Re: Running a python program during idle time only
los [EMAIL PROTECTED] writes: Thanks for all the replies. I did try using nice under windows. I created a java program that would just loop and print numbers on the screen. Even when I ran that simple program with nice, (lets call it program A) as soon as I started the program the cpu went all the way to 100% usage. Then when I ran another program that did the same thing (lets call it program B), program A halted to let B finish, then it started again. Nevertheless it still hogged all the cpu while I was using the computer. Well, shouldn't it? You don't want to waste CPU cycles. If your program is niced to a low priority, it will run _only when more important tasks doesn't run_. I.e.: It stays out of the way when higher priority processes claim the computer, while still utilizing the rest of the computational power. My experience is that properly niced processes can use almost 100 percent CPU, and still not have any noticeable effect on my other use of the computer. Asbj.S. -- Asbjørn Sæbø, post.doc. Centre for Quantifiable Quality of Service in Communication Systems Norwegian University of Science and Technology URL: http://www.q2s.ntnu.no/ -- http://mail.python.org/mailman/listinfo/python-list
Automatic response to your mail (Error)
The automatic reply to this e-mail which you should have received in response to your e-mail to [EMAIL PROTECTED] has not been defined. Please contact [EMAIL PROTECTED] for assistance. -- http://mail.python.org/mailman/listinfo/python-list
Re: How to use protocols.msn.FileSend and protocols.msnFileReceive
I think Joe was trying to encourage you to provide some more information so that someone _can_ help you... Mentioning in the subject that your question is about Twisted would certainly be a step in the right direction, as would at _least_ touching on what you're intending to do, what you've tried, what problems you've encountered, what documentation you've read and what issues you're not following. I have zero experience with Twisted, so I can't provide any help myself, but clearing up your own question might encourage someone who does know to answer. In other words, the easier you make it for someone to answer your question, the more inclined they'll be to answer it. Good luck. -alex23 -- http://mail.python.org/mailman/listinfo/python-list
Re: What are OOP's Jargons and Complexities?
Also sprach John W. Kennedy: alex goldman wrote: John W. Kennedy wrote: Strong typing has been a feature of mainstream programming languages since the late 1950's. I'm just curious, what do you mean by /strong/ typing, and which strongly typed languages do you know? Unfortunately, I have seen the meaning shift with the context. In Ada '83, it means it is not possible to have the equivalent of a C unprototyped function, and that mixed-type expressions tend to need explicit casting. In other contexts (as here), I've seen it used to mean simply that variables have definite types, and it is not possible (except by the use of polymorphic classes) for a variable to change from an integer to a float to a character string in the course of execution. In this sense, compile-to-machine-code languages (ee.g., Fortran, COBOL, C, C++, or Pascal), are generally strongly typed These are statically typed. The extent to which they are also strongly typed differs: C++ is probably a little more strongly typed than C, but by and large their typing is still fairly weak. Most often, languages with strong typing can be found on the functional front (such as ML and Haskell). These languages have a dynamic typing system. I haven't yet come across a language that is both statically and strongly typed, in the strictest sense of the words. I wonder whether such a language would be usable at all. Tassilo -- use bigint; $n=71423350343770280161397026330337371139054411854220053437565440; $m=-8,;;$_=$n(0xff)$m,,$_=$m,,print+chr,,while(($m+=8)=200); -- http://mail.python.org/mailman/listinfo/python-list
Re: What are OOP's Jargons and Complexities?
Tassilo v. Parseval wrote: Also sprach John W. Kennedy: alex goldman wrote: John W. Kennedy wrote: Strong typing has been a feature of mainstream programming languages since the late 1950's. I'm just curious, what do you mean by /strong/ typing, and which strongly typed languages do you know? Unfortunately, I have seen the meaning shift with the context. In Ada '83, it means it is not possible to have the equivalent of a C unprototyped function, and that mixed-type expressions tend to need explicit casting. In other contexts (as here), I've seen it used to mean simply that variables have definite types, and it is not possible (except by the use of polymorphic classes) for a variable to change from an integer to a float to a character string in the course of execution. In this sense, compile-to-machine-code languages (ee.g., Fortran, COBOL, C, C++, or Pascal), are generally strongly typed These are statically typed. The extent to which they are also strongly typed differs: C++ is probably a little more strongly typed than C, but by and large their typing is still fairly weak. Most often, languages with strong typing can be found on the functional front (such as ML and Haskell). These languages have a dynamic typing system. No, ML Haskell are strongly and statically typed. Read this paper if interested: http://research.microsoft.com/Users/luca/Papers/TypeSystems.pdf -- http://mail.python.org/mailman/listinfo/python-list
Re: Access lotus notes using Python
Hi, What I am trying to do is to retrieve data from Lotus Notes Domino server and display the results in some specific format. I initially thought of doing it using Java JDBC (specifically thru JdbcDomino.jar file), but was not successful in getting the jar file (looks like IBM has removed the support for JDBC for LotusNotes). So now I am trying Python to get my work done. I downloaded pywin and installed it. I am trying ways to connect to the Domino server, but could not get hold of the API to do so. Also pywin itself seems to be having lots of bugs. Any help is appreciated. regards, Sateesh Kartic [EMAIL PROTECTED] wrote in message news:[EMAIL PROTECTED] The Great 'Michael Ströder' uttered these words on 5/23/2005 2:43 PM: Kartic wrote: The Great 'Sateesh' uttered these words on 5/23/2005 7:14 AM: Is it possible to access Lotus notes using Python? Can anyone provide me some pointers? Yes, you can... You need the win32all distribution installed and you can access Notes using the COM interface (win32com.client). There could be even more cross-platform programming options depending what access Lotus Notes really means for the original poster. Depending on configuration a Domino server might have several Internet protocol services for accessing Notes data (POP3, IMAP, LDAP, etc.). Ciao, Michael. So I guess it upto the Sateesh to tell whether he needs more information or not. -- http://mail.python.org/mailman/listinfo/python-list
Re: Terminating a thread from the parent
DE wrote: Hello, I have an app with embedded Python. Python scripts create their own threads and I need to terminate these threads at the point where the user wants to leave the application. I use threading.Thread as base classes. I have tried to use call the join method of the python thread objects from C++. But although the call succeeds, the threads don't exit. What is the proper way of doing this ? (e.g. how does the python shell do this ? ) Thanks in advance, Devrim. I found this example somewhere. It shows how you terminate a thread. As Peter said, it's the thread that terminates itself. #!/usr/bin/env python testthread.py An example of an idiom for controling threads Doug Fort http://www.dougfort.net import threading class TestThread(threading.Thread): A sample thread class def __init__(self): Constructor, setting initial variables self._stopevent = threading.Event() self._sleepperiod = 1.0 threading.Thread.__init__(self, name=TestThread) def run(self): overload of threading.thread.run() main control loop print %s starts % (self.getName(),) count = 0 while not self._stopevent.isSet(): count += 1 print loop %d % (count,) self._stopevent.wait(self._sleepperiod) print %s ends % (self.getName(),) def join(self,timeout=None): Stop the thread self._stopevent.set() threading.Thread.join(self, timeout) if __name__ == __main__: testthread = TestThread() testthread.start() import time time.sleep(10.0) testthread.join() Benedict -- http://mail.python.org/mailman/listinfo/python-list
Re: Access lotus notes using Python
Sateesh wrote: Hi, Is it possible to access Lotus notes using Python? Can anyone provide me some pointers? Thanks Sateesh NotesSQL is an ODBC driver for Notes. Using NotesSQL and a python odbc connection you can use the standard python db-api2 to access tables. (Examples of odbc connection: mxODBC or the odbc provided by win32all) HTH, Thor Arne Johansen Technical Director Ibas AS -- http://mail.python.org/mailman/listinfo/python-list
Re: Access lotus notes using Python
try this import win32com.client session = win32com.client.Dispatch('Lotus.NotesSession') session.Initialize(r'') db = session.GetDatabase('',r'.nsf') view = db.GetView(r'') doc = view.GetFirstDocument() print doc.GetFirstItem('ii').Values domino return string as unicode -- http://mail.python.org/mailman/listinfo/python-list
Re: What are OOP's Jargons and Complexities?
Also sprach alex goldman: Tassilo v. Parseval wrote: Most often, languages with strong typing can be found on the functional front (such as ML and Haskell). These languages have a dynamic typing system. No, ML Haskell are strongly and statically typed. Read this paper if interested: You're right, their type system is in fact static. To me they never had a very static feel though which is why I get their classification wrong most of the time. LISP would have been an example for strongly and dynamically typed. Tassilo -- use bigint; $n=71423350343770280161397026330337371139054411854220053437565440; $m=-8,;;$_=$n(0xff)$m,,$_=$m,,print+chr,,while(($m+=8)=200); -- http://mail.python.org/mailman/listinfo/python-list
Re: searching substrings with interpositions
Hello Giorgi, I suggest to google for python boyer moore to get a fast implementation of a string search algorithm in Python (the Boyer-Moore algorithm). One promising hit seems to be: http://www.egenix.com/files/python/mxTextTools.html HTH, Bernd -- http://mail.python.org/mailman/listinfo/python-list
Re: searching substrings with interpositions
[EMAIL PROTECTED] wrote: hi everyone. a problem: two binary strings, a=0101 b=0100; i search a function f(a,b) that gives 1 if a is contained in b with any sub strings interposed. in this example a in contained cause 0100 but also 10100 but also 10100 but also 0100 etc any idea? Thanx in advance. Giorgi Borghi You can do this easily with regular expressions though I guess may be poor with long strings: import re re.search('0.*1.*0.*1', '0100') _sre.SRE_Match object at 0x008D9BF0 _.span() (0, 10) Put the chars of the search string in groups if you need to know where they were found. Kent -- http://mail.python.org/mailman/listinfo/python-list
Melbourne (Australia) Python User Group
Hi all, I'm interested in starting a Python user group in Melbourne, Australia. So far there seems to have been a lot of interest from various parties, but for whatever reasons it's fizzled out. So I've decided that if there's going to be a user group, I'll have to start it myself (hopefully without the meetup.com albatross). If you're in Melbourne, you're a python programmer and you're interested in meeting up, drop me an email and let me know. I'll probably also contact the Linux user groups in the area, but if you know of any other groups that would be interested, please let me know. If you want to forward this email on to other people or groups, feel free to do so. Thanks, Anthony -- - HyPEraCtiVE? HeY, WhO aRE YoU cALliNg HypERaCtIve?! [EMAIL PROTECTED] - -- http://mail.python.org/mailman/listinfo/python-list
Re: What are OOP's Jargons and Complexities?
