<>'
make: *** [debian/rules:4: build-indep] Error 2
dpkg-buildpackage: error: debian/rules build-indep subprocess returned exit
status 2
The build was made in my autobuilder with "dpkg-buildpackage -A"
and it also fails here:
https://tests.reproducible-builds.org/debian/rb-pkg/unstable/amd64/tj3.html
where you can get a full build log if you need it.
If this is really a bug in one of the build-depends, please use reassign and
affects,
so that this is still visible in the BTS web page for this package.
Thanks.
--- End Message ---
--- Begin Message ---
Source: tj3
Source-Version: 3.6.0-6
We believe that the bug you reported is fixed in the latest version of
tj3, which is due to be installed in the Debian FTP archive.
A summary of the changes between this version and the previous one is
attached.
Thank you for reporting the bug, which will now be closed. If you
have further comments please address them to 919...@bugs.debian.org,
and the maintainer will reopen the bug
Bug#920026: python-greenlet-dev: ships header in /usr/include/python3.7/
Hi Andreas, Unfortunately I didn't receive your bugreport and only seen in the BTS recently. The python-greenlet package doesn't define the header installation location itself. I believe it's the python-setuptools code that installs into the incorrect directory. Will consult with Python maintainers about this. Thanks, Laszlo/GCS
Bug#918742: Initialization loop/deadlock when used with jemalloc
Hi Piotr and Faidon,
On Thu, 10 Jan 2019 18:31:01 +0100 Johannes Schauer wrote:
> Quoting Faidon Liambotis (2019-01-10 15:29:59)
> > Unfortunately, the initialization code runs regardless of whether prof was
> > enabled or not, and from the code it seems like this is intentional...
> >
> > See here:
> > https://github.com/jemalloc/jemalloc/blob/5.1.0/src/prof.c#L2392
> > ...where the relevant call to _Unwind_Backtrace is outside the "if
> > (opt_prof)
> > { }" block. (The code is similar in the dev branch)
>
> then I guess the proper fix would be to adapt dl_iterate_phdr to act
> differently in case libjemalloc.so is loaded?
>
> I fear I lack the knowledge of how to do that and unless Piotr finds some
> time,
> I guess the best we can do for Buster, is to temporarily disable the test and
> declare that jemalloc and fakechroot are incompatible in Buster. :/
since nobody else stepped up to fix this properly, I now uploaded a NMU that
just disables the failing test.
As per devref recommendation I uploaded it to DELAYED/2. Debdiff is attached.
Thanks!
cheers, josch
diff -Nru fakechroot-2.19/debian/changelog fakechroot-2.19/debian/changelog
--- fakechroot-2.19/debian/changelog 2019-01-01 08:05:21.0 +0100
+++ fakechroot-2.19/debian/changelog 2019-01-27 16:34:19.0 +0100
@@ -1,3 +1,13 @@
+fakechroot (2.19-3.2) unstable; urgency=medium
+
+ * Non-maintainer upload.
+ * Build-Depends on libjemalloc-dev instead of libjemalloc1 (closes: #918741)
+ * Disable jemalloc test because since libjemalloc2, fakechroot is
+incompatible with jemalloc. They must not be preloaded at the same time.
+(closes: #918742)
+
+ -- Johannes 'josch' Schauer Sun, 27 Jan 2019 16:34:19 +0100
+
fakechroot (2.19-3.1) unstable; urgency=medium
* Non-maintainer upload.
diff -Nru fakechroot-2.19/debian/control fakechroot-2.19/debian/control
--- fakechroot-2.19/debian/control 2016-11-20 18:23:16.0 +0100
+++ fakechroot-2.19/debian/control 2019-01-27 16:25:54.0 +0100
@@ -6,7 +6,7 @@
debhelper (>= 9.20141010),
dh-autoreconf,
dpkg-dev (>= 1.17.14),
- libjemalloc1
+ libjemalloc-dev
Standards-Version: 3.9.8
Homepage: https://github.com/dex4er/fakechroot
VCS-Git: https://anonscm.debian.org/git/collab-maint/fakechroot.git
diff -Nru fakechroot-2.19/debian/patches/disable-jemalloc-test fakechroot-2.19/debian/patches/disable-jemalloc-test
--- fakechroot-2.19/debian/patches/disable-jemalloc-test 1970-01-01 01:00:00.0 +0100
+++ fakechroot-2.19/debian/patches/disable-jemalloc-test 2019-01-27 16:29:27.0 +0100
@@ -0,0 +1,12 @@
+--- a/test/t/jemalloc.t
b/test/t/jemalloc.t
+@@ -9,6 +9,9 @@ libjemalloc=`
+ done
+ echo no
+ `
++# temporarily disable
++# https://bugs.debian.org/cgi-bin/bugreport.cgi?bug=918742
++libjemalloc=no
+ test $libjemalloc = "no" && skip_all 'jemalloc library is missing (sudo apt-get install libjemalloc1)'
+
+ prepare 1
diff -Nru fakechroot-2.19/debian/patches/series fakechroot-2.19/debian/patches/series
--- fakechroot-2.19/debian/patches/series 2019-01-01 08:05:21.0 +0100
+++ fakechroot-2.19/debian/patches/series 2019-01-27 16:28:35.0 +0100
@@ -1 +1,2 @@
renameat2.patch
+disable-jemalloc-test
signature.asc
Description: signature
Bug#867681: marked as done (software-properties-gtk: trusted.gpg file created by this package produces gpg error for 'apt-get update')
Your message dated Sun, 27 Jan 2019 15:35:35 +
with message-id
and subject line Bug#867681: fixed in software-properties 0.96.24.32.7-1
has caused the Debian Bug report #867681,
regarding software-properties-gtk: trusted.gpg file created by this package
produces gpg error for 'apt-get update'
to be marked as done.
This means that you claim that the problem has been dealt with.
If this is not the case it is now your responsibility to reopen the
Bug report if necessary, and/or fix the problem forthwith.
(NB: If you are a system administrator and have no idea what this
message is talking about, this may indicate a serious mail system
misconfiguration somewhere. Please contact ow...@bugs.debian.org
immediately.)
--
867681: https://bugs.debian.org/cgi-bin/bugreport.cgi?bug=867681
Debian Bug Tracking System
Contact ow...@bugs.debian.org with problems
--- Begin Message ---
Package: software-properties-gtk
Version: 0.96.20.2-1
Severity: critical
Tags: d-i
Justification: breaks the whole system
Dear Maintainer,
*** Reporter, please consider answering these questions, where appropriate ***
* What led up to the situation?
>> Adding other repos and keys via gui.
* What exactly did you do (or not do) that was effective (or ineffective)?
>> Deleted /etc/apt/trusted.gpg file and all
contents of /var/lib/apt/lists directory.
* What was the outcome of this action?
>>'app-get update' didn't give any errors.
* What outcome did you expect instead?
>> Same as the above mentioned.
Note: Got the temporary fix from
https://readlist.com/lists/lists.debian.org/debian-user/77/388466.html
*** End of the template - remove these template lines ***
-- System Information:
Debian Release: 9.0
APT prefers proposed-updates
APT policy: (500, 'proposed-updates'), (500, 'stable')
Architecture: amd64 (x86_64)
Kernel: Linux 4.9.0-3-amd64 (SMP w/4 CPU cores)
Locale: LANG=en_IN, LC_CTYPE=en_IN (charmap=UTF-8), LANGUAGE=en_IN:en
(charmap=UTF-8)
Shell: /bin/sh linked to /bin/dash
Init: systemd (via /run/systemd/system)
Versions of packages software-properties-gtk depends on:
ii gir1.2-gtk-3.0 3.22.11-1
ii python3 3.5.3-1
ii python3-gi 3.22.0-2
ii python3-software-properties 0.96.20.2-1
ii software-properties-common 0.96.20.2-1
software-properties-gtk recommends no packages.
Versions of packages software-properties-gtk suggests:
ii gnome-software 3.22.5-1
--- End Message ---
--- Begin Message ---
Source: software-properties
Source-Version: 0.96.24.32.7-1
We believe that the bug you reported is fixed in the latest version of
software-properties, which is due to be installed in the Debian FTP archive.
A summary of the changes between this version and the previous one is
attached.
Thank you for reporting the bug, which will now be closed. If you
have further comments please address them to 867...@bugs.debian.org,
and the maintainer will reopen the bug report if appropriate.
Debian distribution maintenance software
pp.
Julian Andres Klode (supplier of updated software-properties
package)
(This message was generated automatically at their request; if you
believe that there is a problem with it please contact the archive
administrators by mailing ftpmas...@ftp-master.debian.org)
-BEGIN PGP SIGNED MESSAGE-
Hash: SHA512
Format: 1.8
Date: Sat, 26 Jan 2019 22:52:33 +0100
Source: software-properties
Binary: python3-software-properties software-properties-common
software-properties-gtk software-properties-kde
Architecture: source
Version: 0.96.24.32.7-1
Distribution: experimental
Urgency: medium
Maintainer: Julian Andres Klode
Changed-By: Julian Andres Klode
Description:
python3-software-properties - manage the repositories that you install
software from
software-properties-common - manage the repositories that you install software
from (common)
software-properties-gtk - manage the repositories that you install software
from (gtk)
software-properties-kde - manage the repositories that you install software
from (qt)
Closes: 867681
Changes:
software-properties (0.96.24.32.7-1) experimental; urgency=medium
.
* Merge with Ubuntu 18.04 LTS; remaining changes:
- Do not use dh-translations (and now dh-migrations as well)
- Occasional indentation changes in debian/
- Drop aptdaemon, qapt, and ubuntu-drivers
- Updated debian/copyright
- Various patches
* Amongst other things, this fixes apt-key management (Closes: #867681)
* {Build-},Depend on gpg, gpg-agent
.
software-properties (0.96.24.32.7) bionic; urgency=medium
.
* SoftwarePropertiesGtk.py: when checking a package's depends for DKMS also
pass on an AttributeError (LP: #1807373)
.
software-properties (0.96.24.32.6) bionic; urgency=medium
.
* cloudarchive: Enable support for the Stein Ubuntu Cloud Archive on
18.04 (LP: #1805436).
.
software-properties (0.96.24.32.5) bionic;
Bug#912977: iptables: nftables layer breaks ipsec/policy keyword
Control: severity -1 important On Tue, 6 Nov 2018 20:38:41 +0100 Pierre Chifflier wrote: > > I'm still running some more tests, but I think the severity can be > lowered. > Ok, lowering severity now.
Processed: Re: Bug#912977: iptables: nftables layer breaks ipsec/policy keyword
Processing control commands: > severity -1 important Bug #912977 [iptables] iptables: nftables layer breaks ipsec/policy keyword Severity set to 'important' from 'grave' -- 912977: https://bugs.debian.org/cgi-bin/bugreport.cgi?bug=912977 Debian Bug Tracking System Contact ow...@bugs.debian.org with problems
Bug#917143: t-coffee autopkgtest regression
Control: tags -1 help upstream Control: forwarded -1 https://github.com/cbcrg/tcoffee/issues/13 Hi Liubov, On Sun, Jan 27, 2019 at 04:06:51PM +0100, Liubov Chuprikova wrote: > I was trying to figure out the reason for the failure but without any > success. It appeared that the error is reproducible with the upstream's > source version, so I have just opened an issue [1] to inform the upstream > about this bug. > > [1] https://github.com/cbcrg/tcoffee/issues/13 Thanks a lot, Andreas. -- http://fam-tille.de
Processed: Re: Bug#917143: t-coffee autopkgtest regression
Processing control commands: > tags -1 help upstream Bug #917143 [src:t-coffee] t-coffee breaks libbio-tools-run-alignment-tcoffee-perl autopkgtest: COREDUMP Bug #917719 [src:t-coffee] libbio-tools-run-alignment-tcoffee-perl: FTBFS: dh_auto_test: make -j2 test TEST_VERBOSE=1 returned exit code 2 Added tag(s) upstream and help. Added tag(s) upstream and help. > forwarded -1 https://github.com/cbcrg/tcoffee/issues/13 Bug #917143 [src:t-coffee] t-coffee breaks libbio-tools-run-alignment-tcoffee-perl autopkgtest: COREDUMP Bug #917719 [src:t-coffee] libbio-tools-run-alignment-tcoffee-perl: FTBFS: dh_auto_test: make -j2 test TEST_VERBOSE=1 returned exit code 2 Set Bug forwarded-to-address to 'https://github.com/cbcrg/tcoffee/issues/13'. Set Bug forwarded-to-address to 'https://github.com/cbcrg/tcoffee/issues/13'. -- 917143: https://bugs.debian.org/cgi-bin/bugreport.cgi?bug=917143 917719: https://bugs.debian.org/cgi-bin/bugreport.cgi?bug=917719 Debian Bug Tracking System Contact ow...@bugs.debian.org with problems
Bug#920597: Last docker.io update - not start
sorry, is not solved. next problem. docker run -it -u0 --rm alpine:latest docker: Error response from daemon: failed to start shim: exec: "containerd-shim": executable file not found in $PATH: unknown.
