Re: [galaxy-dev] shed tool dependencies
Hij Bjoern, I finally got around to trying your suggestions. It worked out nicely, so thanks for that! I've added the modules as an example to the toolshed, as I didn't find an example yet. Three modules (threads, threads::shared and Thread::Queue) are bundled in a dependency definition called package_perl_threading. Best, Geert Van: Geert Vandeweyer [geert.vandewey...@ua.ac.be] Verzonden: donderdag 8 augustus 2013 9:17 Aan: galaxy-dev@lists.bx.psu.edu Onderwerp: shed tool dependencies Hi, Is there a default notation to specify perl modules (threading modules) in a tool configuration or in a submission to the toolshed? I've got some tools to share that make extensive use of these modules, and they are not default in a perl distribution. Hence, I'd like to inform the users that they need to install these modules (or that they get installed by the the toolshed using cpan ?) Best, Geert -- Geert Vandeweyer, Ph.D. Department of Medical Genetics University of Antwerp Prins Boudewijnlaan 43 2650 Edegem Belgium Tel: +32 (0)3 275 97 56 E-mail: geert.vandewe...@ua.ac.be http://ua.ac.be/cognitivegenetics http://www.linkedin.com/pub/geert-vandeweyer/26/457/726 ___ Please keep all replies on the list by using reply all in your mail client. To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ To search Galaxy mailing lists use the unified search at: http://galaxyproject.org/search/mailinglists/
Re: [galaxy-dev] migrate_tools error with latest release (hg update release_2014.02.10 )
Thanks! I didn't get output before the error, so I think no tools were migrated successfully. I tried to strip down the XML to only hold the first tool, but that gave the same error. I hope to try a fresh install today keeping the database and all settings not related to toolshed ( ie copy them from the old install.) could I then reinstall all shed tools, or will there be conflicts from info in the MySQL database? Best Geert Van: Dave Bouvier [d...@bx.psu.edu] Verzonden: dinsdag 11 februari 2014 22:56 Aan: Vandeweyer Geert; galaxy-dev@lists.bx.psu.edu Onderwerp: Re: [galaxy-dev] migrate_tools error with latest release (hg update release_2014.02.10 ) Geert, I have not yet been able to reproduce that error in my local Galaxy installation running on the release_2014.02.10 tag, but I am continuing to investigate. Are you able to determine which repository last succeeded in the migration script output? --Dave B. On 02/11/2014 10:29 AM, Geert Vandeweyer wrote: This message is also returned when I try to start the server without the migrate tools script (but after the initial error). Can I safely revert to a previous release somehow? Best, Geert On 02/11/2014 03:18 PM, Geert Vandeweyer wrote: Hi, I'm having problems upgrading Galaxy to the latest release. The migrate tools script gives the following error. No handlers could be found for logger galaxy.tools Traceback (most recent call last): File ./scripts/migrate_tools/migrate_tools.py, line 21, in module app = MigrateToolsApplication( sys.argv[ 1 ] ) File /galaxy/galaxy-dist/lib/tool_shed/galaxy_install/migrate/common.py, line 45, in __init__ self.installed_repository_manager = installed_repository_manager.InstalledRepositoryManager( self ) File /galaxy/galaxy-dist/lib/tool_shed/galaxy_install/installed_repository_manager.py, line 66, in __init__ self.load_dependency_relationships() File /galaxy/galaxy-dist/lib/tool_shed/galaxy_install/installed_repository_manager.py, line 269, in load_dependency_relationships self.add_entry_to_runtime_tool_dependencies_of_installed_tool_dependencies( tool_dependency ) File /galaxy/galaxy-dist/lib/tool_shed/galaxy_install/installed_repository_manager.py, line 147, in add_entry_to_runtime_tool_dependencies_of_installed_tool_dependencies tool_dependency_util.get_runtime_dependent_tool_dependency_tuples( self.app, tool_dependency, status=None ) File /galaxy/galaxy-dist/lib/tool_shed/util/tool_dependency_util.py, line 323, in get_runtime_dependent_tool_dependency_tuples env_shell_file_path = td.get_env_shell_file_path( app ) File /galaxy/galaxy-dist/lib/galaxy/model/tool_shed_install/__init__.py, line 533, in get_env_shell_file_path installation_directory = self.installation_directory( app ) File /galaxy/galaxy-dist/lib/galaxy/model/tool_shed_install/__init__.py, line 548, in installation_directory self.tool_shed_repository.owner, AttributeError: 'NoneType' object has no attribute 'owner' Any help on how to resolve this? The 0009_tools.xml content is : ?xml version=1.0? toolshed name=toolshed.g2.bx.psu.edu repository owner=devteam changeset_revision=96d2e31a3938 name=bowtie2 description=Bowtie2 tool id=bowtie2 version=0.2 file=bowtie2_wrapper.xml / /repository repository owner=devteam changeset_revision=a0c8dc671a23 name=ccat description=Control-based ChIP-seq Analysis Tool tool id=peakcalling_ccat version=0.0.1 file=ccat_wrapper.xml / /repository repository owner=devteam changeset_revision=7cc64024fe92 name=clustalw description=ClustalW multiple sequence alignment program for DNA or proteins tool