Xah Lee wrote: The Rise of Classes, Methods, Objects 1) Most of the information you posted was incomplete and much of it is just plain wrong. 2) What you posted was not perl related. Are you deliberately trying to make yourself a laughingstock? -- http://mail.python.org/mailman/listinfo/python-list
Re: Access lotus notes using Python
Lotus Domino Designer 6.5.1 Help (instaled by notesdesigner) see section LotusScript/COM/OLE Classes LotusScript Classes A-Z -- http://mail.python.org/mailman/listinfo/python-list
Re: searching substrings with interpositions
i search a function f(a,b) that gives 1 if a is contained in b with any sub strings interposed. If I understand it right, it should be something like this: def blnFindCharSequenceAevenIfSpreadOverEntireStringB(strA, strB): intNoOfCharsFound = 0 intPtrToBeginOfSubsectionOfB = 0 intLenA = len(strA) intLenB = len(strB) blnStrAinB = False for chrA in strA: blnFoundChrA = False # print chrA for indxToB in range(intPtrToBeginOfSubsectionOfB, intLenB): if(chrA == strB[indxToB]): intNoOfCharsFound += 1 # print,chrA, strB[indxToB], indxToB intPtrToBeginOfSubsectionOfB = indxToB + 1 blnFoundChrA = True break #:if #:for if(intNoOfCharsFound == intLenA): blnStrAinB = True print sequence '%s' found in '%s'%(strA, strB) break #:if if(blnFoundChrA == False): break #:if #:for if blnStrAinB == False: print sequence '%s' not in '%s'%(strA, strB) #:if #:def strA = 0101 strB = 0100 blnFindCharSequenceAevenIfSpreadOverEntireStringB(strA, strB) strA = 010101 strB = 0100 blnFindCharSequenceAevenIfSpreadOverEntireStringB(strA, strB) Note: code above is intended to help clarify things only, so that a bunch of examples can be tested. If you need production quality code, maybe someone else can provide it. Is it what you are looking for? By the way: it looks to me like a standard problem while comparing DNA sequences, so I suppose that there are ready to use fast libraries providing such kind of function. Claudio [EMAIL PROTECTED] schrieb im Newsbeitrag news:[EMAIL PROTECTED] hi everyone. a problem: two binary strings, a=0101 b=0100; i search a function f(a,b) that gives 1 if a is contained in b with any sub strings interposed. in this example a in contained cause 0100 but also 10100 but also 10100 but also 0100 etc any idea? Thanx in advance. Giorgi Borghi -- http://mail.python.org/mailman/listinfo/python-list
reg python related job searching
Dear All, Can any one guide me how to get python related jobs?. Actually Now I am in Python web programming field. I have technical knowledge about Python, ZOPE and Twisted-web(Twisted Python) with 1 year exp.. Yahoo! India Matrimony: Find your life partner online Go to: http://yahoo.shaadi.com/india-matrimony -- http://mail.python.org/mailman/listinfo/python-list
Hacking the scope to pieces
We're starting to version a number of our python modules here, and I've written a small function that assists with loading the versioned modules... A module would be called something like: myModule_1_0.py In anything that uses it, though, we want to be able to refer to it simply as 'myModule', with an environment variable (MYMODULE_VERSION - set to 1.0) that defines the version. I've written a module called 'moduleLoader' with the follwing function in: def loadModule(module, version, v = globals()): import compiler loadStr = import %s_%s as %s % (module, version.replace(., _), module) eval(compiler.compile(loadStr, /tmp/%s_%s_errors.txt % (module, version.replace(., _)), single)) v[module] = vars()[module] The ideal situation with this would be to be able, in whatever script, to have: import moduleLoader moduleLoader.loadModule(myModule, os.getenv(MODULE_VERSION)) However, this doesn't work. The two options that do work are: import moduleLoader moduleLoader.loadModule(myModule, os.getenv(MODULE_VERSION), globals()) import moduleLoader moduleLoader.loadModule(myModule, os.getenv(MODULE_VERSION)) from moduleLoader import myModule What I'm after is a way of moduleLoader.loadModule working back up the scope and placing the imported module in the main global scope. Any idea how to do this? -- Hugh Macdonald -- http://mail.python.org/mailman/listinfo/python-list
ANN: Leo 4.3 final
Leo 4.3 final is now available at http://sourceforge.net/projects/leo/ Leo 4.3 is here after almost five months of work. The defining features of Leo 4.3: - 1. Leo now stores options in @settings trees, that is, outlines whose headline is '@settings'. When opening a .leo file, Leo looks for @settings trees not only in the outline being opened but also in various leoSettings.leo files. Users can create arbitrarily complex user options with @settings trees. 2. The Preferences command temporarily replaces the outline pane with an outline showing all the @settings trees in effect. The Preferences command also replaces the body pane with a settings pane. This settings pane allows you to change the settings selected in the outline pane using standard gui widgets. 3. Leo now stores recent files information in .leoRecentFiles.txt files. 4. Leo's read/write code in leoAtFile.py has been rewritten to support user-defined tangling and untangling. This is a major cleanup of Leo's core. 5. Leo now contains an excellent Plugins Manager plugin. This plugin enables and disables plugins automatically and tells you everything you need to know about each plugin. This plugin also lets you download plugins from Leo's cvs site. 6. You can install third-party extensions in Leo's extensions directory. Leo will attempt to import such extensions from the extensions directory when normal imports fail. The distribution contains Python Mega Widgets in the extensions directory. What people are saying about Leo Another day, another breakthrough using Leo--now I realize Leo is the best URL bookmark manager there is. No more bookmarks menus or favorites lists inside the browser for me. With the @url directive I can just double click on the URL to open it in my browser. Leo lets me arrange the URLs in a hierarchy (or multiple hierarchies), attach notes to them, save clippings of things I read on the sites. It's sooo much better than anything the browsers have built in and it lets me easily use different browsers on different platforms and different machines (try that with the browsers' built-in bookmark managers). -- Dan Winkler I am an amateur photographer. I use plain old 35mm. film for my pictures. Over the weekend, I used Leo to organize my lists of pictures. It is quite helpful--I can have separate nodes for pictures I have enlarged, as well as pictures I have submitted to our local camera club. Thanks! -- Rich Reis Cloning is pure genius!... Leo's cloning facility, allows me to create several views on the CFA course material. My main view follows the prescribed study guide. Another view is organized like the textbooks. Yet another gives me a glossary of terms. And when I'm done, I'll have some nice libraries...I can re-use later in other projects. -- Michael Manti More quotes at: http://webpages.charter.net/edreamleo/testimonials.html What makes Leo special? --- - Leo's outlines add a new dimension to programming. - Leo shows you your code and data the way _you_ want to see them. - Leo extends, completes and simplifies literate programming. - Leo's script buttons bring scripts to data. What is Leo? - A programmer's editor, an outlining editor and a flexible browser. - A literate programming tool, compatible with noweb and CWEB. - A data organizer and project manager. Leo provides multiple views of projects within a single outline. - Fully scriptable using Python. Leo saves its files in XML format. - Portable. leo.py is 100% pure Python. - Open Software, distributed under the Python License. Leo requires Python 2.2.1 or above and tcl/tk 8.4 or above. Leo works on Linux, Windows and MacOs X. Links: -- Leo: http://webpages.charter.net/edreamleo/front.html Home: http://sourceforge.net/projects/leo/ Download: http://sourceforge.net/project/showfiles.php?group_id=3458 CVS: http://sourceforge.net/cvs/?group_id=3458 Quotes: http://webpages.charter.net/edreamleo/testimonials.html Edward K. Ream email: [EMAIL PROTECTED] Leo: Literate Editor with Outlines Leo: http://webpages.charter.net/edreamleo/front.html -- http://mail.python.org/mailman/listinfo/python-list
IRIX MipsPro compiler chokes on Python.h
Hi there, I just built and installed Python-2.4.1 on my Irix machine. My compiler, the MipsPro compiler, chokes on the Python.h include file, as demonstrated here: $ CC -v MIPSpro Compilers: Version 7.41 $ python -V Python 2.4.1 $ cat l.cxx #include Python.h int main() { return 0; } $ CC -I $HOME/include/python2.4 l.cxx cc-1311 CC: ERROR File = /usr/include/sys/time.h, Line = 186 The indicated linkage specification is incompatible with previous select (declared at line 479 of /usr/include/unistd.h). static int select( ^ 1 error detected in the compilation of l.cxx. Has anyone experienced the same? How do I solve this? Thanks, Bram Stolk -- http://mail.python.org/mailman/listinfo/python-list
staticmethod and classmethod
Hi, Does anyone know of any examples on how ( where) to use staticmethods and classmethods? Thanks Colin -- http://mail.python.org/mailman/listinfo/python-list
Re: Python DOM
On Mon, 23 May 2005 22:37:09 -0700, [EMAIL PROTECTED] wrote: textNode = yourDocumentElement.createTextNode(the content) yourElement.appendChild(textNode) Thanks, it works, but 'yourDocumentElement' needs to be of type 'document'. The name leads to conclusion that it needs to be a root element of the document. DG -- http://mail.python.org/mailman/listinfo/python-list
Re: What are OOP's Jargons and Complexities?