Bug#917143: t-coffee autopkgtest regression
Hi, I was trying to figure out the reason for the failure but without any success. It appeared that the error is reproducible with the upstream's source version, so I have just opened an issue [1] to inform the upstream about this bug. [1] https://github.com/cbcrg/tcoffee/issues/13 With regards, Liubov
Bug#899002: systemd: networking and rdma-load-modules@infiniband service run in parallel despite the declared dependency order
severity 899002 important clone 899002 -1 -2 retitle -2 Networking not waiting for USB Ethernet dongle to be detected thanks On Sun, Jan 27, 2019 at 02:40:06PM +0100, Benjamin Drung wrote: > severity 899002 grave The definition of grave is: “makes the package in question unusable or mostly so, or causes data loss, or introduces a security hole allowing access to the accounts of users who use the package.” While it might make the package unusable on YOUR system, this is only an issue for some particular, not so common setups. Also, this issue has nothing to do with RDMA, and while there are similarities, I'll treat this as a separate bug. > This race condition bug hit me also with an Odroid HC1. This ARM boards > has an Ethernet controller connected over USB. Without this bugfix, the > networking service does not wait until the USB hub is initialised and > the Ethernet controller is found: Can you provide me with a copy of your /etc/network/interfaces file? In particular, did you use "auto eth0" or "allow-hotplug eth0"? If the interface's presence is delayed because of the USB hub being initialized in parallel, then using allow-hotplug might work around the issue for you. > Please get ifupdown >= 0.8.33 > into testing! Good point, I have to fix #900269 to do that. -- Met vriendelijke groet / with kind regards, Guus Sliepen signature.asc Description: PGP signature
Processed: Re: Bug#899002: systemd: networking and rdma-load-modules@infiniband service run in parallel despite the declared dependency order
Processing commands for cont...@bugs.debian.org:
> severity 899002 important
Bug #899002 {Done: Guus Sliepen } [ifupdown] systemd:
networking and rdma-load-modules@infiniband service run in parallel despite the
declared dependency order
Severity set to 'important' from 'grave'
> clone 899002 -1 -2
Bug #899002 {Done: Guus Sliepen } [ifupdown] systemd:
networking and rdma-load-modules@infiniband service run in parallel despite the
declared dependency order
Bug 899002 cloned as bugs 920622-920623
> retitle -2 Networking not waiting for USB Ethernet dongle to be detected
Bug #920623 {Done: Guus Sliepen } [ifupdown] systemd:
networking and rdma-load-modules@infiniband service run in parallel despite the
declared dependency order
Changed Bug title to 'Networking not waiting for USB Ethernet dongle to be
detected' from 'systemd: networking and rdma-load-modules@infiniband service
run in parallel despite the declared dependency order'.
> thanks
Stopping processing here.
Please contact me if you need assistance.
--
899002: https://bugs.debian.org/cgi-bin/bugreport.cgi?bug=899002
920623: https://bugs.debian.org/cgi-bin/bugreport.cgi?bug=920623
Debian Bug Tracking System
Contact ow...@bugs.debian.org with problems
Bug#920597: marked as done (docker.io: Unable to start daemon: "containerd" executable file not found in PATH)
Your message dated Sun, 27 Jan 2019 13:51:00 + with message-id and subject line Bug#920597: fixed in docker.io 18.09.1+dfsg1-3 has caused the Debian Bug report #920597, regarding docker.io: Unable to start daemon: "containerd" executable file not found in PATH to be marked as done. This means that you claim that the problem has been dealt with. If this is not the case it is now your responsibility to reopen the Bug report if necessary, and/or fix the problem forthwith. (NB: If you are a system administrator and have no idea what this message is talking about, this may indicate a serious mail system misconfiguration somewhere. Please contact ow...@bugs.debian.org immediately.) -- 920597: https://bugs.debian.org/cgi-bin/bugreport.cgi?bug=920597 Debian Bug Tracking System Contact ow...@bugs.debian.org with problems --- Begin Message --- Package: docker.io Version: 18.09.1+dfsg1-2 Severity: serious X-Debbugs-CC: arnaud.rebill...@collabora.com Docker daemon is unable to start: Failed to start containerd: exec: "containerd": executable file not found in $PATH signature.asc Description: This is a digitally signed message part. --- End Message --- --- Begin Message --- Source: docker.io Source-Version: 18.09.1+dfsg1-3 We believe that the bug you reported is fixed in the latest version of docker.io, which is due to be installed in the Debian FTP archive. A summary of the changes between this version and the previous one is attached. Thank you for reporting the bug, which will now be closed. If you have further comments please address them to 920...@bugs.debian.org, and the maintainer will reopen the bug report if appropriate. Debian distribution maintenance software pp. Dmitry Smirnov (supplier of updated docker.io package) (This message was generated automatically at their request; if you believe that there is a problem with it please contact the archive administrators by mailing ftpmas...@ftp-master.debian.org) -BEGIN PGP SIGNED MESSAGE- Hash: SHA256 Format: 1.8 Date: Sun, 27 Jan 2019 23:43:53 +1100 Source: docker.io Binary: docker-doc docker.io docker.io-dbgsym golang-docker-dev golang-github-docker-docker-dev vim-syntax-docker Architecture: source all amd64 Version: 18.09.1+dfsg1-3 Distribution: unstable Urgency: medium Maintainer: Dmitry Smirnov Changed-By: Dmitry Smirnov Description: docker-doc - Linux container runtime -- documentation docker.io - Linux container runtime golang-docker-dev - Transitional package for golang-github-docker-docker-dev golang-github-docker-docker-dev - reusable Go packages included with Docker vim-syntax-docker - Docker container engine - Vim highlighting syntax files Closes: 920597 Changes: docker.io (18.09.1+dfsg1-3) unstable; urgency=medium . * New patch to fix name of the "containerd" executable (Closes: #920597). Checksums-Sha1: b1dc1e4c48927bb1022144b7f6d6e445332ddcbb 8933 docker.io_18.09.1+dfsg1-3.dsc 0a700dd150381f14af84a36d0df7ad2aaa643a03 40520 docker.io_18.09.1+dfsg1-3.debian.tar.xz 21f6cd26d8a937d17cd7b9a68059abf969fa9439 974648 docker-doc_18.09.1+dfsg1-3_all.deb b6d7b184c764742e4e81a8220611f459a903ced3 7122520 docker.io-dbgsym_18.09.1+dfsg1-3_amd64.deb 50b3b8222cf352a671d4ff44cabf106e66ad90e7 25559 docker.io_18.09.1+dfsg1-3_amd64.buildinfo 73a32d5c8f186332a5930a4137f844b239eb7739 53525024 docker.io_18.09.1+dfsg1-3_amd64.deb 0cded981b8dba6407fb97b869bb5fb2d2f310d51 20096 golang-docker-dev_18.09.1+dfsg1-3_all.deb a000c0474a0d8539ec3e24c2b678c571fc4f5a0a 532492 golang-github-docker-docker-dev_18.09.1+dfsg1-3_all.deb 71b04234abc70fd631e2916ece1942eb03510af9 21260 vim-syntax-docker_18.09.1+dfsg1-3_all.deb Checksums-Sha256: 5cda0d271e10f5e5c89f04cd6e82ed2bde6ce0edf179f85048f68b7f1c88a236 8933 docker.io_18.09.1+dfsg1-3.dsc 34cebd557e4658e480f12284a059b99a27ca526c51b1c04fcd522978a50c06b4 40520 docker.io_18.09.1+dfsg1-3.debian.tar.xz ca5ba01157d1747092566c03e174e1d7c3c2b44eee854fae5dfa1e4699a6394b 974648 docker-doc_18.09.1+dfsg1-3_all.deb ac17e9dbde21490de928d2b11c6d5060a825644ec040a48ab96f4537e3b6e903 7122520 docker.io-dbgsym_18.09.1+dfsg1-3_amd64.deb 038ab8a198f83130cc838ff6c81df37fb87d6226edb4be176f3ae768c82c4d8d 25559 docker.io_18.09.1+dfsg1-3_amd64.buildinfo 9c4744d0ecca3c90339cf3eccc59603b7c4931106bbf811ba75c7829818aacfa 53525024 docker.io_18.09.1+dfsg1-3_amd64.deb d48403317fe92d41e88feb1a316fc49fc06ec5e674b575c12236846d9923af38 20096 golang-docker-dev_18.09.1+dfsg1-3_all.deb 1b50f8c4e44c36d96b722a4434875d0c9812e955dd9f1a89a4fd7b3c630fbf7d 532492 golang-github-docker-docker-dev_18.09.1+dfsg1-3_all.deb 8b6a844b10faaa56aeaa0af40bd97121f099e8bf734f44e6938b5cf8348591b3 21260 vim-syntax-docker_18.09.1+dfsg1-3_all.deb Files: a5db07b642e61c20a274eb5ac22bd05b 8933 admin optional docker.io_18.09.1+dfsg1-3.dsc 36ae6429627843e7742a64c4bdf9ea5d 40520 admin optional docker.io_18.09.1+dfsg1-3.debian.tar.xz 5804d8d995a2a1305e4c3fc7359e9e33 974648 doc optional
Processed: Re: Bug#899002: systemd: networking and rdma-load-modules@infiniband service run in parallel despite the declared dependency order
Processing commands for cont...@bugs.debian.org:
> tags 899002 buster
Bug #899002 {Done: Guus Sliepen } [ifupdown] systemd:
networking and rdma-load-modules@infiniband service run in parallel despite the
declared dependency order
Added tag(s) buster.
> severity 899002 grave
Bug #899002 {Done: Guus Sliepen } [ifupdown] systemd:
networking and rdma-load-modules@infiniband service run in parallel despite the
declared dependency order
Severity set to 'grave' from 'normal'
> thanks
Stopping processing here.
Please contact me if you need assistance.