id=clustalw version=0.1 file=rgClustalw.xml / /repository repository owner=devteam changeset_revision=6708501767b6 name=dwt_cor_ava_perclass description=Compute P-values and Correlation Coefficients for Feature Occurrences tool id=compute_p-values_correlation_coefficients_feature_occurrences_between_two_datasets_using_discrete_wavelet_transfom version=1.0.0 file=execute_dwt_cor_aVa_perClass.xml / /repository repository owner=devteam changeset_revision=0f2eda4ea8dc name=dwt_cor_avb_all description=Compute P-values and Correlation Coefficients for Occurrences of Two Set of Features tool id=compute_p-values_correlation_coefficients_featureA_featureB_occurrences_between_two_datasets_using_discrete_wavelet_transfom version=1.0.0 file=execute_dwt_cor_aVb_all.xml / /repository repository owner=devteam changeset_revision=0b89b03ad760 name=dwt_ivc_all description=Compute P-values and Second Moments for Feature Occurrences tool id=compute_p-values_second_moments_feature_occurrences_between_two_datasets_using_discrete_wavelet_transfom version=1.0.0 file=execute_dwt_IvC_all.xml / /repository repository owner=devteam changeset_revision=cb422b6f49d2 name
Re: [galaxy-dev] pass user groups to dynamic job runner
Thanks, I integrated parts of these snippets into our general dynamic_jobs function, and it works flawlessly. Best, Geert Van: jmchil...@gmail.com [jmchil...@gmail.com] namens John Chilton [chil...@msi.umn.edu] Verzonden: donderdag 19 september 2013 19:42 Aan: Vandeweyer Geert CC: galaxy-...@bx.psu.edu Onderwerp: Re: [galaxy-dev] pass user groups to dynamic job runner Feature request received. The following changeset demonstrates how one could implement this https://github.com/jmchilton/galaxy-central/commit/b500a24bc1aa94bef48db20a7cc1f3d68855b7fd First step is to create a new dynamic job destination, this is demonstrated in job_conf.xml in the above changeset. This demonstrates the new style job_conf section - this will need to be adapted for the old style runners but is still doable. Then you will want to add a dynamic job runner rule that implements this logic. This is the file lib/galaxy/jobs/rules/license_checker.py. This will do what you asked, you can adjust the tools it targets and the message that gets displayed to the user pretty easily (right now it is just No license, no tool). There is no longer any need to display such tools to the user thanks to dynamic toolbox filters. This is that last file: lib/galaxy/tools/filters/license_filter.py. This will prevent any tool in the list 'LICENSED_TOOLS' from even being seen by unlicensed users. You do need to specify this filter is being used by adding the line: tool_filters = license_filter:has_license in the [app:main] section of universe_wsgi.ini. Hope this helps! -John On Thu, Sep 19, 2013 at 2:45 AM, Vandeweyer Geert geert.vandewe...@uantwerpen.be wrote: Hi, Could somebody point me to the place where I can create a ticket for the following feature: - We want to have tools available only to users who provided a licence for this tool. - To prevent very long email lists (see example on dev-only tools), I'd like to have a group 'have_licence' - in dynamic job runner function : check if user is in usergroup : ok = run ; fail = give message. Or can I hide tools from the menu based on usergroup? Best, Geert ___ Please keep all replies on the list by using reply all in your mail client. To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ To search Galaxy mailing lists use the unified search at: http://galaxyproject.org/search/mailinglists/ ___ Please keep all replies on the list by using reply all in your mail client. To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ To search Galaxy mailing lists use the unified search at: http://galaxyproject.org/search/mailinglists/
[galaxy-dev] pass user groups to dynamic job runner
Hi, Could somebody point me to the place where I can create a ticket for the following feature: - We want to have tools available only to users who provided a licence for this tool. - To prevent very long email lists (see example on dev-only tools), I'd like to have a group 'have_licence' - in dynamic job runner function : check if user is in usergroup : ok = run ; fail = give message. Or can I hide tools from the menu based on usergroup? Best, Geert ___ Please keep all replies on the list by using reply all in your mail client. To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ To search Galaxy mailing lists use the unified search at: http://galaxyproject.org/search/mailinglists/
[galaxy-dev] no access to ftp on email change
Hi, Galaxy provides the option for users to change their login email. However, if they do, they loose access to their ftp folder. Is there an option to allow galaxy to rename these folders? Best, Geert ___ Please keep all replies on the list by using reply all in your mail client. To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ To search Galaxy mailing lists use the unified search at: http://galaxyproject.org/search/mailinglists/
Re: [galaxy-dev] workflow issues in local Galaxy....