Wibble [EMAIL PROTECTED] writes: Java or even C is more strongly typed than lisp or tcl which dont really have a concept of a typed variable. Lisp only does runtime type checking unless you do wierd unnatural things. You get terminology totally wrong here. As already said, Lisp is stronger typed than C, but C is statically typed, whereas Lisp is dynamically typed. In Lisp (or Scheme), all variables have types: (define foo #(1 2 3)) (vector? foo) = #t (boolean? foo) = #t See http://cliki.tunes.org/Type%20System. Rotty -- Andreas Rottmann | [EMAIL PROTECTED] | [EMAIL PROTECTED] | [EMAIL PROTECTED] http://yi.org/rotty | GnuPG Key: http://yi.org/rotty/gpg.asc Fingerprint | DFB4 4EB4 78A4 5EEE 6219 F228 F92F CFC5 01FD 5B62 v2sw7MYChw5pr5OFma7u7Lw2m5g/l7Di6e6t5BSb7en6g3/5HZa2Xs6MSr1/2p7 hackerkey.com Python is executable pseudocode, Perl is executable line-noise. -- http://mail.python.org/mailman/listinfo/python-list
Re: SQL Query via python
Jeff Elkins [EMAIL PROTECTED] wrote in message news:[EMAIL PROTECTED] Just as an fyi: In one weekend I have gone from knowing zip about SQL/Python to implementing code on my personal server that emails info to family about birthdays and such. Actually - http://www.pythonweb.org/ will handle the SQL (and many other tasks) in a much simpler way! If you do try the web.database.object examples, be aware that the docs are not entirely tracking the code; f.ex. databases have no type parameter; it's an adapter i.e. connection = web.database.connect(type=sqlite,database=object-simple.db) should be: connection = web.database.connect(adapter=sqlite,database=object-simple.db)' there are probably others - it's good to see what the parameters are in idle if something does not work as advertised. Overall, Pythonweb is very impressive work IMO. -- http://mail.python.org/mailman/listinfo/python-list
Running in Release or Debug version of the python interpreter?
Hi I have to check wheter a .py script is run within the debug or the release version of an embedded python interpreter (in short, wheter python24_d.dll or python24.dll is in use). long version: I'm using ctypes to load my own dll. There exists 2 version of this dll - a debug and a release version (where one is linked against debug C runtime dll and the other to release C runtime dll). Now I have to change the name of the dll I want to be loaded by ctypes... But how can I find out which of the dll I have to load?! Thanks in advance! Raphael Zulliger -- http://mail.python.org/mailman/listinfo/python-list
Re: slow sql server DB reads
If GUID is not a key in the database make it one. That way you won't have to do serial reads through the entire table to locate matching entries. It is hard to be more specific because we don't know how many records are in ASPSessionState table. If there are only a few, the problem is probably elsewhere. If there are many, indexing on GUID would provide speed improvement. Larry Bates bart wrote: I run a python website on a IIS server. I replaced my flat file DB with SQL server, but the reads are very slow. 7 seconds for 3 querrys like these conn= adodbapi.connect( Provider=SQLOLEDB.1;Persist Security Info=False;User ID=sa;Password=xxx;Initial Catalog=dlpl;Data Source=(local) ) crsr = conn.cursor() sql = select SessionKey, SessionValue from ASPSessionState where GUID='%s' % self.id crsr.execute(sql) while 1: info = crsr.fetchone() if not info: break strKey = str(info[0]) Opening the database is already good for 2 seconds. Anyone know how to speed it up? -- http://mail.python.org/mailman/listinfo/python-list
Re: Terminating a thread from the parent
I appreciate your posts guys. It answers my questions and I like the idea of overriding join method. I will use this one. -- http://mail.python.org/mailman/listinfo/python-list
Re: searching substrings with interpositions
thanx everyone, is what i need. As Claudio argues, it's a standard problem of dna sequences comparation. the next step of my job is to make limits of lenght of interposed sequences (if someone can help me in this way i'll apreciate a lot) thanx everyone. giorgio -- http://mail.python.org/mailman/listinfo/python-list
TEENS FUCKIN FOR CASH
18 Years young Teenies fuckin for Cash! Geile Teens ficken fuer Taschengeld! http://www.sexycorner.biz Enjoy Maria -- http://mail.python.org/mailman/listinfo/python-list
Re: What are OOP's Jargons and Complexities?
alex goldman wrote: John W. Kennedy wrote: Strong typing has been a feature of mainstream programming languages since the late 1950's. Is Fortran a strongly typed language? I don't think so. Strong typing has been invented in the 70's, if I'm not mistaken, when ML was invented, but strong typing has never been mainstream. I begin to believe that I have been reading naughty references, and that I should rather have said statically typed. I am not familiar with modern Fortran. Surely it at least has argument prototyping by now? -- John W. Kennedy You can, if you wish, class all science-fiction together; but it is about as perceptive as classing the works of Ballantyne, Conrad and W. W. Jacobs together as the 'sea-story' and then criticizing _that_. -- C. S. Lewis. An Experiment in Criticism -- http://mail.python.org/mailman/listinfo/python-list
\l operation in regular expressions
I've started to play around with regexps in Python and I tried something like this print re.sub( r'(\bw\w+\b)', r'\u\1', 'will it work') and get \uwill it \uwork when I had expected Will it Work I tried to find some documentation about this but I can't find anything that says if operations like \l \L \u \U etc are supported or not. It doesn't look like it supported? What is the Python way of doing this, writing a function and use that as the replacement? -- http://mail.python.org/mailman/listinfo/python-list
py2exe for WMI
Hello All. I'm trying to 'compile-to-EXE' a python program which uses Win32 WMI to pull system info. from the PC such as serial number, CPU speed, etc. I'm having problems with py2exe -- with regard to Win2000 WinXP platforms. It seems that the program only works if I have one typelib for WinXP and a slightly different one for Win2000. Here is my relevent section from the py2exe setup.py: setup( options = {py2exe: {typelibs: ## # typelib for WMI - WinXP ## [('{565783C6-CB41-11D1-8B02-00600806D9B6}', 0, 1, 2)], # typelib for WMI - Win2000 [('{565783C6-CB41-11D1-8B02-00600806D9B6}', 0, 1, 1)], # create a compressed zip archive compressed: 1, optimize: 2, packages: [encodings], excludes: excludes}}, # The lib directory contains everything except the executables and the python dll. # Can include a subdirectory name. zipfile = lib/shared.zip, Can anyone tell me how I might make one unified py2exe setup.py that'll 'compile' for both Win2000 WinXP? If not, can someone give me a hint as to how I can have a python 'launcher' which can determine the difference between Win2000 WinXP? Using the sys.platform, they both show as Win32. Thanks! Dave -- http://mail.python.org/mailman/listinfo/python-list
Re: reg python related job searching
praba Can any one guide me how to get python related jobs? You mean a source of job postings? If so, try the Python Jobs Board: http://www.python.org/Jobs.html Skip -- http://mail.python.org/mailman/listinfo/python-list
Re: Hacking the scope to pieces
Hugh What I'm after is a way of moduleLoader.loadModule working back up Hugh the scope and placing the imported module in the main global Hugh scope. Any idea how to do this? You want to write an import hook I think. I'd start with the docs for the __import__ builtin. Also, Google for python import hook. Skip -- http://mail.python.org/mailman/listinfo/python-list
Re: Hacking the scope to pieces
I will take a look! Thanks Skip -- Hugh -- http://mail.python.org/mailman/listinfo/python-list
Running PythonNN.DLL as debug or release?
Hi Folks, We've been using Python embedded in an application for a while now, where the Python dll is PythonNN.dll, NN being the version number, such as Python24.dll. Recently it was pointed out to me that Python can run in a debug or release configuration and that you can specify this on the command line using -O and -OO. My question is how do I specify this to the Python DLL I have embedded in my application? Is it as straightforward as: o Use PythonNN.dll for release mode Python o Use PythonNN_d.dll for debug mode Python and if so, how do I specify I want -O or -OO with release mode? I've tried looking at the C API documentation but couldn't find anything useful there. We are using versions of Python from 2.2 upwards. Cheers Stephen -- Stephen Kellett Object Media Limited Computer Consultancy, Software Development Windows C++, Java, Assembler, Performance Analysis, Troubleshooting -- http://mail.python.org/mailman/listinfo/python-list
RE: py2exe for WMI
| Hello All. | I'm trying to 'compile-to-EXE' a python program which uses | Win32 WMI to | pull system info. from the PC such as serial number, CPU | speed, etc. I'm | having problems with py2exe -- with regard to Win2000 WinXP | platforms. It | seems that the program only works if I have one typelib for | WinXP and a | slightly different one for Win2000. Here is my relevent | section from the | py2exe setup.py: [... snipped ...] | Can anyone tell me how I might make one unified py2exe | setup.py that'll | 'compile' for both Win2000 WinXP? | | If not, can someone give me a hint as to how I can have a | python 'launcher' | which can determine the difference between Win2000 WinXP? Using the | sys.platform, they both show as Win32. | | Thanks! | Dave There was a thread about this on the python-win32 list a while back. I think this is the start of the the thread (altho' it's a bit confusing). The conclusion seems to be that there's no conclusion. Maybe there's more info on the py2exe list/wiki? http://aspn.activestate.com/ASPN/Mail/Message/Python-win32/2007557 As to the other question (which platform am I on) there was also a thread about this recently: http://groups-beta.google.com/group/comp.lang.python/browse_frm/thread/b87d5de8f91c8e9c?tvc=1q=platform+hl=en which, in short, says: use the platform module TJG This e-mail has been scanned for all viruses by Star. The service is powered by MessageLabs. For more information on a proactive anti-virus service working around the clock, around the globe, visit: http://www.star.net.uk -- http://mail.python.org/mailman/listinfo/python-list
interesting Link
Hello everybody, I found on the web an interesting way to gain some money: it's netbux, that allows you to learn something while you search the web through google or altaista. I earned 40$ in a month, not a lot, but I have simply to use Google to do My searches. If you want try it subscribe at: http://netbux.org/?r=67933 -- http://mail.python.org/mailman/listinfo/python-list
Re: execution error
Skip Montanaro [EMAIL PROTECTED] escribió en el mensaje news:[EMAIL PROTECTED] Ximo And my question is how can show the execution error whitout exit Ximo of the program, showing it in the error output as You need to catch ZeroDivisionError. Here's a trivial example: try: ... 6/0 ... except ZeroDivisionError: ... print whoops! divide by zero... ... whoops! divide by zero... But I execute the operation in the else: try: except ZeroDivisionError: print whoops! divide by zero... else: execute( ) The exeption is produced after. Skip -- http://mail.python.org/mailman/listinfo/python-list
Re: searching substrings with interpositions
Just another solution, pretty and effective: def fct(a, b): idx = -1 for c in a: idx = b.find(c, idx+1) if idx == -1: return False return True On 24 May 2005 06:06:03 -0700, [EMAIL PROTECTED] [EMAIL PROTECTED] wrote:thanx everyone, is what i need.As Claudio argues, it's a standard problem of dna sequences comparation.the next step of my job is to make limits of lenght of interposedsequences (if someone can help me in this way i'll apreciate a lot)thanx everyone.giorgio-- http://mail.python.org/mailman/listinfo/python-list -- http://mail.python.org/mailman/listinfo/python-list
Re: \l operation in regular expressions
Kalle Anka [EMAIL PROTECTED] wrote: I've started to play around with regexps in Python and I tried something like this print re.sub( r'(\bw\w+\b)', r'\u\1', 'will it work') and get \uwill it \uwork when I had expected Will it Work I tried to find some documentation about this but I can't find anything that says if operations like \l \L \u \U etc are supported or not. they're not mentioned in the RE syntax chapter, and they don't work, so not supported is probably the right answer. It doesn't look like it supported? What is the Python way of doing this, writing a function and use that as the replacement? def fixup(m): return m.group().capitalize() s = re.sub( r'(\bw\w+\b)', fixup, 'will it work') or, if you insist on writing one-liners: s = re.sub( r'(\bw\w+\b)', lambda m: m.group().capitalize(), 'will it work') /F -- http://mail.python.org/mailman/listinfo/python-list
Re: Just remember that Python is sexy
Silly but true. It started with trying to figure how to remember it's strip() and not trim(). Then it went downhill from there. -- http://mail.python.org/mailman/listinfo/python-list
Pyrex: TypeError: unsubscriptable object
-BEGIN PGP SIGNED MESSAGE- Hash: SHA1 Hi, I'm just transforming a Python module into Pyrex, and I get the following error: File indicadorPyrex.pyx, line 37, in indicadorPyrex.volatilidade ~h1 = precoMax[barra] I made no changes to this module except including 'int' for two variables in the def argument of the function. I also tried to declare cdef float h1, but I get the same error. What can be wrong? Thanks, Luis -BEGIN PGP SIGNATURE- Version: GnuPG v1.2.4 (GNU/Linux) Comment: Using GnuPG with Thunderbird - http://enigmail.mozdev.org iD8DBQFCkz6MHn4UHCY8rB8RAlTZAJ0ZXfdmkZuXFLPrhGvaYUBoS7YTVQCZAZhp Fc65UgWF+rCkilTs0BAmNSU= =PZpG -END PGP SIGNATURE- -- http://mail.python.org/mailman/listinfo/python-list
Re: Running PythonNN.DLL as debug or release?