--
899002: https://bugs.debian.org/cgi-bin/bugreport.cgi?bug=899002
Debian Bug Tracking System
Contact ow...@bugs.debian.org with problems
Bug#903201: cinnamon: CVE-2018-13054: privilege escalation in cinnamon-settings-users.py GUI
Hi Cinnamon Team, Can you adress this issue via an upcoming point release? Regards, Salvatore
Bug#919918: marked as done (scikit-learn FTBFS on armel/armhf/arm64/ppc64el/s390x: test failures)
Your message dated Sun, 27 Jan 2019 12:50:32 + with message-id and subject line Bug#919918: fixed in scikit-learn 0.20.2+dfsg-2 has caused the Debian Bug report #919918, regarding scikit-learn FTBFS on armel/armhf/arm64/ppc64el/s390x: test failures to be marked as done. This means that you claim that the problem has been dealt with. If this is not the case it is now your responsibility to reopen the Bug report if necessary, and/or fix the problem forthwith. (NB: If you are a system administrator and have no idea what this message is talking about, this may indicate a serious mail system misconfiguration somewhere. Please contact ow...@bugs.debian.org immediately.) -- 919918: https://bugs.debian.org/cgi-bin/bugreport.cgi?bug=919918 Debian Bug Tracking System Contact ow...@bugs.debian.org with problems --- Begin Message --- Source: scikit-learn Version: 0.20.1+dfsg-3 Severity: serious Tags: ftbfs https://buildd.debian.org/status/package.php?p=scikit-learn=sid There are several, potentially unrelated, test failures on various architectures. --- End Message --- --- Begin Message --- Source: scikit-learn Source-Version: 0.20.2+dfsg-2 We believe that the bug you reported is fixed in the latest version of scikit-learn, which is due to be installed in the Debian FTP archive. A summary of the changes between this version and the previous one is attached. Thank you for reporting the bug, which will now be closed. If you have further comments please address them to 919...@bugs.debian.org, and the maintainer will reopen the bug report if appropriate. Debian distribution maintenance software pp. Ole Streicher (supplier of updated scikit-learn package) (This message was generated automatically at their request; if you believe that there is a problem with it please contact the archive administrators by mailing ftpmas...@ftp-master.debian.org) -BEGIN PGP SIGNED MESSAGE- Hash: SHA512 Format: 1.8 Date: Sun, 27 Jan 2019 11:41:13 +0100 Source: scikit-learn Binary: python-sklearn python-sklearn-lib python3-sklearn python3-sklearn-lib python-sklearn-doc Architecture: source Version: 0.20.2+dfsg-2 Distribution: unstable Urgency: medium Maintainer: Debian Science Team Changed-By: Ole Streicher Description: python-sklearn - Python modules for machine learning and data mining - Python 2 python-sklearn-doc - documentation and examples for scikit-learn python-sklearn-lib - low-level implementations and bindings for scikit-learn python3-sklearn - Python modules for machine learning and data mining - Python 3 python3-sklearn-lib - low-level implementations and bindings for scikit-learn - Python Closes: 919918 Changes: scikit-learn (0.20.2+dfsg-2) unstable; urgency=medium . * Team upload. * Skip tests that fail on non-intel platforms. Closes: #919918 Checksums-Sha1: b455bc66cb0e152f713eb1d78752ac5871ad0200 3346 scikit-learn_0.20.2+dfsg-2.dsc a72db918b69b20a7eae44de6867f18eb29d12cdf 21020 scikit-learn_0.20.2+dfsg-2.debian.tar.xz Checksums-Sha256: 6ffa71e735fb7d9cd3e534f28dde936d1c2e2c07b2288c93fdd15a296c29510b 3346 scikit-learn_0.20.2+dfsg-2.dsc 4f427fa4ec6e75e6d02da4bf18e6c9874ad28c120fa6eac8dae02af09582d7ab 21020 scikit-learn_0.20.2+dfsg-2.debian.tar.xz Files: 0f0a673aeda88555b8017da735e7b54f 3346 python optional scikit-learn_0.20.2+dfsg-2.dsc f7ae6a65a9f1291650c735928f8f243d 21020 python optional scikit-learn_0.20.2+dfsg-2.debian.tar.xz -BEGIN PGP SIGNATURE- iQIzBAEBCgAdFiEEuvxshffLFD/utvsVcRWv0HcQ3PcFAlxNpZEACgkQcRWv0HcQ 3PdzQg/5AcmrfAnRvbeCMqBm1stzxW3tQcnD6pCpViffzzh1ZD+ZuNw6HkNm0nhb 97to7OnrFAQuOlu9/KjLsNzccEEtc1CfvB9A45n3BpviQCTaRhmOq+V/whmbnqvt eWlj9REhcNoBdVIT9Qfww1ZX16eLp3SerHJxBsrRo2G1VJqdsmNKjS/oqehLMIYd r56QD/39ICwzrs0hCdvCKgYNUle0W/2I5ff4inWmK9Glpbr9oHiHdxCXHOE9FGan 3ms4gqaIwjKkqBai1MhWIyY834w0O7viLJtqmbwhoCdLz/DRLzJYX45T64oBrD5A 0I9lWM47USQMYf0LWwJPrIS3QqhpxDS8YCexvHjycZQTQktW35CT0iwLcFbMHIdw aFEfIWP3LDPJ6R3yogcW2ITuHtBACFjXbYCdCFEfffxsgXPdQ4bxoiwpsSfhVtQm lgGlTPpJBEHxt9kCleFDgmx/9EWZjDO3jGhGk9sT+xcPWueYQGwM1bBpaxM9ovPM yRA14nuHoz2k8Z/5pLUSTJNUS3N7Jt1DzpcY4gGezzsT7OxdAvzZcEW1uFuniHHc SE20m7UwrZENOk0yFGCP2Fti9zHQmXmw/LsnXcSa36dq99kHfUDyGxTJOUOTjAB/ DMseSll2Gl7dqs8WKFKZOwS/JbFjJUejZGk/wfWZOmr7ujW7hrU= =997f -END PGP SIGNATURE End Message ---
Processed: Bug #920597 in docker.io marked as pending
Processing control commands: > tag -1 pending Bug #920597 [docker.io] docker.io: Unable to start daemon: "containerd" executable file not found in PATH Added tag(s) pending. -- 920597: https://bugs.debian.org/cgi-bin/bugreport.cgi?bug=920597 Debian Bug Tracking System Contact ow...@bugs.debian.org with problems
Bug#920597: Bug #920597 in docker.io marked as pending
Control: tag -1 pending Hello, Bug #920597 in docker.io reported by you has been fixed in the Git repository and is awaiting an upload. You can see the commit message below and you can check the diff of the fix at: https://salsa.debian.org/docker-team/docker/commit/0a686b6545a6f17ba7859c8b77b1364f9af1eb33 New patch to fix name of the "containerd" executable (Closes: #920597) (this message was generated automatically) -- Greetings https://bugs.debian.org/920597
Bug#918149: terminator in buster
Hey all, is anyone taking care about the RC bug [2] in terminator[1] for upcoming buster? I plan to do an NMU over the next days, if no one says stop. I've seen that Emilio did some Python 3 work in experimental, is that ready for unstable? What's the upstream work on this? Maybe I'm going to adopt the package as well, since I'm using terminator. Anyone opposes that? Cheers Markus Frosch [1] https://tracker.debian.org/pkg/terminator [2] https://bugs.debian.org/918149 -- mar...@lazyfrosch.de / lazyfro...@debian.org https://lazyfrosch.de signature.asc Description: OpenPGP digital signature
Bug#920609: lynkeos.app: Does not start; assertion failure
Package: lynkeos.app Version: 2.10+dfsg1-3+b2 Severity: grave $ Lynkeos 2019-01-27 14:04:19.881 Lynkeos[10492:10492] styleoffsets ... guessing offsets 2019-01-27 14:04:19.882 Lynkeos[10492:10492] styleoffsets ... guessing offsets 2019-01-27 14:04:20.852 Lynkeos[10492:10492] Selected non-scalable font. 2019-01-27 14:04:20.999 Lynkeos[10492:10492] File NSData.m: 253. In readContentsOfFile Open ((null)) attempt failed - bad path 2019-01-27 14:04:21.000 Lynkeos[10492:10492] Could not convert cursor bitmap data Lynkeos: malloc.c:2385: sysmalloc: Assertion `(old_top == initial_top (av) && old_size == 0) || ((unsigned long) (old_size) >= MINSIZE && prev_inuse (old_top) && ((unsigned long) old_end & (pagesize - 1)) == 0)' failed. Прекъснат (gdb) bt #0 0x7544d85b in __GI_raise (sig=sig@entry=6) at ../sysdeps/unix/sysv/linux/raise.c:50 #1 0x75438535 in __GI_abort () at abort.c:79 #2 0x75495c98 in __malloc_assert (assertion=assertion@entry=0x7559c230 "(old_top == initial_top (av) && old_size == 0) || ((unsigned long) (old_size) >= MINSIZE && prev_inuse (old_top) && ((unsigned long) old_end & (pagesize - 1)) == 0)", file=file@entry=0x755983b0 "malloc.c", line=line@entry=2385, function=function@entry=0x7559c940 <__PRETTY_FUNCTION__.12981> "sysmalloc") at malloc.c:298 #3 0x7549809f in sysmalloc (nb=nb@entry=64, av=av@entry=0x755d1c40 ) at malloc.c:2382 #4 0x754994e9 in _int_malloc (av=av@entry=0x755d1c40 , bytes=bytes@entry=48) at malloc.c:4133 #5 0x7549a603 in __GI___libc_malloc (bytes=48) at malloc.c:3049 #6 0x756033b9 in objc_malloc (size=size@entry=48) at /build/gcc-8-oQsZX8/gcc-8-8.2.0/src/libobjc/memory.c:95 #7 0x7560492f in sarray_lazy_copy (oarr=0x5582a100) at /build/gcc-8-oQsZX8/gcc-8-8.2.0/src/libobjc/sarray.c:489 #8 0x75605c59 in __objc_prepare_dtable_for_class (cls=cls@entry=0x556a5220 <_OBJC_MetaClass_MyImageAnalyzerPrefs>) at /build/gcc-8-oQsZX8/gcc-8-8.2.0/src/libobjc/sendmsg.c:1095 #9 0x75605a88 in __objc_install_dtable_for_class (cls=0x556a5220 <_OBJC_MetaClass_MyImageAnalyzerPrefs>) at /build/gcc-8-oQsZX8/gcc-8-8.2.0/src/libobjc/sendmsg.c:1012 #10 0x75605a88 in __objc_install_dtable_for_class (cls=0x556a5220 <_OBJC_MetaClass_MyImageAnalyzerPrefs>) at /build/gcc-8-oQsZX8/gcc-8-8.2.0/src/libobjc/sendmsg.c:981 #11 0x75606dd4 in get_implementation (sel=, class=, receiver=) at /build/gcc-8-oQsZX8/gcc-8-8.2.0/src/libobjc/sendmsg.c:260 #12 0x75606dd4 in objc_msg_lookup (receiver=receiver@entry=0x556a4fa0 <_OBJC_Class_MyImageAnalyzerPrefs>, op=op@entry=0x556deb90 <_OBJC_SELECTOR_TABLE+1968>) at /build/gcc-8-oQsZX8/gcc-8-8.2.0/src/libobjc/sendmsg.c:450 #13 0x5563391f in -[MyPluginsController(Private) processPreferencesClass:] (self=0x581d2a80, _cmd=, theClass=0x556a4fa0 <_OBJC_Class_MyImageAnalyzerPrefs>) at ./GNUstep/../Sources/MyPluginsController.m:330 #14 0x55633ab8 in -[MyPluginsController(Private) retrieveClasses] (self=0x581d2a80, _cmd=) at ./GNUstep/../Sources/MyPluginsController.m:389 #15 0x55632fba in -[MyPluginsController init] (self=0x581d2a80, _cmd=) at ./GNUstep/../Sources/MyPluginsController.m:542 #16 0x55632c54 in +[MyPluginsController defaultPluginController] (self=0x556df440 <_OBJC_Class_MyPluginsController>, _cmd=0x556f0100 <_OBJC_SELECTOR_TABLE+1664>) at ./GNUstep/../Sources/MyPluginsController.m:521 #17 0x5563c942 in -[MyUserPrefsController toolbarSelectableItemIdentifiers:] (self=, _cmd=, toolbar=) at ./GNUstep/../Sources/MyUserPrefsController.m:99 #18 0x75fb1533 in -[NSToolbar _build] (self=0x581c6c50, _cmd=) at NSToolbar.m:1041 #19 0x5563cfad in -[MyUserPrefsController init] (self=0x581cba40, _cmd=) at ./GNUstep/../Sources/MyUserPrefsController.m:75 #20 0x76021a7d in -[NSCustomObject nibInstantiate] (self=0x57a26a60, _cmd=) at GSNibLoading.m:1009 #21 0x76052bb1 in -[GSXibLoader awake:inContainer:withContext:] (self=, _cmd=, rootObjects=, objects=0x56f963f0, context=) at GSXibLoader.m:957 #22 0x76052578 in -[GSXibLoader loadModelData:externalNameTable:withZone:] (self=0x56046660, _cmd=, data=, context=0x5594e180, zone=) at GSXibLoader.m:1007 #23 0x75e84b87 in +[NSBundle(NSBundleAdditions) loadNibFile:externalNameTable:withZone:] (self=, _cmd=, fileName=0x558a9e30, context=0x5594e180, zone=0x75bfd360 ) at NSBundleAdditions.m:52 #24 0x75e399e7 in NSApplicationMain (argc=, argv=) at Functions.m:83 #25 0x7543a09b in __libc_start_main (main=0x555e9ad0 , argc=1, argv=0x7fffe948, init=, fini=, rtld_fini=, stack_end=0x7fffe938) at ../csu/libc-start.c:308 #26 0x555e9e6a in _start () -- System Information: Debian Release: buster/sid APT prefers unstable-debug APT policy: (500, 'unstable-debug'), (500,
Bug#919973: marked as done (netdata: fails to install: useradd: group netdata exists - if you want to add this user to that group, use -g.)