Hi, I've reported the jobs running out of order issue before. http://lists.bx.psu.edu/pipermail/galaxy-dev/2013-May/014777.html We use mysql database. It seems rather random, but it might be only jobs taking multiple inputs. I'll check that if it happens. I've not found a solution yet. Geert Van: galaxy-dev-boun...@lists.bx.psu.edu [galaxy-dev-boun...@lists.bx.psu.edu] namens Nikhil Joshi [najo...@ucdavis.edu] Verzonden: dinsdag 17 september 2013 3:48 Aan: Björn Grüning CC: galaxy-dev@lists.bx.psu.edu Onderwerp: Re: [galaxy-dev] workflow issues in local Galaxy I am not using CloudMan, but we do use a sqlite database. It seems to have that behavior when there is an output that connects to two inputs... but I think I need to do more investigating. I suppose we could try postgres and see if that works... - Nik. On Mon, Sep 16, 2013 at 2:04 PM, Björn Grüning bjo...@gruenings.eumailto:bjo...@gruenings.eu wrote: Hi Nikhil, do you use the CloudMan?http://wiki.galaxyproject.org/CloudMan I have such a behaviour when I used the sqlite database and not postgresql. Cheers, Bjoern Hi all, So we use Galaxy to teach our bioinformatics courses and we have an install of Galaxy in the Amazon cloud that we have customized with various tools. However, we don't touch the Galaxy code base itself. Recently, we've been getting errors in creating and running workflows. We are getting locked database errors, sometimes the steps seem to run out of order, and sometimes the entire workflow just hangs. Also, the workflow editor seems to be having issues, like it allows connections between outputs and inputs of entirely different datatypes. Has anyone seen any issues like this? - Nik. -- Nikhil Joshi Bioinformatics Analyst/Programmer UC Davis Bioinformatics Core http://bioinformatics.ucdavis.edu/ najoshi -at- ucdavis -dot- edu 530.752.2698tel:530.752.2698 (w) ___ Please keep all replies on the list by using reply all in your mail client. To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ To search Galaxy mailing lists use the unified search at: http://galaxyproject.org/search/mailinglists/ -- Nikhil Joshi Bioinformatics Analyst/Programmer UC Davis Bioinformatics Core http://bioinformatics.ucdavis.edu/ najoshi -at- ucdavis -dot- edu 530.752.2698 (w) ___ Please keep all replies on the list by using reply all in your mail client. To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ To search Galaxy mailing lists use the unified search at: http://galaxyproject.org/search/mailinglists/
Re: [galaxy-dev] Fwd: Map with BWA results in correpted SAM file
Also through toolshed, version 0.5.9-r16. An example error on our part is (SamToBam): Error extracting alignments from (/galaxy/galaxy-dist/database/files/067/dataset_67090.dat), [samopen] SAM header is present: 25 sequences. Parse error at line 261924: sequence and quality are inconsistent Aborted That line in the sam does show sequence/qual inconsistency in length: HWI-1KL167:27:D1NADACXX:4:2315:10415:96156 0 chr1152187281 0 99M * 0 0 CTGGAAGACTGACCTGTGCTAGATCCCTCCTGGTCAAAGGTTGATGACTGTCCTGATGTAGAACCATGCTGTCCTTGGCTACAGAAGTGCCCTGAGCCA BBBFFBIFFFBFFBBFBFBBB XT:A:U NM:i:1 X0:i:1 X1:i:0 XM:i:1 XO:i:0 XG:i:0 MD:Z:33A65 fastq file fed to BWA holds the correct info: @HWI-1KL167:27:D1NADACXX:4:2315:10415:96156 1:N:0:GTGGCC CTGGAAGACTGACCTGTGCTAGATCCCTCCTGGTCAAAGGTTGATGACTGTCCTGATGTAGAACCATGCTGTCCTTGGCTACAGAAGTGCCCTGAGCCA + BBBFFBIFFFIFIIFFFFIIFFIIIFFBFFBFIBFBBBFBBBFFFBB Best, Geert Van: galaxy-dev-boun...