Stephen Kellett wrote: We've been using Python embedded in an application for a while now, where the Python dll is PythonNN.dll, NN being the version number, such as Python24.dll. Recently it was pointed out to me that Python can run in a debug or release configuration and that you can specify this on the command line using -O and -OO. whoever pointed that out to you was confused: -O and -OO are optimization flags used by the Python interpreter, and has nothing to do with what Python runtime you're using. $ python -h usage: python [option] ... [-c cmd | file | -] [arg] ... Options and arguments (and corresponding environment variables): ... -O : optimize generated bytecode (a tad; also PYTHONOPTIMIZE=x) -OO: remove doc-strings in addition to the -O optimizations ... if you want to use these from your C code, setting the global Py_OptimizeFlag to 1 (-O) or 2 (-OO) should work. /F -- http://mail.python.org/mailman/listinfo/python-list
Re: Python on a public library computer
alex23 wrote: In this case, it sounds like the library is providing computers for two purposes: access to Office tools and to the internet. Given the everything not forbidden is permissable attitude of most people, unless the use is restricted to only those two activities people legitimately wanting access will tend to end up waiting for others who have co-opted the services for their own personal end. But who are those people using this *public* library for their own personal end? Is it the cannibal elite that is using this public space to promote microsoft products and 'reducing' their workload (actually I believe they are making their own job harder) or is it the user who wants to run public domain software? The current situation is such that in order to make the system 'safer' I cannot clear my own cache, so my internet history is visible for the next user, which compromises *my* security. Surely there should be a balance between the interests of the provider and the client, but since in this case the client is also the 'owner' of the service (it's a *public* library) there should be room to run non-proprietary software. The connection with the european constitution is exactly about this shifting of the ownership of public buildings, institutions, infrastructure etc. *from* the persons using the service *towards* the people accidentally working in that place. So social security starts to act like it's an employer, but since they are also the state, they don't have to pay minimum wages, if one is treated unfairly it's impossible to get a fair trial. If one doesn't agree with this treatment they just keep the money they are obliged to pay (according to our national constituton) to themselves. Universities start to act like the buildings are extra living room for the persons working there and in order to get a degree one has to *work* for a professor. The elite in the city starts building luxury appartments for their own people (who are payed with public money stolen one way or the other from the normal residents in the city) in the natural resorts because their is some kind of 'shortage' in the housing market. On the other hand one wants to make the polluter pay and creates taxes for garbage. But these taxes are 'equal' for everyone, meaning that they are negligible for the rich but a large part of the income of the poor. The same goes for fines for speeding or parking tickets. If you're rich or know the people in the elite you can get away with anything. The *european* constitution is related to this because our government wants to limit the discussion to the merits of the document. The problem is that even with a good constitution a corrupt elite can interpret the terms in a way that is unfavorable for the poor (almost anyone is poor or becoming poor by now). And secondly the document is only intelligible for specialists, so even if it was good, there's no way to tell. So we might find ourselves in a situation one day when walking to the water tap to fill our teakettle a voice will come out of it asking whether we want *coca* cola or *pepsi* cola. When complaning about this to our government we will hear something like: 'Look you *have* a choice it's not like we prefer one brand over the other, so what are you complaining about? Be silent out you will be removed from our administration, which means no food, health care, money or friends. I'm currently mentally analogizing this discussion with the one on python dev about whether the decimal module should give users 'what they expect' or conform to industry standards, but I guess one has to be Dutch to see any connection at all here :-) The rationale for all of this is that the economy is bad and we have close to zero growth. We should be like China or other low wage countries in order to be more competitive. However the rationale is false! Because we have better infrastructure here we are *further* up the exponential development curve so we could have fenomenal growth if we wanted! The fact that this isn't happening at all has nothing to do with with the economic potential but all the more with conservative power consolidation tactics. The media play a very nasty role in all of this. For example the newspapers are complaining nobody reads paper anymore because of the internet. IMO it is caused more by nobody wanting to read the same old selfpromotion anymore. Something comparable is happening with public television which is not a true representation of the public opinion at all. Not to say public opinion is always good, but if noone thinks you are giving the right characterization of the current situation, one is not likely to want to join the discussion. Ok, this is getting way to far off topic. Thanks to all for the hints to get python running here. I'm now contemplating to access the already running java interpreter that must hide somewher in this IE, and to start a jython console from there (without even running a new
Build error Python 2.4.1 - stat problem?
Hello, I tried to build Python 2.4.1 on a Reliant Unix system. Just after the python executable program has been built, I get the following error: begin make output === CC -W1 -Blargedynsym -o python \ Modules/python.o \ libpython2.4.a -lresolv -lsocket -lnsl -ldl -lm case $MAKEFLAGS in \ *-s*) CC='cc' LDSHARED='ld' OPT='-DNDEBUG -O' ./python -E ./setup.py -q build;; \ *) CC='cc' LDSHARED='ld' OPT='-DNDEBUG -O' ./python -E ./setup.py build;; \ esac Traceback (most recent call last): File ./setup.py, line 1088, in ? class PyBuildInstallLib(install_lib): File ./setup.py, line 1094, in PyBuildInstallLib so_ext = sysconfig.get_config_var(SO) File /build_dir/Python-2.4.1/Lib/distutils/sysconfig.py, line 511, in get_config_var return get_config_vars().get(name) File /build_dir/Python-2.4.1/Lib/distutils/sysconfig.py, line 488, in get_config_vars func() File /build_dir/Python-2.4.1/Lib/distutils/sysconfig.py, line 358, in _init_posix raise DistutilsPlatformError(my_msg) distutils.errors.DistutilsPlatformError: invalid Python installation: unable to open /usr/local/lib/python2.4/config/Makefile (No such file or directory) make: *** Error code 1 make: Fatal error. end make output === It is strange that the Makefile complains about /usr/local/lib/python2.4 since this is still the build phase, far away from the installation into /usr/local. I used the python executable from the build directory to run the following program: import os def main(): if not (os.path.exists(/)): print / does not exist else: print / exists if not (os.path.isdir(/)): print / is not a directory else: print / ok if __name__ == __main__: main() The output is: / exists / is not a directory It's the same for every (existing) directory name I try: os.path.isdir() always returns false. It looks as if the stat results are not recognised: os.path.exists() works, but all the functions os.path.isdir(), os.path.isfile() etc. don't. Could anyone help me to solve the problem? - Servatius Servatius Brandt Phone: +49 89 636-41504 Fujitsu Siemens ComputersFax: +49 89 636-48716 EP SW AD C++ Email: [EMAIL PROTECTED] -- http://mail.python.org/mailman/listinfo/python-list
Re: execution error
Ximo My question is how can show the execution error whitout exit of the program, showing it in the error output as Skip You need to catch ZeroDivisionError. Here's a trivial example: try: ... 6/0 ... except ZeroDivisionError: ... print whoops! divide by zero... ... whoops! divide by zero... But I execute the operation in the else: try: except ZeroDivisionError: print whoops! divide by zero... else: execute( ) The exeption is produced after. -- http://mail.python.org/mailman/listinfo/python-list
Re: Running in Release or Debug version of the python interpreter?