Your message dated Sun, 27 Jan 2019 12:05:33 + with message-id and subject line Bug#919973: fixed in netdata 1.12.0~rc3-2 has caused the Debian Bug report #919973, regarding netdata: fails to install: useradd: group netdata exists - if you want to add this user to that group, use -g. to be marked as done. This means that you claim that the problem has been dealt with. If this is not the case it is now your responsibility to reopen the Bug report if necessary, and/or fix the problem forthwith. (NB: If you are a system administrator and have no idea what this message is talking about, this may indicate a serious mail system misconfiguration somewhere. Please contact ow...@bugs.debian.org immediately.) -- 919973: https://bugs.debian.org/cgi-bin/bugreport.cgi?bug=919973 Debian Bug Tracking System Contact ow...@bugs.debian.org with problems --- Begin Message --- Package: netdata Version: 1.12.0~rc3-1 Severity: serious User: debian...@lists.debian.org Usertags: piuparts Hi, during a test with piuparts I noticed your package failed to install. As per definition of the release team this makes the package too buggy for a release, thus the severity. >From the attached log (scroll to the bottom...): Selecting previously unselected package netdata. (Reading database ... (Reading database ... 5667 files and directories currently installed.) Preparing to unpack .../netdata_1.12.0~rc3-1_amd64.deb ... Unpacking netdata (1.12.0~rc3-1) ... Setting up netdata (1.12.0~rc3-1) ... useradd: group netdata exists - if you want to add this user to that group, use -g. dpkg: error processing package netdata (--configure): installed netdata package post-installation script subprocess returned error exit status 9 Errors were encountered while processing: netdata cheers, Andreas netdata_1.12.0~rc3-1.log.gz Description: application/gzip --- End Message --- --- Begin Message --- Source: netdata Source-Version: 1.12.0~rc3-2 We believe that the bug you reported is fixed in the latest version of netdata, which is due to be installed in the Debian FTP archive. A summary of the changes between this version and the previous one is attached. Thank you for reporting the bug, which will now be closed. If you have further comments please address them to 919...@bugs.debian.org, and the maintainer will reopen the bug report if appropriate. Debian distribution maintenance software pp. Daniel Baumann (supplier of updated netdata package) (This message was generated automatically at their request; if you believe that there is a problem with it please contact the archive administrators by mailing ftpmas...@ftp-master.debian.org) -BEGIN PGP SIGNED MESSAGE- Hash: SHA512 Format: 1.8 Date: Sun, 27 Jan 2019 12:42:30 +0100 Source: netdata Binary: netdata netdata-data netdata-dbgsym Architecture: source all amd64 Version: 1.12.0~rc3-2 Distribution: experimental Urgency: medium Maintainer: Lennart Weller Changed-By: Daniel Baumann Description: netdata- real-time performance monitoring netdata-data - real-time performance monitoring (data) Closes: 919973 Changes: netdata (1.12.0~rc3-2) experimental; urgency=medium . * Repeating Section for binary packages in control. * Reordering, formating and ordering maintainer scripts to make them more robust (Closes: #919973). * Correcting spelling typo in netdata.conf comments. * Sorting netdata.install file. Checksums-Sha1: fca60efa0678f52345d24243c159162e83bb220f 2080 netdata_1.12.0~rc3-2.dsc 640e3d714fc5b8a711a79e2efbfc3dc855c38bfb 661536 netdata_1.12.0~rc3-2.debian.tar.xz a6a6a936bdde9788f68d961187dc1c6e69de766d 998188 netdata-data_1.12.0~rc3-2_all.deb f6645fd9cf060a10ba6810f537e57686cf2e76a7 1112420 netdata-dbgsym_1.12.0~rc3-2_amd64.deb 8e1c6aa689721f16ab442dbda672c872368140e6 6022 netdata_1.12.0~rc3-2_amd64.buildinfo c99adc8b9c17bdbf298432dec8988a6e7de0a9d6 643672 netdata_1.12.0~rc3-2_amd64.deb Checksums-Sha256: 5a4586541b72873f93873b17ad1e89b5d99b778f576cf4515deb4e9a5b47b0a1 2080 netdata_1.12.0~rc3-2.dsc 0b70a755af73bcdc1cb7aed931b62be1e77347abaca090bf9b8d12cb97a6c8b9 661536 netdata_1.12.0~rc3-2.debian.tar.xz 6f20d8fe95ed9f99ce1ebadff0df96a565b5c0bbdf1b8c2e030cf8a3a194aa4c 998188 netdata-data_1.12.0~rc3-2_all.deb ca3ae3f133a5fac369953fd05ac464c85922e1157d00314e5c8dfce6c3045424 1112420 netdata-dbgsym_1.12.0~rc3-2_amd64.deb 160dc95dcd4689a82bd831ae25b5a4a520d678cee11e781af8405b0f54b4037d 6022 netdata_1.12.0~rc3-2_amd64.buildinfo 405938eb8b52281fe545b1e5bcc21507c4c0d26d9babf03ed4fc93a428fd30d3 643672 netdata_1.12.0~rc3-2_amd64.deb Files: f48e51887945af0195ac1f2508e462c9 2080 net optional netdata_1.12.0~rc3-2.dsc de8b79914fe5e24977b15e7cc0534d9c 661536 net optional netdata_1.12.0~rc3-2.debian.tar.xz b23e5c4b813b2d02cce726dc9d36bdb8 998188 net optional netdata-data_1.12.0~rc3-2_all.deb bd44fddb603af78324cfcb0eb44c61db 1112420 debug optional netdata-dbgsym_1.12.0~rc3-2_amd64.deb
Bug#919973: marked as done (netdata: fails to install: useradd: group netdata exists - if you want to add this user to that group, use -g.)
Your message dated Sun, 27 Jan 2019 12:05:15 + with message-id and subject line Bug#919973: fixed in netdata 1.11.1+dfsg-4 has caused the Debian Bug report #919973, regarding netdata: fails to install: useradd: group netdata exists - if you want to add this user to that group, use -g. to be marked as done. This means that you claim that the problem has been dealt with. If this is not the case it is now your responsibility to reopen the Bug report if necessary, and/or fix the problem forthwith. (NB: If you are a system administrator and have no idea what this message is talking about, this may indicate a serious mail system misconfiguration somewhere. Please contact ow...@bugs.debian.org immediately.) -- 919973: https://bugs.debian.org/cgi-bin/bugreport.cgi?bug=919973 Debian Bug Tracking System Contact ow...@bugs.debian.org with problems --- Begin Message --- Package: netdata Version: 1.12.0~rc3-1 Severity: serious User: debian...@lists.debian.org Usertags: piuparts Hi, during a test with piuparts I noticed your package failed to install. As per definition of the release team this makes the package too buggy for a release, thus the severity. >From the attached log (scroll to the bottom...): Selecting previously unselected package netdata. (Reading database ... (Reading database ... 5667 files and directories currently installed.) Preparing to unpack .../netdata_1.12.0~rc3-1_amd64.deb ... Unpacking netdata (1.12.0~rc3-1) ... Setting up netdata (1.12.0~rc3-1) ... useradd: group netdata exists - if you want to add this user to that group, use -g. dpkg: error processing package netdata (--configure): installed netdata package post-installation script subprocess returned error exit status 9 Errors were encountered while processing: netdata cheers, Andreas netdata_1.12.0~rc3-1.log.gz Description: application/gzip --- End Message --- --- Begin Message --- Source: netdata Source-Version: 1.11.1+dfsg-4 We believe that the bug you reported is fixed in the latest version of netdata, which is due to be installed in the Debian FTP archive. A summary of the changes between this version and the previous one is attached. Thank you for reporting the bug, which will now be closed. If you have further comments please address them to 919...@bugs.debian.org, and the maintainer will reopen the bug report if appropriate. Debian distribution maintenance software pp. Daniel Baumann (supplier of updated netdata package) (This message was generated automatically at their request; if you believe that there is a problem with it please contact the archive administrators by mailing ftpmas...@ftp-master.debian.org) -BEGIN PGP SIGNED MESSAGE- Hash: SHA512 Format: 1.8 Date: Sun, 27 Jan 2019 12:42:01 +0100 Source: netdata Binary: netdata netdata-data netdata-dbgsym Architecture: source all amd64 Version: 1.11.1+dfsg-4 Distribution: unstable Urgency: medium Maintainer: Lennart Weller Changed-By: Daniel Baumann Description: netdata- real-time performance monitoring netdata-data - real-time performance monitoring (data) Closes: 919973 Changes: netdata (1.11.1+dfsg-4) unstable; urgency=medium . * Repeating Section for binary packages in control. * Reordering, formating and ordering maintainer scripts to make them more robust (Closes: #919973). * Correcting spelling typo in netdata.conf comments. * Sorting netdata.install file. Checksums-Sha1: c187b100599e407b32e77069ab98fe4f544d91cb 2087 netdata_1.11.1+dfsg-4.dsc a0807d65749c0895b27fe5605976ac97815d9bce 661704 netdata_1.11.1+dfsg-4.debian.tar.xz 6178df481e1dfce551ff53cb8e0fbdfa7d942e2f 1045940 netdata-data_1.11.1+dfsg-4_all.deb 16a5905894e4b4cd448166aeadc9a562c161c805 1081876 netdata-dbgsym_1.11.1+dfsg-4_amd64.deb 5b04161ec823cba95d94fb5b259326622953bb96 6038 netdata_1.11.1+dfsg-4_amd64.buildinfo d37ceb092be7aeb78076e485cde090f95302fa30 613588 netdata_1.11.1+dfsg-4_amd64.deb Checksums-Sha256: 204b8d29199c55ebd3a571c4035d6a818fe3e19d26151711e609d23809ac3959 2087 netdata_1.11.1+dfsg-4.dsc f9d65e34c8468c751dc36b49da891aebc5ecd7217c7b380316a376c557b621d6 661704 netdata_1.11.1+dfsg-4.debian.tar.xz 7fb4e2127887b600b9d60a28bfee8f4b957fdf74c6edabd2bb8d9635abb7185e 1045940 netdata-data_1.11.1+dfsg-4_all.deb ca17c466633b85044b7533ecb3a30ff1b6dff2e04fa391f24e026df0d3812272 1081876 netdata-dbgsym_1.11.1+dfsg-4_amd64.deb f566de2c2be087a2b09c817e17e120251bcf1044db5706b70aa381ee08595544 6038 netdata_1.11.1+dfsg-4_amd64.buildinfo 55a7706e0269aa6564d9807a266855b550a0ec5f98de635a1c5694a2b919ee2b 613588 netdata_1.11.1+dfsg-4_amd64.deb Files: 379d2219dea60adae1698108d2446fa5 2087 net optional netdata_1.11.1+dfsg-4.dsc dc57926413029e00ce354a9b078f9735 661704 net optional netdata_1.11.1+dfsg-4.debian.tar.xz 427e2f2ab22bf71bd54f8d5926cb8064 1045940 net optional netdata-data_1.11.1+dfsg-4_all.deb 0d421643327d69433fd3b6015fb88cb8 1081876 debug optional netdata-dbgsym_1.11.1+dfsg-4_amd64.deb
Bug#919776: marked as done (mariadb-10.1 FTBFS on most architectures, testsuite failures.)
