Re: [galaxy-user] generating a new fasta from a pileup
I have some code which can do most of the requested things. Let me figure out how to galaxy around it, and I'll submit it. John Sent from my mobile device On 2011-07-30, at 12:47 AM, Jennifer Jackson j...@bx.psu.edu wrote: Hello David, Generating a consensus fasta sequence from a BAM or Pile-up file is not yet possible in Galaxy. To date, the Tool Shed also does not have a wrapped/novel tool for this function either. If you or another user were to create such a wrapped tool, it would be most welcome. As would a tool that would replace the corresponding region of the reference genome with the variant fasta sequence to create a novel reference for alignments. Both great ideas that have been discussed a few times on the list and here among our team. If you wanted to open a bitbucket ticket, that would be one way to share exactly what you had in mind and give you a ticket to watch for if/when tools like this are added. Or, I can open one (or possibly two, one for each function) for you, just let me know. https://bitbucket.org/galaxy/galaxy-central/issues?status=newstatus=open Thanks for the great feedback, sorry there wasn't a solution (yet!), Best, Jen Galaxy team On 7/22/11 12:56 PM, David Matthews wrote: Hi On a separate issue, I have been having trouble generating a corrected fasta file based on a pileup. I have a dataset that is a resequenced genome and I want to correct the fasta file based on the consensus and then re run the alignments to see how it affects things. However, I cannot for the life of me figure out how to do it in Galaxy. Any help appreciated! David ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ -- Jennifer Jackson http://usegalaxy.org http://galaxyproject.org/Support ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
Re: [galaxy-user] filtering fastq file according to qual score
Hi Haluk, By filtering, you mean removing reads? trimming their ends? or masking some of their bases? There are 3 tools under Generic FASTQ manipulation that may help you: Filter FASTQ reads by quality score and length FASTQ Quality Trimmer by sliding window FASTQ Masker by quality score Regards, Florent On 31/07/11 05:58, Haluk Dogan wrote: Hi, I am trying to filter my fastq file with the condition of if quality score of reads is less then min score. So far, I have tried both *fastq_quality_filter* and *Filter FASTQ under NGS: QC and manipulation** *but I was not be able to do it. In the following you can see my fastq file. @F4HZV5G02CX6WP rank=096 x=1092.0 y=1767.0 length=45 TTGAGCAGCGGCGTCACGGCGGCGGCCTCGGCGGCCGCATAGGCG + FFFIHFFDDBDA And these are quality scores. [37, 37, 37, 37, 37, 37, 37, 37, 37, 37, 37, 40, 40, 40, 40, 40, 40, 40, 40, 40, 40, 40, 40, 40, 40, 40, 40, 40, 40, 40, 40, 40, 40, 40, 40, 40, 39, 37, 37, 35, 35, 33, 35, 32, 29] I want to filter bases if their quality scores are less than 33. Any help would be greatly appreciated. -- HD ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