Raphael Zulliger wrote: long version: I'm using ctypes to load my own dll. There exists 2 version of this dll - a debug and a release version (where one is linked against debug C runtime dll and the other to release C runtime dll). Now I have to change the name of the dll I want to be loaded by ctypes... But how can I find out which of the dll I have to load?! calling GetModuleFileName (in kernel32.dll) on sys.dllhandle should give you the name of the current Python DLL. something like this should work: from ctypes import * MAX_PATH = 500 filename = c_buffer(MAX_PATH) windll.kernel32.GetModuleFileNameA(sys.dllhandle, filename, MAX_PATH) filename = filename.value /F -- http://mail.python.org/mailman/listinfo/python-list
execution error 2
Ximo My question is how can show the execution error whitout exit of the program, showing it in the error output as Skip You need to catch ZeroDivisionError. Here's a trivial example: try: ... 6/0 ... except ZeroDivisionError: ... print whoops! divide by zero... ... whoops! divide by zero... But I execute the operation in the else: try: except ZeroDivisionError: print whoops! divide by zero... else: execute( ) The exeption is produced after. -- http://mail.python.org/mailman/listinfo/python-list
RE: [ZODB-Dev] ZODB memory problems (was: processing a Very Largefile)
[Jeremy Hylton] ... It looks like your application has a single persistent instance -- the root ExtendedTupleTable -- so there's no way for ZODB to manage the memory. That object and everything reachable from it must be in memory at all times. Indeed, I tried running this program under ZODB 3.4b1 on Windows, and about 4% of the way done it dies during one of the subtransaction commits, with a StackError: the object is so sprawling that a megabyte C stack is blown by recursion while trying to serialize it. -- http://mail.python.org/mailman/listinfo/python-list
Re: first release of PyPy
Kay Schluehr wrote: Speed isn't even the biggest problem when running PyPy on itself. PyPy still 'fakes' some objects, e.g. borrows them from the underlying Python. Does it mean You create an RPython object that runs on top of CPython, but is just an RPython facade wrapped around a CPython object? yes. It means that there are objects that behave like they should in PyPy but are implemented by keeping creating a regular CPython instance of the object and delegating all calls on PyPy-level back to the CPython level. So You have four kinds of Pythons: RPy - translateable into LL code APy - non-translateable but interpretable by translated RPy RPy* - non-translateable but consistent interface with RPy. Calls APy* APy* - not translateable and not interpreteable by translated RPy Selfhosting would imply vanishing RPy* and APy*. But the problem seems to be that selfhosting must somehow be broken because the system needs to interact with OS-dependend librarys. As long as You run the system upon CPython the problem does not occur but once You drop it, a kind of extension objectspace must be created which is translated into code with nice interfacing properties. Or do You think that RPython translations will be sufficient and another ext-objectspace is just useless epi-cycling? Not exactly sure what you mean here. It's clear that we have to handle faked objects differently to get a stand-alone PyPy version. One possibility would be, that the RPython code calls certain functions which are implemented in Python (can be regular Python), that are not translated but replaced by a proper C function. For example we have a function intmask at the moment which takes a long and removes as many bits from it as neccessary to make it fit into an int again. This function is left out when translating, since in C an int can obviously not overflow to a long. Regards, Carl Friedrich -- http://mail.python.org/mailman/listinfo/python-list
Re: py2exe for WMI
Tim Golden schrieb: | Hello All. | I'm trying to 'compile-to-EXE' a python program which uses | Win32 WMI to | pull system info. from the PC such as serial number, CPU | speed, etc. I'm | having problems with py2exe -- with regard to Win2000 WinXP | platforms. It | seems that the program only works if I have one typelib for | WinXP and a | slightly different one for Win2000. Here is my relevent | section from the | py2exe setup.py: [... snipped ...] | Can anyone tell me how I might make one unified py2exe | setup.py that'll | 'compile' for both Win2000 WinXP? | | If not, can someone give me a hint as to how I can have a | python 'launcher' | which can determine the difference between Win2000 WinXP? Using the | sys.platform, they both show as Win32. | | Thanks! | Dave There was a thread about this on the python-win32 list a while back. I think this is the start of the the thread (altho' it's a bit confusing). The conclusion seems to be that there's no conclusion. Maybe there's more info on the py2exe list/wiki? http://aspn.activestate.com/ASPN/Mail/Message/Python-win32/2007557 I don't think something wnet into the wiki, unfortunately. The OP of the thread Tim mentions here already had a solution, if I understood him correctly, and the other things that were suggested didn't work. Basically, IIUC, he did add the typelib wrappers from the 'other' windows version manually to the library.zip file. Totally different solutions would be: - change Tim's wmi.py module so that it works with dynamic binding (no typelib wrappers needed) or - change win32com so that the typelib wrappers can be generated by frozen executables at runtime. Thomas -- http://mail.python.org/mailman/listinfo/python-list
Re: Running in Release or Debug version of the python interpreter?
Raphael Zulliger schrieb: Hi I have to check wheter a .py script is run within the debug or the release version of an embedded python interpreter (in short, wheter python24_d.dll or python24.dll is in use). long version: I'm using ctypes to load my own dll. There exists 2 version of this dll - a debug and a release version (where one is linked against debug C runtime dll and the other to release C runtime dll). Now I have to change the name of the dll I want to be loaded by ctypes... But how can I find out which of the dll I have to load?! Thanks in advance! Raphael Zulliger You could use imp.get_suffixes(). In a release build the returned list will contain these entries ('.pyd', 'rb', 3), ('.dll', 'rb', 3) in a debug build that will be ('_d.pyd', 'rb', 3), ('_d.dll', 'rb', 3) Another way would be to look at the filename of any binary extension module. _ctypes.__file__, for example: '.\\_ctypes.pyd' vs. '\\_ctypes_d.pyd'. Thomas -- http://mail.python.org/mailman/listinfo/python-list
Re: staticmethod and classmethod
Think I read something about it here: http://heather.cs.ucdavis.edu/~matloff/Python/ not sure though. Lorenzo -- http://mail.python.org/mailman/listinfo/python-list
RE: py2exe for WMI
[Thomas Heller] [... snip problems with py2exe WMI ...] | The OP of the thread Tim mentions here already had a solution, if I | understood him correctly, and the other things that were suggested | didn't work. Basically, IIUC, he did add the typelib | wrappers from the | 'other' windows version manually to the library.zip file. | | Totally different solutions would be: | - change Tim's wmi.py module so that it works with dynamic | binding (no | typelib wrappers needed) | or Well, if it helps, there's a version of the WMI module that uses dynamic binding on my site: http://timgolden.me.uk/python/downloads/wmi-0.6a.py I've hardcoded the relevant constants (which is pretty much all I was using early binding for) and replaced any other EnsureDispatch calls with simple Dispatch. Does anyone want to give it a try to let me know if it helps? I don't use py2exe myself. TJG This e-mail has been scanned for all viruses by Star. The service is powered by MessageLabs. For more information on a proactive anti-virus service working around the clock, around the globe, visit: http://www.star.net.uk -- http://mail.python.org/mailman/listinfo/python-list
Re: What are OOP's Jargons and Complexities?
John W. Kennedy coughed up: alex goldman wrote: John W. Kennedy wrote: Strong typing has been a feature of mainstream programming languages since the late 1950's. Is Fortran a strongly typed language? I don't think so. Strong typing has been invented in the 70's, if I'm not mistaken, when ML was invented, but strong typing has never been mainstream. I begin to believe that I have been reading naughty references, and that I should rather have said statically typed. I am not familiar with modern Fortran. Surely it at least has argument prototyping by now? There are some fortran advocates that pop into here now and again. Frankly, I'm spooked by how far fortran seems to have come. There is even OO support now. OI. I preferred the old days of thinking that fortran sucked just 'cause. :) -- Enough is enough. It is /not/ a requirement that someone must google relentlessly for an answer before posting in usenet. Newsgroups are for discussions. Discussions do /not/ necessitate prior research. If you are bothered by someone asking a question without taking time to look something up, simply do not respond. -- http://mail.python.org/mailman/listinfo/python-list
Re: staticmethod and classmethod
C Gillespie wrote: Does anyone know of any examples on how ( where) to use staticmethods and classmethods? My personal experience is that I almost *never* want a staticmethod. The things that I would have written as a staticmethod in Java I simply write as a module-level function in Python. I do occasionally used classmethods though to build alternate constructors. I recently had a class with a constructor that looked like: class C(object): def __init__(self, *args): ... I already had code working with this constructor, but I needed to add an optional 'index' parameter. I found the clearest way to do this was something like: class C(object): def __init__(self, *args): ... @classmethod def indexed(cls, index, *args): ... obj = cls(*args) obj.index = index ... return obj Then the classes that needed the 'index' parameter simply use C.indexed() as the constructor instead of C(). STeVe -- http://mail.python.org/mailman/listinfo/python-list
Re: install python 2.4.1
[EMAIL PROTECTED] wrote] I use win xp pro. I wonder about this new version of python because I use Nummeric, pyro, combine with komodo and pydev ide in my python 2.4. If there is compatibility isue with the new version, it is better for me not to install the new version. There will be no compatibility issue with Komodo, at least. Nor should there be with the others, as Martin mentioned. Trent -- Trent Mick [EMAIL PROTECTED] -- http://mail.python.org/mailman/listinfo/python-list
Re: searching substrings with interpositions
[EMAIL PROTECTED] wrote: the next step of my job is to make limits of lenght of interposed sequences (if someone can help me in this way i'll apreciate a lot) thanx everyone. Kent Johnson had the right approach, with regular expressions. For a bit of optimization, use non-greedy groups. That will give you shorter matches. Suppose you want no more than 10 bases between terms. You could use this pattern. a.{,10}?t.{,10}?c.{,10}?g.{,10}? import re pat = re.compile('a.{,10}t.{,10}c.{,10}g.{,10}?') m = pat.search(tcgaacccgtagctaatcg) m.group(0), m.start(0), m.end(0) ('aacccgtagctaatcg', 3, 23) pat.search(tcgaacccgtagctaatttg) _sre.SRE_Match object at 0x9b950 pat.search(tcgaacccgtagctaag) If you want to know the location of each of the bases, and you'll have less than 100 of them (I think that's the limit) then you can use groups in the regular expression language def make_pattern(s, limit = None): ... if limit is None: ... t = .*? ... else: ... t = .{,%d}? % (limit,) ... text = [] ... for c in s: ... text.append((%s)%s % (c, t)) ... return .join(text) ... make_pattern(atcg) '(a).*?(t).*?(c).*?(g).*?' make_pattern(atcg, 10) '(a).{,10}?(t).{,10}?(c).{,10}?(g).{,10}?' pat = re.compile(make_pattern(atcg, 10)) m = pat.search(tcgaacccgtagctaatttg) m _sre.SRE_Match object at 0x8ea70 m.groups() ('a', 't', 'c', 'g') for i in range(1, len(atcg)+1): ... print m.group(i), m.start(i), m.end(i) ... a 3 4 t 9 10 c 16 17 g 27 28 Andrew [EMAIL PROTECTED] -- http://mail.python.org/mailman/listinfo/python-list