Your message dated Sun, 27 Jan 2019 11:36:56 + with message-id and subject line Bug#920581: Removed package(s) from unstable has caused the Debian Bug report #919776, regarding mariadb-10.1 FTBFS on most architectures, testsuite failures. to be marked as done. This means that you claim that the problem has been dealt with. If this is not the case it is now your responsibility to reopen the Bug report if necessary, and/or fix the problem forthwith. (NB: If you are a system administrator and have no idea what this message is talking about, this may indicate a serious mail system misconfiguration somewhere. Please contact ow...@bugs.debian.org immediately.) -- 919776: https://bugs.debian.org/cgi-bin/bugreport.cgi?bug=919776 Debian Bug Tracking System Contact ow...@bugs.debian.org with problems --- Begin Message --- Package: mariadb-10.1 Version: 1:10.1.37-3 Severity: serious During rebuilds for the jemalloc transition mariadb-10.1 failed to build on most architectures with the following error on most architectures (). Completed: Failed 2/4906 tests, 99.96% were successful. Failing test(s): main.mysqldump The log files in var/log may give you some hint of what went wrong. If you want to report this error, please read first the documentation athttp://dev.mysql.com/doc/mysql/en/mysql-test-suite.html 678 tests were skipped, 302 by the test itself. mysql-test-run: *** ERROR: there were failing test cases --- End Message --- --- Begin Message --- Version: 1:10.1.37-3+rm Dear submitter, as the package mariadb-10.1 has just been removed from the Debian archive unstable we hereby close the associated bug reports. We are sorry that we couldn't deal with your issue properly. For details on the removal, please see https://bugs.debian.org/920581 The version of this package that was in Debian prior to this removal can still be found using http://snapshot.debian.org/. This message was generated automatically; if you believe that there is a problem with it please contact the archive administrators by mailing ftpmas...@ftp-master.debian.org. Debian distribution maintenance software pp. Scott Kitterman (the ftpmaster behind the curtain)--- End Message ---
Bug#920380: marked as done (mariadb-10.1: do not release with buster)
Your message dated Sun, 27 Jan 2019 11:36:56 + with message-id and subject line Bug#920581: Removed package(s) from unstable has caused the Debian Bug report #920380, regarding mariadb-10.1: do not release with buster to be marked as done. This means that you claim that the problem has been dealt with. If this is not the case it is now your responsibility to reopen the Bug report if necessary, and/or fix the problem forthwith. (NB: If you are a system administrator and have no idea what this message is talking about, this may indicate a serious mail system misconfiguration somewhere. Please contact ow...@bugs.debian.org immediately.) -- 920380: https://bugs.debian.org/cgi-bin/bugreport.cgi?bug=920380 Debian Bug Tracking System Contact ow...@bugs.debian.org with problems --- Begin Message --- Source: mariadb-10.1 Version: 1:10.1.37-3 Severity: serious Tags: sid buster buster should only ship one mariadb version, and as it looks, that will be 10.3 Andreas --- End Message --- --- Begin Message --- Version: 1:10.1.37-3+rm Dear submitter, as the package mariadb-10.1 has just been removed from the Debian archive unstable we hereby close the associated bug reports. We are sorry that we couldn't deal with your issue properly. For details on the removal, please see https://bugs.debian.org/920581 The version of this package that was in Debian prior to this removal can still be found using http://snapshot.debian.org/. This message was generated automatically; if you believe that there is a problem with it please contact the archive administrators by mailing ftpmas...@ftp-master.debian.org. Debian distribution maintenance software pp. Scott Kitterman (the ftpmaster behind the curtain)--- End Message ---
Bug#912848: marked as done (mariadb-10.1: CVE-2018-3282 CVE-2018-3174 CVE-2018-3143 CVE-2018-3156 CVE-2018-3251)
Your message dated Sun, 27 Jan 2019 11:36:56 + with message-id and subject line Bug#920581: Removed package(s) from unstable has caused the Debian Bug report #912848, regarding mariadb-10.1: CVE-2018-3282 CVE-2018-3174 CVE-2018-3143 CVE-2018-3156 CVE-2018-3251 to be marked as done. This means that you claim that the problem has been dealt with. If this is not the case it is now your responsibility to reopen the Bug report if necessary, and/or fix the problem forthwith. (NB: If you are a system administrator and have no idea what this message is talking about, this may indicate a serious mail system misconfiguration somewhere. Please contact ow...@bugs.debian.org immediately.) -- 912848: https://bugs.debian.org/cgi-bin/bugreport.cgi?bug=912848 Debian Bug Tracking System Contact ow...@bugs.debian.org with problems --- Begin Message --- Source: mariadb-10.1 Version: 10.1.20-1 Severity: grave Tags: security upstream >From https://mariadb.com/kb/en/library/mariadb-10137-release-notes/ and fixed in 10.1.37: Fixes for the following security vulnerabilities: CVE-2018-3282 CVE-2016-9843 CVE-2018-3174 CVE-2018-3143 CVE-2018-3156 CVE-2018-3251 (although the CVE-2016-9843 is for zlib, so not tracked here). Regards, Salvatore --- End Message --- --- Begin Message --- Version: 1:10.1.37-3+rm Dear submitter, as the package mariadb-10.1 has just been removed from the Debian archive unstable we hereby close the associated bug reports. We are sorry that we couldn't deal with your issue properly. For details on the removal, please see https://bugs.debian.org/920581 The version of this package that was in Debian prior to this removal can still be found using http://snapshot.debian.org/. This message was generated automatically; if you believe that there is a problem with it please contact the archive administrators by mailing ftpmas...@ftp-master.debian.org. Debian distribution maintenance software pp. Scott Kitterman (the ftpmaster behind the curtain)--- End Message ---
Bug#917382: marked as done (Should stunserver be removed?)
Your message dated Sun, 27 Jan 2019 11:25:48 + with message-id and subject line Bug#920570: Removed package(s) from unstable has caused the Debian Bug report #917382, regarding Should stunserver be removed? to be marked as done. This means that you claim that the problem has been dealt with. If this is not the case it is now your responsibility to reopen the Bug report if necessary, and/or fix the problem forthwith. (NB: If you are a system administrator and have no idea what this message is talking about, this may indicate a serious mail system misconfiguration somewhere. Please contact ow...@bugs.debian.org immediately.) -- 917382: https://bugs.debian.org/cgi-bin/bugreport.cgi?bug=917382 Debian Bug Tracking System Contact ow...@bugs.debian.org with problems --- Begin Message --- Source: stunserver Severity: serious Should stunserver be removed from the archive? - It's unmaintained (last maintainer upload in 2015) - Dropped from testing over a year ago - Marginal popcon - RC-buggy (one of the handful of remaining packages blocking the removal of OpenSSL 1.0) Cheers, Moritz --- End Message --- --- Begin Message --- Version: 1.2.7-1.1+rm Dear submitter, as the package stunserver has just been removed from the Debian archive unstable we hereby close the associated bug reports. We are sorry that we couldn't deal with your issue properly. For details on the removal, please see https://bugs.debian.org/920570 The version of this package that was in Debian prior to this removal can still be found using http://snapshot.debian.org/. This message was generated automatically; if you believe that there is a problem with it please contact the archive administrators by mailing ftpmas...@ftp-master.debian.org. Debian distribution maintenance software pp. Scott Kitterman (the ftpmaster behind the curtain)--- End Message ---
Bug#859721: marked as done (stunserver: Please migrate to openssl1.1 in Buster)
Your message dated Sun, 27 Jan 2019 11:25:48 + with message-id and subject line Bug#920570: Removed package(s) from unstable has caused the Debian Bug report #859721, regarding stunserver: Please migrate to openssl1.1 in Buster to be marked as done. This means that you claim that the problem has been dealt with. If this is not the case it is now your responsibility to reopen the Bug report if necessary, and/or fix the problem forthwith. (NB: If you are a system administrator and have no idea what this message is talking about, this may indicate a serious mail system misconfiguration somewhere. Please contact ow...@bugs.debian.org immediately.) -- 859721: https://bugs.debian.org/cgi-bin/bugreport.cgi?bug=859721 Debian Bug Tracking System Contact ow...@bugs.debian.org with problems --- Begin Message --- Package: stunserver Version: 1.2.7-1.1 Severity: important Tags: sid buster User: pkg-openssl-de...@lists.alioth.debian.org Usertags: openssl-1.1-trans Please migrate to libssl-dev in the Buster cycle. The bug report about the FTBFS is #828563. The log of the FTBFS can be found at https://breakpoint.cc/openssl-1.1-rebuild-2016-05-29/Attempted/stunserver_1.2.7-1_amd64-20160529-1540 Sebastian --- End Message --- --- Begin Message --- Version: 1.2.7-1.1+rm Dear submitter, as the package stunserver has just been removed from the Debian archive unstable we hereby close the associated bug reports. We are sorry that we couldn't deal with your issue properly. For details on the removal, please see https://bugs.debian.org/920570 The version of this package that was in Debian prior to this removal can still be found using http://snapshot.debian.org/. This message was generated automatically; if you believe that there is a problem with it please contact the archive administrators by mailing ftpmas...@ftp-master.debian.org. Debian distribution maintenance software pp. Scott Kitterman (the ftpmaster behind the curtain)--- End Message ---
Bug#893830: marked as done (sqwebmail cgi can't access sqwebmail.sock)
Your message dated Sun, 27 Jan 2019 11:19:55 + with message-id and subject line Bug#893830: fixed in courier 1.0.5-2 has caused the Debian Bug report #893830, regarding sqwebmail cgi can't access sqwebmail.sock to be marked as done. This means that you claim that the problem has been dealt with. If this is not the case it is now your responsibility to reopen the Bug report if necessary, and/or fix the problem forthwith. (NB: If you are a system administrator and have no idea what this message is talking about, this may indicate a serious mail system misconfiguration somewhere. Please contact ow...@bugs.debian.org immediately.) -- 893830: https://bugs.debian.org/cgi-bin/bugreport.cgi?bug=893830 Debian Bug Tracking System Contact ow...@bugs.debian.org with problems --- Begin Message --- Package: sqwebmail Version: 5.8.3+0.76.3-5 Severity: grave Justification: renders package unusable Dear Maintainer, Upon upgrading from devuan jessie to devuan Ascii (based on debian stretch), I found that accessing the sqwebmail CGI resulted in a page which displayed a system unavailable message. It turns out the problem was that the sqwebmail CGI couldn't access the unix domain sqwebmail.sock socket. This is because the permissions on /var/lib/courier are 750 by default. Changing the permissions on /var/lib/courier to 755 resolves this issue. -- System Information: Debian Release: 9 Architecture: amd64 (x86_64) Kernel: Linux 4.9.0-5-amd64 (SMP w/1 CPU core) Locale: LANG=en_US.UTF-8, LC_CTYPE=en_US.UTF-8 (charmap=UTF-8) Shell: /bin/sh linked to /bin/dash Init: sysvinit (via /sbin/init) Versions of packages sqwebmail depends on: ii apache2 [httpd-cgi] 2.4.25-3+deb9u3 ii courier-authlib 0.66.4-9 ii courier-base0.76.3-5 ii cron3.0pl1-128+deb9u1 ii debconf [debconf-2.0] 1.5.61 ii expect 5.45-7+deb9u1 ii iamerican [ispell-dictionary] 3.4.00-5 ii ibritish [ispell-dictionary]3.4.00-5 ii init-system-helpers 1.48+devuan2.0 ii ispell 3.4.00-5 ii libc6 2.24-11+deb9u3 ii libcourier-unicode1 1.4-3+b1 ii libfam0 2.7.0-17.2+b1 ii libgdbm31.8.3-14 ii libidn111.33-1 ii libldap-2.4-2 2.4.44+dfsg-5+deb9u1 ii libpcre32:8.39-3 ii maildrop2.8.4-2 ii postfix [mail-transport-agent] 3.1.8-0+deb9u1 ii sysvinit-utils 2.88dsf-59.9+devuan2 Versions of packages sqwebmail recommends: pn courier-pcp Versions of packages sqwebmail suggests: ii courier-doc 0.76.3-5 ii gnupg2.1.18-8~deb9u1 -- debconf information: * sqwebmail/calendarmode: local sqwebmail/install-www-backup: symlink sqwebmail/dictionary: default * sqwebmail/install-www: symlink --- End Message --- --- Begin Message --- Source: courier Source-Version: 1.0.5-2 We believe that the bug you reported is fixed in the latest version of courier, which is due to be installed in the Debian FTP archive. A summary of the changes between this version and the previous one is attached. Thank you for reporting the bug, which will now be closed. If you have further comments please address them to 893...@bugs.debian.org, and the maintainer will reopen the bug report if appropriate. Debian distribution maintenance software pp. Markus Wanner (supplier of updated courier package) (This message was generated automatically at their request; if you believe that there is a problem with it please contact the archive administrators by mailing ftpmas...@ftp-master.debian.org) -BEGIN PGP SIGNED MESSAGE- Hash: SHA512 Format: 1.8 Date: Sun, 27 Jan 2019 11:39:29 +0100 Source: courier Binary: courier-base courier-base-dbgsym courier-doc courier-faxmail courier-imap courier-imap-dbgsym courier-ldap courier-ldap-dbgsym courier-mlm courier-mlm-dbgsym courier-mta courier-mta-dbgsym courier-pcp courier-pcp-dbgsym courier-pop courier-pop-dbgsym courier-webadmin courier-webadmin-dbgsym sqwebmail sqwebmail-dbgsym Architecture: source amd64 all Version: 1.0.5-2 Distribution: unstable Urgency: medium Maintainer: Markus Wanner Changed-By: Markus Wanner Description: courier-base - Courier mail server - base system courier-doc - Courier mail server - additional documentation courier-faxmail - Courier mail server - Fax<->mail gateway courier-imap - Courier mail server - IMAP server courier-ldap - Courier mail server - LDAP support courier-mlm - Courier mail server - mailing list manager courier-mta - Courier mail server - ESMTP daemon courier-pcp - Courier mail server - PCP server courier-pop - Courier mail server - POP3 server courier-webadmin - Courier mail server - web-based administration frontend sqwebmail - Courier mail server - webmail server Closes: 863941 883647 885186 893830 919840 Changes:
Bug#919840: marked as done (sqwebmail: leaves broken symlink after purge: /etc/apache2/conf-available/sqwebmail.conf -> ../../sqwebmail/apache24.conf)
Your message dated Sun, 27 Jan 2019 11:19:55 +
with message-id
and subject line Bug#919840: fixed in courier 1.0.5-2
has caused the Debian Bug report #919840,
regarding sqwebmail: leaves broken symlink after purge:
/etc/apache2/conf-available/sqwebmail.conf -> ../../sqwebmail/apache24.conf
to be marked as done.