@lists.bx.psu.edu [galaxy-dev-boun...@lists.bx.psu.edu] namens Moritz Juchler [juch...@stud.uni-heidelberg.de] Verzonden: woensdag 14 augustus 2013 12:59 Aan: Bjoern Gruening CC: galaxy-...@bx.psu.edu Onderwerp: Re: [galaxy-dev] Fwd: Map with BWA results in correpted SAM file Through toolshed. On 14 August 2013 12:50, Bjoern Gruening bjoern.gruen...@gmail.commailto:bjoern.gruen...@gmail.com wrote: Hi Moritz, do you installed bwa through the toolshed or manually? Cheers, Bjoern Hey Folks, Is there really nobody that can help Geert and me? Thats quite important to me right now. This is obviously not something specific to me, as Geert has the exact same error. I meanwhile tried to replace the id with 1 but it still doesnt work. Best Moritz __ Von: galaxy-dev-boun...@lists.bx.psu.eduIm Auftrag vonGeert Vandeweyer Gesendet: Donnerstag, 8. August 2013 17:18:59 (UTC+01:00) Amsterdam, Berlin, Bern, Rom, Stockholm, Wien An: galaxy-dev@lists.bx.psu.edumailto:galaxy-dev@lists.bx.psu.edu Betreff: Re: [galaxy-dev] Map with BWA results in correpted SAM file to add on this : we have similar issues (sam-to-bam conversion fails with similar errors). it seems to be related to the BWA output getting messed up, with (part of) columns missing or duplicated on some lines. I have not found a systematic pattern in the errors, they seem to happen rather random. On 08/08/2013 05:06 PM, Moritz Juchler wrote: Dear Galaxy Community, I have a local instance and installed 0.5.9-r16 BWA and the toolshed wrapper. The mapping is successful. I then use the Filter Sam Tool on the sam file from the alignment, but it spits out this error: Dataset 26: Filter SAM on data 24 Tool execution generated the following error message: Traceback (most recent call last): File /home/trr/galaxy-dist/tools/samtools/sam_bitwise_flag_filter.py, line 148, in module if __name__ == __main__: main() File /home/trr/galaxy-dist/tools/samtools/sam_bitwise_flag_filter.py, line 137, in main flags = int( fields[flag_col] ) ValueError: invalid literal for int() with base 10: 'RG:Z:lane712s006433' I have the same workflow online and did the exact same steps on the same fastq files. Is there anything I am missing? Is there any information I can provide to answer this question? Best Moritz ___ Please keep all replies on the list by using reply all in your mail client. To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ To search Galaxy mailing lists use the unified search at: http://galaxyproject.org/search/mailinglists/ -- Geert Vandeweyer, Ph.D. Department of Medical Genetics University of Antwerp Prins Boudewijnlaan 43 2650 Edegem Belgium Tel: +32 (0)3 275 97 56 E-mail: geert.vandewe...@ua.ac.bemailto:geert.vandewe...@ua.ac.bemailto:geert.vandewe...@ua.ac.bemailto:geert.vandewe...@ua.ac.be http://ua.ac.be/cognitivegenetics http://www.linkedin.com/pub/geert-vandeweyer/26/457/726 ___ Please keep all replies on the list by using reply all in your mail client. To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ To search Galaxy mailing lists use the unified search at: http://galaxyproject.org/search/mailinglists/ ___ Please keep all replies on the list by using reply all in your mail client. To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ To search Galaxy mailing lists use the unified search at: http://galaxyproject.org/search/mailinglists/