Dr. Dobb's Python-URL! - weekly Python news and links (May 24)
QOTW: If you're sick of answering newbie questions, and don't think you can do so politely, for the sake of the community, DON'T! You're not that necessary. - Joal Heagney Who controls the runtime also controls the language. - Kay Schluehr Jake tells us about the \r control character, which allows one to refresh a terminal line. Many people help him to use it from Python, and Fredrik warns him that it might well not work from an IDE: http://groups-beta.google.com/group/comp.lang.python/browse_thread/thread/50cffbb6eb03cc4 John Reese asks whether he needs to explicitly close file objects, or whether reference counting will take care of it for him. Martin v. Löwis shows a scenario that demonstrates that ref counting won't always close files when you think it will: http://groups-beta.google.com/group/comp.lang.python/browse_thread/thread/7eba2d6efd271707 Simon Percivall and Jp Calderone show Michael Chermside how to process subprocess module output a line at a time: http://groups-beta.google.com/group/comp.lang.python/browse_thread/thread/df6854ec10c6d508 WSGI Explorations with Python - Mike Orr investigates WSGI and Paste: http://rex.kicks-ass.net/python/wsgi-explorations.html Len, an old time Cobol programmer, asks for some advice on storing data: http://groups-beta.google.com/group/comp.lang.python/browse_thread/thread/c20623a77b22c456 Dustin is refactoring some unpythonic code that uses a very nasty import mechanism, but now he's having trouble with circular imports: http://groups-beta.google.com/group/comp.lang.python/browse_thread/thread/8eae5075b9973a2b A Matter Of Questions - Ben Last tells us how he's using Python for data cleansing, amongst other things, while building a Playstation Music Quiz: http://www.livejournal.com/users/benlast/24719.html William Park wants to test how similar two strings are. This is more complicated than it sounds... http://groups-beta.google.com/group/comp.lang.python/browse_thread/thread/4aa08f075d05eb48 Create an ODBC data source in the fly with Python: http://aspn.activestate.com/ASPN/Cookbook/Python/Recipe/414879 Paul Rubin investigates how the super() function works with multiple inheritance. A number of people clear things up for him. http://groups-beta.google.com/group/comp.lang.python/browse_thread/thread/57cdcc73f8747091 Notable releases: pysqlite 2.0.2 http://pysqlite.org/ PyPy 0.6 (!) http://groups-beta.google.com/group/comp.lang.python/browse_thread/thread/8e4a74dfb90c8bf4 Everything Python-related you want is probably one or two clicks away in these pages: Python.org's Python Language Website is the traditional center of Pythonia http://www.python.org Notice especially the master FAQ http://www.python.org/doc/FAQ.html PythonWare complements the digest you're reading with the marvelous daily python url http://www.pythonware.com/daily Mygale is a news-gathering webcrawler that specializes in (new) World-Wide Web articles related to Python. http://www.awaretek.com/nowak/mygale.html While cosmetically similar, Mygale and the Daily Python-URL are utterly different in their technologies and generally in their results. For far, FAR more Python reading than any one mind should absorb, much of it quite interesting, several pages index much of the universe of Pybloggers. http://lowlife.jp/cgi-bin/moin.cgi/PythonProgrammersWeblog http://www.planetpython.org/ http://mechanicalcat.net/pyblagg.html comp.lang.python.announce announces new Python software. Be sure to scan this newsgroup weekly. http://groups.google.com/groups?oi=djqas_ugroup=comp.lang.python.announce Steve Bethard, Tim Lesher, and Tony Meyer continue the marvelous tradition early borne by Andrew Kuchling, Michael Hudson and Brett Cannon of intelligently summarizing action on the python-dev mailing list once every other week. http://www.python.org/dev/summary/ The Python Package Index catalogues packages. http://www.python.org/pypi/ The somewhat older Vaults of Parnassus ambitiously collects references to all sorts of Python resources. http://www.vex.net/~x/parnassus/ Much of Python's real work takes place on Special-Interest Group mailing lists http://www.python.org/sigs/ The Python Business Forum further[s] the interests of companies that base their business on ... Python. http://www.python-in-business.org Python Success Stories--from air-traffic control to on-line match-making--can inspire you
Re: install python 2.4.1
thanks On 5/24/05, Trent Mick [EMAIL PROTECTED] wrote: [EMAIL PROTECTED] wrote] I use win xp pro. I wonder about this new version of python because I use Nummeric, pyro, combine with komodo and pydev ide in my python 2.4. If there is compatibility isue with the new version, it is better for me not to install the new version. There will be no compatibility issue with Komodo, at least. Nor should there be with the others, as Martin mentioned. Trent -- Trent Mick [EMAIL PROTECTED] -- http://mail.python.org/mailman/listinfo/python-list
Re: searching substrings with interpositions
[EMAIL PROTECTED] schrieb im Newsbeitrag news:[EMAIL PROTECTED] thanx everyone, is what i need. As Claudio argues, it's a standard problem of dna sequences comparation. the next step of my job is to make limits of lenght of interposed sequences (if someone can help me in this way i'll apreciate a lot) thanx everyone. giorgio Note: code below is intended to help to clarify things only, so that a bunch of examples can be tested. If you need bugfree production quality code, maybe someone else can provide it. I have introduced two additional parameter to the function. If intMaxLenOfGap == 0 the gap size doesn't matter. lstStartEndOfRangeOfBwithOccurenceOfA returns in its 0,1 elements the begin and end of the range strA was found in strB. Hope this does what you mean with make limits of lenght of interposed sequences, does it? Claudio P.S. Here the code: def blnFindCharSequenceAevenIfSpreadOverEntireStringB(strA, strB, intMaxLenOfGap = 0, lstStartEndOfRangeOfBwithOccurenceOfA = []): lstStartEndOfRangeOfBwithOccurenceOfA = [] intNoOfCharsFound = 0 intPtrToFirstCharFound = 0 intPtrToBeginOfSubsectionOfB = 0 intLenA = len(strA) intLenB = len(strB) blnStrAinB = False indxToA = 0 while(indxToA intLenA): # print chrA if(indxToA == 0): blnFoundChrA = False for indxToB in range(intPtrToBeginOfSubsectionOfB, intLenB): if(strA[indxToA] == strB[indxToB]): intNoOfCharsFound += 1 # print,chrA, strB[indxToB], indxToB intPtrToFirstCharFound = indxToB intPtrToBeginOfSubsectionOfB = indxToB + 1 blnFoundChrA = True break #:if #:for if(intNoOfCharsFound == intLenA): blnStrAinB = True print sequence '%s' found in '%s'%(strA, strB) break #:if if(blnFoundChrA == False): break #:if indxToA += 1 else: intGapLen = 0 blnFoundChrA = False for indxToB in range(intPtrToBeginOfSubsectionOfB, intLenB): if(strA[indxToA] == strB[indxToB]): intNoOfCharsFound += 1 # print,chrA, strB[indxToB], indxToB intPtrToBeginOfSubsectionOfB = indxToB + 1 blnFoundChrA = True break #:if intGapLen += 1 if(intMaxLenOfGap 0 and intGapLen intMaxLenOfGap): indxToA = 0 blnFoundChrA = False intPtrToBeginOfSubsectionOfB = intPtrToFirstCharFound + 1 intNoOfCharsFound = 0 break #:if #:for if(intNoOfCharsFound == intLenA): blnStrAinB = True print sequence '%s' found in '%s' at range(%i, %i)%(strA, strB, intPtrToFirstCharFound, indxToB+1) lstStartEndOfRangeOfB.append(intPtrToFirstCharFound) lstStartEndOfRangeOfB.append(indxToB+1) break #:if if(blnFoundChrA == False): break #:if indxToA += 1 #:if/else #:while if blnStrAinB == False: if(intMaxLenOfGap 0 and intGapLen intMaxLenOfGap): print sequence '%s' not in '%s' (maybe allowed gap of %i chars was too small?)%(strA, strB, intMaxLenOfGap) else: print sequence '%s' not in '%s'%(strA, strB) #:if #:def print lstStartEndOfRangeOfB = [] strA = 0101 strB = 0100 blnFindCharSequenceAevenIfSpreadOverEntireStringB(strA, strB) lstStartEndOfRangeOfB = [] strA = 0101 strB = 0100 blnFindCharSequenceAevenIfSpreadOverEntireStringB(strA, strB, 2) strA = 010101 strB = 0100 blnFindCharSequenceAevenIfSpreadOverEntireStringB(strA, strB, 6, lstStartEndOfRangeOfB) strA = 010101 strB = 01001 blnFindCharSequenceAevenIfSpreadOverEntireStringB(strA, strB, 4, lstStartEndOfRangeOfB) strA = 010101 strB = 01001 blnFindCharSequenceAevenIfSpreadOverEntireStringB(strA, strB, 5, lstStartEndOfRangeOfB) print print usage of lstStartEndOfRangeOfB parameter passed to function for use as return value: print sequence '%s' was found in '%s' at range(%i, %i)%(strA, strB, lstStartEndOfRangeOfB[0], lstStartEndOfRangeOfB[1]) -- http://mail.python.org/mailman/listinfo/python-list
Re: Hacking the scope to pieces
Maybe I misunderstood what you meant, but I couldn't quite manage to get this one working My initial hopes about __import__() were that I could define it inside my new module (moduleLoader) and, when the module is imported, it could do stuff (like try to hold onto the vars() and globals() from the importing scope). However, I couldn't get it to import... The route I've ended up going (which is just about as simple) is just to return the new module from moduleLoader.loadModule, so my loading code is: import moduleLoader myModule = moduleLoader.loadModule(myModule, os.getenv(MODULE_VERSION)) I've also switched over to using 'inp' for this, rather than creating a compiler string - much nicer Anyway, thanks Skip -- Hugh -- http://mail.python.org/mailman/listinfo/python-list
Tk and raw_input segfault
Python newbie disclaimer on I am running an app with Tkinter screen in one thread and command-line input in another thread using raw_input(). First question - is this legal, should it run without issue? If not can you point me to a description of why. While updating objects on the screen I get a segfault after an indeterminate number of updates. It doesn't seem to matter how quickly the updates occur, but it does segfault faster when there are more objects on the screen ( as I said failure time seems to have a random factor added to it ). Commenting out the raw_input() makes problem go away. I can schedule as many updates as I wish without error. And it doesn't seem to matter if I actually hit any keys for raw_input(), it can just sit there. I have read other posts about readline library failures with Esc O M sequences and could not recreate those failures. This happens on 2 separate machines 1st: development workstation tk-8.4.6-28 tcl-8.4.6-23 Python 2.3.3 (#1, Feb 5 2005, 16:30:27) [GCC 3.3.3 (SuSE Linux)] on linux2 Linux name deleted 2.6.5-7.151-smp #1 SMP Fri Mar 18 11:31:21 UTC 2005 x86_64 x86_64 x86_64 GNU/Linux 2nd: target machine tk-8.4.6-37 tcl-8.4.6-26 Python 2.3.3 (#1, Apr 6 2004, 01:47:39) [GCC 3.3.3 (SuSE Linux)] on linux2 Linux name deleted 2.6.4-52-default #1 Wed Apr 7 02:08:30 UTC 2004 i686 i686 i386 GNU/Linux I have tried to simplify the code as much as possible to make error more visible( no actual updates of the screen etc ) I've uncommented the after code line so it fails much more rapidly. I know its ugly repeatedly scheduling the after but, the same code runs without the raw_input, and it shows the error more readily. To see the error start the code and click the button repeatedly until it segfaults. It will still segfault if you remove the 'command' funtion and call update dirctly - it just takes a bit longer and your wrist will probably get tired. Thanks in advance for any responses. -- from Tkinter import * from time import sleep import thread class Test(Frame): def __init__(self, parent=None): Frame.__init__(self, parent, bg='white') # Button Definition: CLEAR ALL OUTPUTS caB = Button( self, text='CLEAR ALL\nOUTPUTS',\ #command = (lambda: self.update()) ) command = (lambda: self.command()) ) caB.pack() self.updateCount = 0 self.commanded = 0 self.update() def command( self ): self.commanded = 1 self.update() def update( self ): self.updateCount += 1 print 'updatin... num = ', self.updateCount self.after( 1, self.update ) def test(): root = Tk() root.geometry('640x480') Test().pack() root.mainloop() if __name__ == '__main__': scanTID= thread.start_new_thread( test, () ) sleep(1) while True: f= raw_input() print 'f=', f sleep(1) -- http://mail.python.org/mailman/listinfo/python-list