This means that you claim that the problem has been dealt with.
If this is not the case it is now your responsibility to reopen the
Bug report if necessary, and/or fix the problem forthwith.
(NB: If you are a system administrator and have no idea what this
message is talking about, this may indicate a serious mail system
misconfiguration somewhere. Please contact ow...@bugs.debian.org
immediately.)
--
919840: https://bugs.debian.org/cgi-bin/bugreport.cgi?bug=919840
Debian Bug Tracking System
Contact ow...@bugs.debian.org with problems
--- Begin Message ---
Package: sqwebmail
Version: 6.0.0+1.0.5-1
Severity: serious
User: debian...@lists.debian.org
Usertags: piuparts
Hi,
during a test with piuparts I noticed your package ships (or creates)
a broken symlink.
>From the attached log (scroll to the bottom...):
0m54.4s ERROR: FAIL: Broken symlinks:
/etc/apache2/conf-available/sqwebmail.conf -> ../../sqwebmail/apache24.conf
cheers,
Andreas
sqwebmail_6.0.0+1.0.5-1.log.gz
Description: application/gzip
--- End Message ---
--- Begin Message ---
Source: courier
Source-Version: 1.0.5-2
We believe that the bug you reported is fixed in the latest version of
courier, which is due to be installed in the Debian FTP archive.
A summary of the changes between this version and the previous one is
attached.
Thank you for reporting the bug, which will now be closed. If you
have further comments please address them to 919...@bugs.debian.org,
and the maintainer will reopen the bug report if appropriate.
Debian distribution maintenance software
pp.
Markus Wanner (supplier of updated courier package)
(This message was generated automatically at their request; if you
believe that there is a problem with it please contact the archive
administrators by mailing ftpmas...@ftp-master.debian.org)
-BEGIN PGP SIGNED MESSAGE-
Hash: SHA512
Format: 1.8
Date: Sun, 27 Jan 2019 11:39:29 +0100
Source: courier
Binary: courier-base courier-base-dbgsym courier-doc courier-faxmail
courier-imap courier-imap-dbgsym courier-ldap courier-ldap-dbgsym courier-mlm
courier-mlm-dbgsym courier-mta courier-mta-dbgsym courier-pcp
courier-pcp-dbgsym courier-pop courier-pop-dbgsym courier-webadmin
courier-webadmin-dbgsym sqwebmail sqwebmail-dbgsym
Architecture: source amd64 all
Version: 1.0.5-2
Distribution: unstable
Urgency: medium
Maintainer: Markus Wanner
Changed-By: Markus Wanner
Description:
courier-base - Courier mail server - base system
courier-doc - Courier mail server - additional documentation
courier-faxmail - Courier mail server - Fax<->mail gateway
courier-imap - Courier mail server - IMAP server
courier-ldap - Courier mail server - LDAP support
courier-mlm - Courier mail server - mailing list manager
courier-mta - Courier mail server - ESMTP daemon
courier-pcp - Courier mail server - PCP server
courier-pop - Courier mail server - POP3 server
courier-webadmin - Courier mail server - web-based administration frontend
sqwebmail - Courier mail server - webmail server
Closes: 863941 883647 885186 893830 919840
Changes:
courier (1.0.5-2) unstable; urgency=medium
.
[ Alban Vidal ]
* Updated French po-debconf translation. Closes: #863941.
.
[ Viktor Szépe ]
* Fix lintian "script-not-executable".
.
[ Markus Wanner ]
* Add an apache_unlink step to the postrm of sqwebmail.
Closes: #919840.
* Move the statoverrides for /etc/courier/imapaccess from
courier-base to courier-imap.
* Remove the statoverrides for /var/lib/courier/{tmp,msgq,msgs}
from courier-base, courier-mta properly covers these.
* Add patch 0025-Move-sqwebmail.sock.patch to move the sqwebmail
socket file to /var/run/courier. Closes: #893830.
* Update German and Russion po-debconf translations.
Closes: #885186, #883647.
Checksums-Sha1:
1439f228f8508b6b1280c3bdd4b7a05e752563ec 2257 courier_1.0.5-2.dsc
b07fa8cb4ab393bf83a87c9797253605dfeb2e6c 10335137 courier_1.0.5.orig.tar.gz
26267ba78baf033db3824e4f6e0e7f951acdd1a8 93440 courier_1.0.5-2.debian.tar.xz
0be6156cad2a4488b18a48336d52ad41eb534157 523216
courier-base-dbgsym_1.0.5-2_amd64.deb
0e33a95c3b72e3b8b4d91193246ebe07197cdc4b 286448 courier-base_1.0.5-2_amd64.deb
7fd380e4c8d3494e442d4f9f7dd10f5927349203 383580 courier-doc_1.0.5-2_all.deb
c101953bc91ce6ca9c6e5f8ea2a6076769e3ae1c 109180
courier-faxmail_1.0.5-2_amd64.deb
75ad9af65d795b0cbd547839c75687ca10515573 554080
courier-imap-dbgsym_5.0.5+1.0.5-2_amd64.deb
50a8ca08873cafbbf5a824f4c877082540d2e833 248728
courier-imap_5.0.5+1.0.5-2_amd64.deb
beff78d7ee9d84b1786f635379c1f597c6417e08 34676
courier-ldap-dbgsym_1.0.5-2_amd64.deb
Bug#920606: transifex-client: Depends: python3-six (= 1.11.0) but 1.12.0-1 is to be installed
Package: transifex-client Version: 0.13.5-1 Severity: serious The following packages have unmet dependencies: transifex-client : Depends: python3-six (= 1.11.0) but 1.12.0-1 is to be installed
Bug#919406: marked as done (kdiff3 FTBFS: missing -latomic)
Your message dated Sun, 27 Jan 2019 11:54:26 +0100 with message-id <53401610.30EAEqkozB@track> and subject line Re: Bug#919406: kdiff3 FTBFS: missing -latomic has caused the Debian Bug report #919406, regarding kdiff3 FTBFS: missing -latomic to be marked as done. This means that you claim that the problem has been dealt with. If this is not the case it is now your responsibility to reopen the Bug report if necessary, and/or fix the problem forthwith. (NB: If you are a system administrator and have no idea what this message is talking about, this may indicate a serious mail system misconfiguration somewhere. Please contact ow...@bugs.debian.org immediately.) -- 919406: https://bugs.debian.org/cgi-bin/bugreport.cgi?bug=919406 Debian Bug Tracking System Contact ow...@bugs.debian.org with problems --- Begin Message --- Source: kdiff3 Version: 1.7.90-1 Severity: serious Tags: ftbfs User: helm...@debian.org Usertags: rebootstrap While conducting cross build tests, I found that kdiff3 fails to build from source natively on armel, mips and mipsel due to missing symbols that are present in -latomic, e.g.: | cd /<>/obj-mipsel-linux-gnu/src && /usr/bin/cmake -E cmake_link_script CMakeFiles/kdiff3.dir/link.txt --verbose=1 | /usr/bin/mipsel-linux-gnu-g++ -g -O2 -fdebug-prefix-map=/<>=. -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -std=c++0x -fno-operator-names -fno-exceptions -Wall -Wextra -Wcast-align -Wchar-subscripts -Wformat-security -Wno-long-long -Wpointer-arith -Wundef -Wnon-virtual-dtor -Woverloaded-virtual -Werror=return-type -Wvla -Wdate-time -Wall -Wduplicated-cond -Wduplicated-branches -Wshadow -Wl,--enable-new-dtags -Wl,-z,relro -Wl,--as-needed -rdynamic CMakeFiles/kdiff3.dir/main.cpp.o CMakeFiles/kdiff3.dir/kdiff3_shell.cpp.o CMakeFiles/kdiff3.dir/kdiff3_part.cpp.o CMakeFiles/kdiff3.dir/kdiff3.cpp.o CMakeFiles/kdiff3.dir/directorymergewindow.cpp.o CMakeFiles/kdiff3.dir/merger.cpp.o CMakeFiles/kdiff3.dir/pdiff.cpp.o CMakeFiles/kdiff3.dir/difftextwindow.cpp.o CMakeFiles/kdiff3.dir/diff.cpp.o CMakeFiles/kdiff3.dir/optiondialog.cpp.o CMakeFiles/kdiff3.dir/mergeresultwindow.cpp.o CMakeFiles/kdiff3.dir/fileaccess.cpp.o CMakeFiles/kdiff3.dir/gnudiff_analyze.cpp.o CMakeFiles/kdiff3.dir/gnudiff_io.cpp.o CMakeFiles/kdiff3.dir/gnudiff_xmalloc.cpp.o CMakeFiles/kdiff3.dir/common.cpp.o CMakeFiles/kdiff3.dir/smalldialogs.cpp.o CMakeFiles/kdiff3.dir/progress.cpp.o CMakeFiles/kdiff3.dir/ProgressProxyExtender.cpp.o CMakeFiles/kdiff3.dir/PixMapUtils.cpp.o CMakeFiles/kdiff3.dir/MergeFileInfos.cpp.o CMakeFiles/kdiff3.dir/Utils.cpp.o CMakeFiles/kdiff3.dir/selection.cpp.o CMakeFiles/kdiff3.dir/cvsignorelist.cpp.o CMakeFiles/kdiff3.dir/kdiff3_autogen/mocs_compilation.cpp.o -o kdiff3 /usr/lib/mipsel-linux-gnu/libKF5Parts.so.5.51.0 /usr/lib/mipsel-linux-gnu/libKF5KIOWidgets.so.5.51.0 /usr/lib/mipsel-linux-gnu/libKF5KIOCore.so.5.51.0 /usr/lib/mipsel-linux-gnu/libKF5Crash.so.5.51.0 /usr/lib/mipsel-linux-gnu/libKF5JobWidgets.so.5.51.0 /usr/lib/mipsel-linux-gnu/libQt5Concurrent.so.5.11.3 /usr/lib/mipsel-linux-gnu/libKF5XmlGui.so.5.51.0 /usr/lib/mipsel-linux-gnu/libQt5PrintSupport.so.5.11.3 /usr/lib/mipsel-linux-gnu/libQt5Network.so.5.11.3 /usr/lib/mipsel-linux-gnu/libKF5TextWidgets.so.5.51.0 /usr/lib/mipsel-linux-gnu/libKF5IconThemes.so.5.51.0 /usr/lib/mipsel-linux-gnu/libKF5Service.so.5.51.0 /usr/lib/mipsel-linux-gnu/libKF5Completion.so.5.51.0 /usr/lib/mipsel-linux-gnu/libKF5ConfigWidgets.so.5.51.0 /usr/lib/mipsel-linux-gnu/libKF5ConfigGui.so.5.51.0 /usr/lib/mipsel-linux-gnu/libKF5ConfigCore.so.5.51.0 /usr/lib/mipsel-linux-gnu/libQt5Xml.so.5.11.3 /usr/lib/mipsel-linux-gnu/libKF5I18n.so.5.51.0 /usr/lib/mipsel-linux-gnu/libKF5WidgetsAddons.so.5.51.0 /usr/lib/mipsel-linux-gnu/libKF5Codecs.so.5.51.0 /usr/lib/mipsel-linux-gnu/libKF5Auth.so.5.51.0 /usr/lib/mipsel-linux-gnu/libKF5CoreAddons.so.5.51.0 /usr/lib/mipsel-linux-gnu/libQt5DBus.so.5.11.3 /usr/lib/mipsel-linux-gnu/libKF5SonnetUi.so.5.51.0 /usr/lib/mipsel-linux-gnu/libQt5Widgets.so.5.11.3 /usr/lib/mipsel-linux-gnu/libQt5Gui.so.5.11.3 /usr/lib/mipsel-linux-gnu/libQt5Core.so.5.11.3 | /usr/lib/gcc-cross/mipsel-linux-gnu/8/../../../../mipsel-linux-gnu/bin/ld: CMakeFiles/kdiff3.dir/progress.cpp.o: undefined reference to symbol '__atomic_load_8@@LIBATOMIC_1.0' | /usr/lib/gcc-cross/mipsel-linux-gnu/8/../../../../mipsel-linux-gnu/bin/ld: //usr/lib/mipsel-linux-gnu/libatomic.so.1: error adding symbols: DSO missing from command line | collect2: error: ld returned 1 exit status | make[3]: *** [src/CMakeFiles/kdiff3.dir/build.make:447: src/kdiff3] Error 1 | make[3]: Leaving directory '/<>/obj-mipsel-linux-gnu' | make[2]: *** [CMakeFiles/Makefile2:309: src/CMakeFiles/kdiff3.dir/all] Error 2 | make[2]: Leaving directory '/<>/obj-mipsel-linux-gnu' | make[1]: *** [Makefile:144: all] Error 2 | make[1]: Leaving directory '/<>/obj-mipsel-linux-gnu' | make: ***
Bug#920605: fortunate.app: Does not start: Bad application class '(null)' specified
Package: fortunate.app Version: 3.1-2 Severity: grave $ Fortunate 2019-01-27 12:44:44.637 Fortunate[7927:7927] Bad application class '(null)' specified And the reason is: $ ls -la /usr/lib/GNUstep/Applications/Fortunate.app/Resources/ общо 8 drwxr-xr-x 2 root root 4096 яну 17 11:47 . drwxr-xr-x 3 root root 4096 яну 17 11:47 .. -- System Information: Debian Release: buster/sid APT prefers unstable-debug APT policy: (500, 'unstable-debug'), (500, 'testing-debug'), (500, 'unstable'), (500, 'testing') Architecture: amd64 (x86_64) Foreign Architectures: i386 Kernel: Linux 4.19.0-2-amd64 (SMP w/2 CPU cores) Locale: LANG=bg_BG.UTF-8, LC_CTYPE=bg_BG.UTF-8 (charmap=UTF-8), LANGUAGE=bg_BG.UTF-8 (charmap=UTF-8) Shell: /bin/sh linked to /bin/dash Init: systemd (via /run/systemd/system) LSM: AppArmor: enabled Versions of packages fortunate.app depends on: ii fortune-mod 1:1.99.1-7+b1 ii gnustep-back0.27 0.27.0-2 ii gnustep-base-runtime 1.26.0-3 ii gnustep-gui-runtime 0.27.0-3 ii libc6 2.28-5 ii libgcc1 1:8.2.0-15 ii libgnustep-base1.26 1.26.0-3 ii libgnustep-gui0.270.27.0-3 ii libobjc4 8.2.0-15 fortunate.app recommends no packages. fortunate.app suggests no packages. -- no debconf information
Bug#920604: mongo-tools FTBFS with Go 1.11
Source: mongo-tools Version: 3.4.14-3 Severity: serious Tags: ftbfs https://buildd.debian.org/status/package.php?p=mongo-tools=sid ... # _/<>/mongorestore ./filepath.go:357: Logvf call has arguments but no formatting directives FAIL_/<>/mongorestore [build failed] make[1]: *** [debian/rules:52: override_dh_auto_test] Error 2
Bug#920597: Last docker.io update - not start
On Sunday, 27 January 2019 7:21:26 PM AEDT Holger Schröder wrote: > The last docker.io update (18.09.1+dfsg1-2) docker no longer starts. The > output of 'systemctl start docker.service' see attached logfile Thanks for letting me know but next time please report a bug [1] so others will be aware of the problem and the progress. If I could not respond then others might be able to but only if there is bug report visible by everyone. [1]: https://www.debian.org/Bugs/Reporting As a temporary workaround please use the following command: sudo ln -sv /usr/bin/docker-containerd /usr/local/bin/containerd -- Regards, Dmitry Smirnov. --- Continuous effort - not strength or intelligence - is the key to unlocking our potential. -- Winston Churchill signature.asc Description: This is a digitally signed message part.
Bug#920597: docker.io: Unable to start daemon: "containerd" executable file not found in PATH
Package: docker.io Version: 18.09.1+dfsg1-2 Severity: serious X-Debbugs-CC: arnaud.rebill...@collabora.com Docker daemon is unable to start: Failed to start containerd: exec: "containerd": executable file not found in $PATH signature.asc Description: This is a digitally signed message part.
Bug#919583: ebtables: broken symlinks: /sbin/ebtables{,-restore,-save} -> /usr/sbin/ebtables{,-restore,-save}
Le 27/01/19 à 09:54, Laurent Bigonville a écrit :
On Thu, 17 Jan 2019 15:35:54 +0100 Andreas Beckmann
wrote:
>
> Hi,
Hello
>
> 0m33.7s ERROR: FAIL: Broken symlinks:
> /sbin/ebtables-restore -> /usr/sbin/ebtables-restore
> /sbin/ebtables-save -> /usr/sbin/ebtables-save
> /sbin/ebtables -> /usr/sbin/ebtables
I can confirm this.
These symlinks are created by the postinst script of ebtables but are
not properly removed by the pre/postrm one.
The prerm script is doing the following:
if [ "$1" = "remove" ] ; then
iptables_version=$(dpkg-query -W -f='${Version;3}\n' iptables)
if [[ "$iptables_version" < 1.8 ]]; then
LIST="/sbin/ebtables /sbin/ebtables-save /sbin/ebtables-restore"
for i in $LIST ; do
if [ -L "$i" ] ; then
rm $i
fi
done
fi
fi
First remark, shouldn't dpkg --compare-versions be used instead of
just the < sign?
Then, these symlinks must also be created/removed in the iptables
package itself for this to work, this is not the case ATM. Otherwise,
if ebtables is removed and then iptables package is removed, the
symlinks will stay on the filesystem forever.
An other solution is to remove this version check and just remove
unconditionally these symlinks in /sbin as they are not created by any
other packages (including iptables)
Bug#919583: ebtables: broken symlinks: /sbin/ebtables{,-restore,-save} -> /usr/sbin/ebtables{,-restore,-save}
On Thu, 17 Jan 2019 15:35:54 +0100 Andreas Beckmann wrote:
>
> Hi,
Hello
>
> 0m33.7s ERROR: FAIL: Broken symlinks:
> /sbin/ebtables-restore -> /usr/sbin/ebtables-restore
> /sbin/ebtables-save -> /usr/sbin/ebtables-save
> /sbin/ebtables -> /usr/sbin/ebtables
I can confirm this.
These symlinks are created by the postinst script of ebtables but are
not properly removed by the pre/postrm one.
The prerm script is doing the following:
if [ "$1" = "remove" ] ; then
iptables_version=$(dpkg-query -W -f='${Version;3}\n' iptables)
if [[ "$iptables_version" < 1.8 ]]; then
LIST="/sbin/ebtables /sbin/ebtables-save /sbin/ebtables-restore"
for i in $LIST ; do
if [ -L "$i" ] ; then
rm $i
fi
done
fi
fi
First remark, shouldn't dpkg --compare-versions be used instead of just
the < sign?
Then, these symlinks must also be created/removed in the iptables
package itself for this to work, this is not the case ATM. Otherwise, if
ebtables is removed and then iptables package is removed, the symlinks
will stay on the filesystem forever.
Again all of this needs to be coordinated between ip/eb/arptables
packages, could all of this be fixed in a consistent way?
Bug#918797: marked as done (minieigen: FTBFS with Sphinx 1.8: No module named 'sphinx.ext.pngmath')
Your message dated Sun, 27 Jan 2019 08:45:46 + with message-id and subject line Bug#918797: fixed in minieigen 0.50.3+dfsg1-8 has caused the Debian Bug report #918797, regarding minieigen: FTBFS with Sphinx 1.8: No module named 'sphinx.ext.pngmath' to be marked as done. This means that you claim that the problem has been dealt with. If this is not the case it is now your responsibility to reopen the Bug report if necessary, and/or fix the problem forthwith. (NB: If you are a system administrator and have no idea what this message is talking about, this may indicate a serious mail system misconfiguration somewhere. Please contact ow...@bugs.debian.org immediately.) -- 918797: https://bugs.debian.org/cgi-bin/bugreport.cgi?bug=918797 Debian Bug Tracking System Contact ow...@bugs.debian.org with problems --- Begin Message --- Source: minieigen Version: 0.50.3+dfsg1-7 Severity: important User: python-modules-t...@lists.alioth.debian.org Usertags: sphinx1.8 Dear Maintainer, minieigen fails to build with Sphinx 1.8: make -C doc html make[2]: Entering directory '/<>/minieigen-0.50.3+dfsg1/doc' PYTHONPATH=. sphinx-build -b html -d build/doctrees source build/html Running Sphinx v1.8.3 Error in sitecustomize; set PYTHONVERBOSE for traceback: AttributeError: module 'sys' has no attribute 'setdefaultencoding' Extension error: Could not import extension sphinx.ext.pngmath (exception: No module named 'sphinx.ext.pngmath') The pngmath extension was deprecated in Sphinx 1.4 and has been removed [1] in Sphinx 1.8. It looks like minieigen upstream has updated [2] conf.py to use mathjax instead of it. If you want to use mathjax in Debian packaging, then add this line to conf.py: mathjax_path = 'file:///usr/share/javascript/mathjax/MathJax.js?config=TeX-AMS-MML_HTMLorMML' and make your documentation package depend on libjs-mathjax. Also you can use imgmath which is another alternative for pngmath. See [3] for details on math support in Sphinx. [1]: https://github.com/sphinx-doc/sphinx/pull/4702 [2]: https://github.com/eudoxos/minieigen/commit/103ccad16a6ab1c0 [3]: https://www.sphinx-doc.org/en/1.8/usage/extensions/math.html -- Dmitry Shachnev signature.asc Description: PGP signature --- End Message --- --- Begin Message --- Source: minieigen Source-Version: 0.50.3+dfsg1-8 We believe that the bug you reported is fixed in the latest version of minieigen, which is due to be installed in the Debian FTP archive. A summary of the changes between this version and the previous one is attached. Thank you for reporting the bug, which will now be closed. If you have further comments please address them to 918...@bugs.debian.org, and the maintainer will reopen the bug report if appropriate. Debian distribution maintenance software pp. Anton Gladky (supplier of updated minieigen package) (This message was generated automatically at their request; if you believe that there is a problem with it please contact the archive administrators by mailing ftpmas...@ftp-master.debian.org) -BEGIN PGP SIGNED MESSAGE- Hash: SHA512 Format: 1.8 Date: Sun, 27 Jan 2019 09:14:29 +0100 Source: minieigen Binary: python-minieigen python3-minieigen Architecture: source Version: 0.50.3+dfsg1-8 Distribution: unstable Urgency: medium Maintainer: Debian Science Maintainers Changed-By: Anton Gladky Description: python-minieigen - Wrapper of parts of the Eigen library (Python 2) python3-minieigen - Wrapper of parts of the Eigen library (Python 3) Closes: 918797 Changes: minieigen (0.50.3+dfsg1-8) unstable; urgency=medium . * [ffbc36d] Use mathjax instead of pngmath. (Closes: #918797) * [dd52f7c] Set standards-version to 4.3.0 Checksums-Sha1: 5bea912c52130d10044bac56b5852fd0d1916389 2252 minieigen_0.50.3+dfsg1-8.dsc 8cba6cbe9c6e29dae8ffbeb8b5a9199d8503f4ab 7108 minieigen_0.50.3+dfsg1-8.debian.tar.xz a5a1395267438da12a09391da5fbf4f4fe6ddb84 5269 minieigen_0.50.3+dfsg1-8_source.buildinfo Checksums-Sha256: 9692a07f6bd8120b27f54a6a2588a769f83352e99dd240818d05076a66bc88eb 2252 minieigen_0.50.3+dfsg1-8.dsc a303e7ac380217e80ca90c72dbbdc0e24040694b4b1c243d57fa4b8cad47e95c 7108 minieigen_0.50.3+dfsg1-8.debian.tar.xz d2780f4a190769c4d67093553d5b743f78cbe95b83882b3b5fbfb45493c04d4e 5269 minieigen_0.50.3+dfsg1-8_source.buildinfo Files: 6172cbd0f852444c28d4c43d24ab1ca9 2252 libs optional minieigen_0.50.3+dfsg1-8.dsc 20a99d0620595754bd5fa44824f4f5cc 7108 libs optional minieigen_0.50.3+dfsg1-8.debian.tar.xz f250116b221a996951206296b5444f7e 5269 libs optional minieigen_0.50.3+dfsg1-8_source.buildinfo -BEGIN PGP SIGNATURE- iQIzBAEBCgAdFiEEu71F6oGKuG/2fnKF0+Fzg8+n/wYFAlxNaJAACgkQ0+Fzg8+n /wYF8hAAj8zgDtSDT4OG/itjjrpvk+E2ty6lECGQTfZeQI+Z39Vwji+LagYJRTfT IbDofsk/jjtY9PYc/1XBLVpPOokNgC489n2YMYLYNkIjcWSuM1GuUvm7TcdEvDdl drodS09Y3CH9eIV7Z+y3gdDCPtSqxXtmvsalx33Q/9gi37O8P4MBnAwPOeIirT/c GniUfIJf1Xx1ADIfDxb/+2YYIIbVOu7UX5yZSnM+T1oHY7vp4uvf12ck4XYhLA8Z