RE: line-by-line output from a subproce
I wrote: I am using the subprocess module to invoke a command-line utility [...] I would like to process the output line-by-line [...] rather than running [...] to completion Simon Percivall writes: Okay, so the reason what you're trying to do doesn't work is that the readahead buffer used by the file iterator is 8192 bytes, which clearly might be too much. Jp Calderone writes: def iterread(fobj): return iter(fobj.readline, '') Thanks folks... that did it nicely! -- Michael Chermside -- http://mail.python.org/mailman/listinfo/python-list
Creating methods depending on packages that have been installed
Dear All, What is the best way of creating methods depending on the packages that have been installed. A silly example is try: import somepack class hello: def __init__(self): print 'hi' def some(self): print 'some' except: class hello: def __init__(self): print 'hi' This is obviously not what I want - since it looks ugly and I wish to test for lots packages. Any ideas? Thanks Colin -- http://mail.python.org/mailman/listinfo/python-list
Re: reference counting and file objects
Martin v. Löwis wrote: Paul Rubin wrote: Consider the function above. Do I need the fp.close(), or will the file be closed automatically when fp goes out of scope and its reference count drops to zero? In CPython, fp gets closed when it leaves scope. One issue is that when the function terminates through an exception, the file stays open as long as the traceback is available, which exists until the next exception is raised (and thus replaces this traceback). If the function terminates normally (i.e. through return), it is as you say. Regards, Martin Does the idiom: lines = file(myfile,r).readlines() have any better guarantee of being closed automatically? Peter -- http://mail.python.org/mailman/listinfo/python-list
Re: PIL and line drawing
rzed [EMAIL PROTECTED] wrote: if you have 1.1.5, you can use the width option to control the line width. see: I'm glad to see that addition. I was surprised to see that 'width' is actually doubled in the resulting line, though. I suppose the code adds and subtracts the specified width from the specified coordinate point(?). hmm. that sure sounds a lot like a bug I though I had fixed. /F -- http://mail.python.org/mailman/listinfo/python-list
Python 2.4.1 installation problem
Hi, I am trying to install 2.4.1 on a new machine and have the following problems. 1) I'm on MDK 10.1 2) The system had 2.3.4 installed in /usr , I deleted the lib 3) I ran ./configure --prefix=/usr, then make, then make install, everything went OK If I run Python, I get File /etc/pythonrc.py, Line 2 in ? ImportError: no module readline I also tried to run one of my script and got an import error on bz2. I have 2.4.1 running OK on another machine with the exact same distro. Any clue ? Thanks, Philippe -- http://mail.python.org/mailman/listinfo/python-list
Re: Dr. Dobb's Python-URL! - weekly Python news and links (May 24)
Simon Brunning wrote: QOTW: If you're sick of answering newbie questions, and don't think you can do so politely, for the sake of the community, DON'T! You're not that necessary. - Joal Heagney Taken out of context, Joal's comments might seem a bit rude and abrasive - I don't think they were meant that way. People really should look at the context of the quote - it'a actually a very constructive suggestion. (If the direct link works:) http://groups-beta.google.com/group/comp.lang.python/msg/6330925dcecb6bdb (If not, go to http://groups.google.com and search Joal Heagney politely group:comp.lang.python Click on the Python Polymorphism thread.) -- http://mail.python.org/mailman/listinfo/python-list
Re: Build error Python 2.4.1 - stat problem?
In article [EMAIL PROTECTED], [EMAIL PROTECTED] wrote: ... I used the python executable from the build directory to run the following program: import os def main(): if not (os.path.exists(/)): print / does not exist else: print / exists if not (os.path.isdir(/)): print / is not a directory else: print / ok if name == main : main() The output is: / exists / is not a directory It's the same for every (existing) directory name I try: os.path.isdir() always returns false. It looks as if the stat results are not recognised: os.path.exists() works, but all the functions os.path.isdir(), os.path.isfile() etc. don't. Could anyone help me to solve the problem? Unless there are other Reliant users here ahead of you, some of it is going to be up to you. If you follow isdir() back, you'll find some hard-coded octal bitmask definitions, including S_IFDIR = 004. Check it out. Try to use that value the way they're using it, in C and in Python, and print out all the values involved. At worst, if C comes out wrong too, you may have a question that the vendor will be more likely to respond to. Donn Cave, [EMAIL PROTECTED] -- http://mail.python.org/mailman/listinfo/python-list
Re: staticmethod and classmethod
C Gillespie [EMAIL PROTECTED] wrote in message news:[EMAIL PROTECTED] Hi, Does anyone know of any examples on how ( where) to use staticmethods and classmethods? A python class method is closer to a Java static method than a python static method. Class methods can be useful if you want to be able to change objects in the class, or if you want to be able to use inheritance, neither of which python static methods allow you to do cleanly. Another, and rather esoteric use, is to use the class as its own instance. I find that static methods are useful when I want to import a class from a module, and don't want to import the module itself or a lot of bits and pieces from the module. The class gives a place to park the method, and also lets you use inheritance, neither of which putting it into the module does. John Roth Thanks Colin -- http://mail.python.org/mailman/listinfo/python-list
Re: py2exe for WMI
Tim Golden schrieb: [Thomas Heller] [... snip problems with py2exe WMI ...] | The OP of the thread Tim mentions here already had a solution, if I | understood him correctly, and the other things that were suggested | didn't work. Basically, IIUC, he did add the typelib | wrappers from the | 'other' windows version manually to the library.zip file. | | Totally different solutions would be: | - change Tim's wmi.py module so that it works with dynamic | binding (no | typelib wrappers needed) | or Well, if it helps, there's a version of the WMI module that uses dynamic binding on my site: http://timgolden.me.uk/python/downloads/wmi-0.6a.py I've hardcoded the relevant constants (which is pretty much all I was using early binding for) and replaced any other EnsureDispatch calls with simple Dispatch. It may be dangerous since the constants may or may not be the same on different versions, at least in theory. I've appended a small module which allows to bind constants from the type library at runtime. Not much error checking, but you may get the idea. I'll leave providing a proper patch for pywin32, if it makes sense, to those that have more time ;-) Does anyone want to give it a try to let me know if it helps? I don't use py2exe myself. The simple test case I have works on XP (I don't use wmi myself, except as sample for py2exe). Thomas # constants.py class ProvideConstants(object): A class which, when called on a win32com.client.Dispatch object, provides lazy access to constants defined in the typelib. They can be accessed as attributes of the _constants property. def __init__(self, comobj): comobj.__dict__[_constants] = self # Get the typelibrary's typecomp interface self.__typecomp = \ comobj._oleobj_.GetTypeInfo().GetContainingTypeLib()[0].GetTypeComp() def __getattr__(self, name): if name.startswith(__) and name.endswith(__): raise AttributeError, name result = self.__typecomp.Bind(name) # Bind returns a 2-tuple, first item is TYPEKIND, # the second item has the value if not result[0]: raise AttributeError, name return result[1].value if __name__ == __main__: from win32com.client import Dispatch d = Dispatch(WbemScripting.SWbemLocator) ProvideConstants(d) print d._constants.wbemImpersonationLevelAnonymous print d._constants.wbemImpersonationLevelDelegate -- http://mail.python.org/mailman/listinfo/python-list
Re: Hacking the scope to pieces
Hugh Macdonald wrote: We're starting to version a number of our python modules here, and I've written a small function that assists with loading the versioned modules... A module would be called something like: myModule_1_0.py In anything that uses it, though, we want to be able to refer to it simply as 'myModule', with an environment variable (MYMODULE_VERSION - set to 1.0) that defines the version. Another technique that you might want to consider, is to have an explicit require call in the code, instead of an external environment variable. The python gtk interface, pygtk, is used like so: import pygtk pygtk.require('1.5') import gtk -- or import pygtk pygtk.require('2.0') import gtk I imagine you could eliminate the extra import gtk step, by clever coding of the import hook. You can find pygtk at: http://ftp.gnome.org/pub/GNOME/sources/pygtk/2.4/pygtk-2.4.1.tar.gz I've written a module called 'moduleLoader' with the follwing function in: def loadModule(module, version, v = globals()): import compiler loadStr = import %s_%s as %s % (module, version.replace(., _), module) eval(compiler.compile(loadStr, /tmp/%s_%s_errors.txt % (module, version.replace(., _)), single)) v[module] = vars()[module] The ideal situation with this would be to be able, in whatever script, to have: import moduleLoader moduleLoader.loadModule(myModule, os.getenv(MODULE_VERSION)) However, this doesn't work. The two options that do work are: import moduleLoader moduleLoader.loadModule(myModule, os.getenv(MODULE_VERSION), globals()) import moduleLoader moduleLoader.loadModule(myModule, os.getenv(MODULE_VERSION)) from moduleLoader import myModule What I'm after is a way of moduleLoader.loadModule working back up the scope and placing the imported module in the main global scope. Any idea how to do this? -- Hugh Macdonald -- http://mail.python.org/mailman/listinfo/python-list
Re: Running a python program during idle time only
Yes it should. The problem is that I notice a loss in performance when the program is running at 100% CPU. Even though it is nice, if you try to open up new applications, or switch between them, you notice your computer lagging a little bit. That's why even though I'm not using the cpu that much as I'm just reading my email, or browsing the web, I wouldn't necessarily want the indexing program to be running at full pace. If you use google's desktop program, you'll notice that once the computer has been idle for a few minutes your CPU will go to 100%, but as soon as you move your mouse, or hit a keystroke the cpu will drop to 5-10% usage. That's the behavior I'm trying to achieve. Thanks David for your suggestions. That seems to be what I was looking for. I'm going to try to incorporate those changes in my code and see what I can come up with. Thanks for everyone who responded as well. I really appreciate it. -los -- http://mail.python.org/mailman/listinfo/python-list
Re: Python 2.4.1 installation problem
I had not realized (silly me) that Python might need external libraries in order to support specific modules. I have installed the bz2 and readline devel packages re-configured/made and everythin os now working. Philippe C. Martin wrote: Hi, I am trying to install 2.4.1 on a new machine and have the following problems. 1) I'm on MDK 10.1 2) The system had 2.3.4 installed in /usr , I deleted the lib 3) I ran ./configure --prefix=/usr, then make, then make install, everything went OK If I run Python, I get File /etc/pythonrc.py, Line 2 in ? ImportError: no module readline I also tried to run one of my script and got an import error on bz2. I have 2.4.1 running OK on another machine with the exact same distro. Any clue ? Thanks, Philippe -- http://mail.python.org/mailman/listinfo/python-list
Re: first release of PyPy
so what could this PyPy do in the future ? .. concretely ... hope this is not a stupid question -- ionel. -- http://mail.python.org/mailman/listinfo/python-list
Re: What are OOP's Jargons and Complexities?