Bug#920525: marked as done (freecad: autopkgtest failure)
Your message dated Sun, 27 Jan 2019 08:40:40 + with message-id and subject line Bug#920525: fixed in freecad 0.17+dfsg1-8 has caused the Debian Bug report #920525, regarding freecad: autopkgtest failure to be marked as done. This means that you claim that the problem has been dealt with. If this is not the case it is now your responsibility to reopen the Bug report if necessary, and/or fix the problem forthwith. (NB: If you are a system administrator and have no idea what this message is talking about, this may indicate a serious mail system misconfiguration somewhere. Please contact ow...@bugs.debian.org immediately.) -- 920525: https://bugs.debian.org/cgi-bin/bugreport.cgi?bug=920525 Debian Bug Tracking System Contact ow...@bugs.debian.org with problems --- Begin Message --- Source: freecad Version: 0.17+dfsg1-7 Severity: serious Dear maintainer, even after -7, autopkgtest still fails https://ci.debian.net/data/autopkgtest/unstable/amd64/f/freecad/1785985/log.gz From what I can see, I think the test itself passes, but it outputs stuff to stderr, which causes autopkgtest to consider it as a failure. -- regards, Mattia Rizzolo GPG Key: 66AE 2B4A FCCF 3F52 DA18 4D18 4B04 3FCD B944 4540 .''`. more about me: https://mapreri.org : :' : Launchpad user: https://launchpad.net/~mapreri `. `'` Debian QA page: https://qa.debian.org/developer.php?login=mattia `- signature.asc Description: PGP signature --- End Message --- --- Begin Message --- Source: freecad Source-Version: 0.17+dfsg1-8 We believe that the bug you reported is fixed in the latest version of freecad, which is due to be installed in the Debian FTP archive. A summary of the changes between this version and the previous one is attached. Thank you for reporting the bug, which will now be closed. If you have further comments please address them to 920...@bugs.debian.org, and the maintainer will reopen the bug report if appropriate. Debian distribution maintenance software pp. Kurt Kremitzki (supplier of updated freecad package) (This message was generated automatically at their request; if you believe that there is a problem with it please contact the archive administrators by mailing ftpmas...@ftp-master.debian.org) -BEGIN PGP SIGNED MESSAGE- Hash: SHA512 Format: 1.8 Date: Sat, 26 Jan 2019 18:04:22 -0600 Source: freecad Architecture: source Version: 0.17+dfsg1-8 Distribution: unstable Urgency: medium Maintainer: Debian Science Maintainers Changed-By: Kurt Kremitzki Closes: 920525 Changes: freecad (0.17+dfsg1-8) unstable; urgency=medium . * [9d6a8a1] Add allow-stderr restriction on autopkgtest (Closes: #920525) Checksums-Sha1: 455d4e164520304a36ffee9f479d5ee5c44742f8 3144 freecad_0.17+dfsg1-8.dsc 7b91be1bf58a8297d44d5c6584f6aeefdab03b17 27840 freecad_0.17+dfsg1-8.debian.tar.xz 9c27b4e345f1e98d0fdbdfb937f8203a1aa83436 29484 freecad_0.17+dfsg1-8_source.buildinfo Checksums-Sha256: f3c3062a8e20b3bee551d5faa5850bdd6d145e75a1170e28917f4955656e5818 3144 freecad_0.17+dfsg1-8.dsc e2e03ed011ec97efa8a01a7b98b1f4636dcc41a9d9fd493ca0be1328ed2c81a9 27840 freecad_0.17+dfsg1-8.debian.tar.xz 1014b74f0457d49a294a5b1af34752bd1de18fc76db99b4247a4fefefbd2b2e0 29484 freecad_0.17+dfsg1-8_source.buildinfo Files: 7d44d88d7a57da7b5d755cd5f5639901 3144 science optional freecad_0.17+dfsg1-8.dsc 963a00cd9395f9b758b2016b575325d2 27840 science optional freecad_0.17+dfsg1-8.debian.tar.xz 9add311271b346675369d727245a25d9 29484 science optional freecad_0.17+dfsg1-8_source.buildinfo -BEGIN PGP SIGNATURE- iQJFBAEBCgAvFiEEh8RU7HmiYTD5HEfrKUghB0bfc8AFAlxM9ekRHGt1cnRAa3dr LnN5c3RlbXMACgkQKUghB0bfc8BmfBAAkH/u6aAIvH5FeeUUkBm+HI1FdY5vpBkG wit9FqJagX1RDe4yeZerwsOpcbflEymWRkreWoUgRFYbyq5enXY+NAbj6eA4K730 gxNbg9JxWoVEyRh3QbaXnOmKqN16ISleKl3f8nWLclgIhsaDYtKzysu99kxMuENO 4Ak8oW2SvGL6gXuLRaE5ZZUaO5yuFgvZhvBB1kSc24nG9TmnxHuTvdSaqpEH20B5 b03kgQVOtcB0ceObCLadiOrmr5h7DGdQaLgCUE6Y7x4uodcGYUDxAEOMM7FfQRuq 7+T/t7pmPkPb0T3tGOA9XdGxObWmI+Wt09fW2BhmiJNeivh3WD5OYwK2vvqRRWV2 +oGOZ6ik60TqvbKAQUgoVYKQC+rF4pJ+Qtn9Q6zQVl3M/nmZ4P2VFBg53Rokbxsr j4Znsls+v5+1Li+vFUP6F3KNZlAikpG3SSRe0smhEXWB/gP/+/dJQGIA6qctuzSJ TPsZZRMR//89U3dbzqOOZUJmjB2Xo8IRW2AoEsNDb3bPZmDJEjEToSb2p3ruUX/A /RDVO4cGEM2I+wiwnM0vS0jBjuG+knlfCxjPfwQZ1+jyIe8BOyEyaOcgVjsYF8yu v5egdXch1DBXtWaAntytQhS3WVRXDkqfThRUWhqnB0bg/RcRUy+sxfiNv5HWwK4T B+26b3V0l+Q= =+QBT -END PGP SIGNATURE End Message ---
Bug#920584: python-plastex: cannot correctly import PIL; cannot process images
MR: https://salsa.debian.org/python-team/modules/plastex/merge_requests/2 -- Stuart Prescotthttp://www.nanonanonano.net/ stu...@nanonanonano.net Debian Developer http://www.debian.org/ stu...@debian.org GPG fingerprint90E2 D2C1 AD14 6A1B 7EBB 891D BBC1 7EBB 1396 F2F7
Bug#920584: python-plastex: cannot correctly import PIL; cannot process images
Package: python-plastex
Version: 0.9.2-1.2
Severity: serious
Tags: + patch
Justification: Renders package (almost) useless
Dear Maintainer,
Various python-imaging/python-pil imports have changed over time and plastex
in Debian has almost kept up with them. It currently depends on python-pil but
does not correctly import from PIL and so claims that python-pil is not
installed; images within the documentation cannot be processed in this state.
Since (almost) all documentation contains images, this means that plastex
misrenders the documentation. (The only build-rdep of plastex in the archive
makes heavy use of images in its documentation and is affected by this bug.)
Patch attached and MR to follow.
regards
Stuart
-- System Information:
Debian Release: buster/sid
APT prefers unstable-debug
APT policy: (500, 'unstable-debug'), (500, 'unstable')
Architecture: amd64 (x86_64)
Kernel: Linux 4.9.0-8-amd64 (SMP w/4 CPU cores)
Locale: LANG=en_AU.UTF-8, LC_CTYPE=en_AU.UTF-8 (charmap=UTF-8),
LANGUAGE=en_AU:en (charmap=UTF-8)
Shell: /bin/sh linked to /bin/dash
Init: unable to detect
Versions of packages python-plastex depends on:
ii dvipng 1.15-1.1
ii python 2.7.15-4
ii python-pil 5.4.1-1
ii texlive-latex-base 2018.20190122-1
Versions of packages python-plastex recommends:
ii python-cheetah 3.1.0-3
ii python-genshi 0.7-6
ii python-kid 0.9.6-3
python-plastex suggests no packages.
-- no debconf information
commit 156f57a99896710e64ce3b42248abc849e52f7b6
Author: Stuart Prescott
Date: Sun Jan 27 18:44:28 2019 +1100
Fix import of PIL after rename
diff --git a/debian/changelog b/debian/changelog
index 2f22e5d..f5d3226 100644
--- a/debian/changelog
+++ b/debian/changelog
@@ -1,11 +1,15 @@
plastex (0.9.2-2) UNRELEASED; urgency=medium
+ [ Ondřej Nový ]
* d/changelog: Remove trailing whitespaces
* d/control: Remove trailing whitespaces
* Remove debian/pycompat, it's not used by any modern Python helper
* Convert git repository from git-dpm to gbp layout
* d/watch: Use https protocol
+ [ Stuart Prescott ]
+ * Correctly import PIL
+
-- Ondřej Nový Mon, 12 Mar 2018 23:22:35 +0100
plastex (0.9.2-1.2) unstable; urgency=low
diff --git a/debian/patches/pilimport.diff b/debian/patches/pilimport.diff
new file mode 100644
index 000..1bd4f91
--- /dev/null
+++ b/debian/patches/pilimport.diff
@@ -0,0 +1,15 @@
+diff --git a/plasTeX/Imagers/__init__.py b/plasTeX/Imagers/__init__.py
+index 199fafe..ac26238 100644
+--- a/plasTeX/Imagers/__init__.py
b/plasTeX/Imagers/__init__.py
+@@ -13,8 +13,8 @@ depthlog = getLogger('render.images.depth')
+ status = getLogger('status')
+
+ try:
+-import Image as PILImage
+-import ImageChops as PILImageChops
++from PIL import Image as PILImage
++from PIL import ImageChops as PILImageChops
+ except ImportError:
+ PILImage = PILImageChops = None
+
diff --git a/debian/patches/series b/debian/patches/series
index 20a73cb..d64a4e1 100644
--- a/debian/patches/series
+++ b/debian/patches/series
@@ -1,3 +1,4 @@
03_template_icon_links.diff
remove_cgpdfpng.patch.diff
02_shebang.diff
+pilimport.diff
Bug#910627: xul-ext-nostalgy: Please update to upstream 0.2.36 to be compatible with TB 60+
On Wed, Jan 23, 2019 at 05:42:38PM -0500, Louis-Philippe Véronneau wrote: > On 1/23/19 5:14 PM, Moritz Mühlenhoff wrote: > > I'm moderately familiar with our procedures of updating stable... > > Oh, sorry, I didn't know you were a DD! I'm actually really not familiar > with the stable-proposed-updates procedures :D > > > If noone fixes that in stable, I'll request removal of the broken package > > by the next point release. > > Please do! > > Are you using this package? If you have some time, I'm looking for > someone to upload a fix I pushed to Salsa [1] to make this package > reproducible. No, I'm not using the package myself, I'm only filing bugs to ensure that all extensions are working fine with current releases. Cheers, Moritz