Andreas Rottmann wrote: You get terminology totally wrong here. As already said, Lisp is stronger typed than C, but C is statically typed, whereas Lisp is dynamically typed. In Lisp (or Scheme), all variables have types: (define foo #(1 2 3)) (vector? foo) = #t (boolean? foo) = #t Hmm.. weird Scheme you're using here. Normally you have to quote the vector (see R5RS, 6.2.6) because it is not self-evaluating, and boolean? should not return true on vectors (6.3.1). I get (on scheme48): (define foo '#(1 2 3)) (vector? foo) = #t (boolean? foo) = #f mkb. -- http://mail.python.org/mailman/listinfo/python-list
Re: Encryption with Python?
For your own good, please change your credit card number now! You have obviously lost your mind. Please read Applied Cryptography if you are wondering why I would say this. I am not trying to be mean. For example: I have access to 80 Pentium 3 cpus (at ~1.8 GHz) and have engineered a simple brute force on this (in pure python) that can check 2**31 integers overnight. I timed it. I used absolutely NO optimization. Also, beyond these 2**31 integers, I stopped trying because I have other things to do--I had no incentive. Now your credit card info is on the line. I'm a rank ammy and I'm sure a skilled programmer could speed it up 100 to 1000 fold (1000 ~ 2**10). Also, this was for your first message about which I knew positively nothing. You have made the job now several times easier (lets say 10 ~ 2**3) by disclosing the nature of the plain text. If you think that there are lots of keys that map some part of your cipher text to a set of 16 numbers (+/-) separators, you are right. But they would be some small fraction of the total keyspace. 10**6 such keys could be stored easily and so second and later rounds of analysis would be trivial. So lets do some math. Say someone had the same computing power as I do. Say, we could start with 2**32 keys in 24 hours or 1 day. Now lets say they are a good programmer: 2**32 * 2**10 keys/day. Now lets say they take full advantage of knowing the nature of the plain text: 3**32 * 2**10 * 2**3. Lets say they put 2 weeks of computing time into it: 14 days ~ 2**4 days. Of course both + and - integers are possible, so we'll divide our final answer by 2 later. So, say you had a highly motivated, reasonably adept programmer whose lack of cryptanalysis knowledge limited himself to brute force--but he had a lot of computers and 2 weeks to work with--and was checking both + and - integers: 2**(32+10+3+4-1) = 281474976710656 That's 15 digits. That is a telephone number (with area code) and a 5 digit zip. That's 2 birthdays, easy. That is easily the hash of any hashable python object (only 2**32 possibilities for these). Do you get the point? Basically, these 15 digits are about the limit of any managable key. Now, lets say you have someone skilled at cryptanalysis. Well, they are probably already trying to figure out what they want to buy first. Normally I wouldn't warn you of this, but I am positively certain that someone smarter than me will be spending on your credit card and I want to spoil their holiday. James On Tuesday 24 May 2005 01:16 am, Anthra Norell wrote: I wasn't going to pursue this any further. Actually, I am quite disappointed about the belligerent style of some correspondents. It's not necessary. It spoils the fun. It cloggs bandwidth. Why whack someone over the head who tries to develop an idea of his own. Such an approach isn't uncommon to earn extra credit in educational settings. True, I have also been offered good advice and being able to extract it from between insuslts I have expressed my appreciation for it. In return of the favor I offer a little anecdote about the nature of creativeness. The connection between candor and creativeness has always fascinated me. At some point, almost thirty years ago, I came across an article in a hang glider magazine by one Dr. Paul MacCready who had just won the Kremer Prize with his human-powered Gossamer Condor, a prize that had been standing for decades despite innumerable unsuccessful attempts to win it. In that article MacCready explained that it was the advent of hang gliders that gave him the idea to go for the Kremer prize. Namely, he immediately realized that hang gliders dissipated less energy in stable flight than any other aircraft in existence, not because the flew so well--they didn't--but because of their low weight. He calculated that a twenty-kilogram hang glider with a wing span of close to thirty meters would dissipate no more than one third of a horse power or thereabout and that is an amount of energy a competition cyclist generates over the course of a race. After winning the prize, MacCready challenged himself to fly across the English channel and started building an improved second version of his airplane. Passing through Los Angeles I went to see the project in a Long Beach hangar and took the opportunity to pick MacCready's brain for the benefit of our own magazine. Referring to his article I confessed my surprise that a scientist of his caliber would be inspried by such crude aeronautical engineering hacks as hang gliders unquestionably were. His reply was this: I also consider myself an amateur. I have a PhD in aeronautics, but not in aeronautical engineering. But this just might have been my advantage. All these many previous failed attempts had been made by people with better engineering credentials. If their conception of possible solutions was better defined, it was probably also more constrained by
pygame 1.6 for windows (python2.4)
Hi All, Does anyone have any info concerning the windows pygame 1.6 for python2.4? It doesn't seem to be available yet. Will pygame1.6 for python23 work with python24? Thanks for any help concerning this. BC -- http://mail.python.org/mailman/listinfo/python-list
Re: Just remember that Python is sexy
:-) -- http://mail.python.org/mailman/listinfo/python-list
Re: first release of PyPy
ionel wrote: so what could this PyPy do in the future ? .. concretely ... hope this is not a stupid question Maybe the description from the homepage says it best: The PyPy project aims at producing a flexible and fast Python implementation. The guiding idea is to translate a Python-level description of the Python language itself to lower level languages. Rumors have it that the secret goal is being faster-than-C which is nonsense, isn't it? Regards, Carl Friedrich -- http://mail.python.org/mailman/listinfo/python-list
Linuz Python Module using PythonC/ API
I have this error message poping up when I try to import a module I made in C using the Python/C API. Everything compiles like a charm. Gives me this error message : Traceback (most recent call last): File mod_test.py, line 4, in ? import utm ImportError: dynamic module does not define init function (initutm) but the initutm function is there. Running on Fedora Core 3. Thanx David P.S Other question is there a command to know what export symbols a .so library has ? Relevant files below. utmmodule.c -- #include Python.h #include utm.h PyMODINIT_FUNC initutm(void); static PyObject * utm_utm_to_ll(PyObject * self, PyObject * args); static PyObject * utm_ll_to_utm(PyObject * self, PyObject * args); static PyObject * utm_zone(PyObject * self, PyObject * args); static PyObject * utm_grid(PyObject * self, PyObject * args); static PyObject * utm_trans_list(PyObject * self, PyObject * args); static PyObject * utm_transform(PyObject * self, PyObject * args); // /*! \var static PyObject * UTMError \brief UTM Python Module error handling object */ // static PyObject * UTMError; // /*! \var static PyMethodDef UTMMethods \brief UTM Python Module function list */ // static PyMethodDef UTMMethods[] = { {utm_to_ll, utm_utm_to_ll, METH_VARARGS, Converts UTM coordinates to Lat/Long using the input UTM zone number and letter and tranformation.}, {ll_to_utm, utm_ll_to_utm, METH_VARARGS, Converts Lat/Long coordinates to UTM using the input transformation.}, {zone, utm_zone, METH_VARARGS, Returns the UTM longitude zone number.}, {grid, utm_grid, METH_VARARGS, Returns the UTM latitude zone letter (C to X) - omiting chars I and O.\nReturns Z if Latitude value out of UTM bounds 84N - 80S.}, {trans_list, utm_trans_list, METH_VARARGS, Returns the list of available ellipsoid transformations in a list.}, {transform, utm_transform, METH_VARARGS, Returns the tranform index based on the transform type string, EX: 'WGS 84' returns index 29}, {NULL, NULL, 0, NULL}/* Sentinel */ }; // /*! \fn PyMODINIT_FUNC initutm(void) \brief Python Module __init__() function This function is called when the module is loaded by Python. It creates a mapping of the python module commands linked to their C counterpart in the DLL/SO module. It also creates an error handling Python object (UTMError). */ // PyMODINIT_FUNC initutm(void) { PyObject *m; m = Py_InitModule( utm, UTMMethods ); UTMError = PyErr_NewException( utm.error, NULL, NULL ); Py_INCREF( UTMError ); PyModule_AddObject( m, error, UTMError ); } -- makefile important lines --- CC=g++ CFLAGS=-Wall -I/usr/local/src/Python-2.3.5/Include -L/usr/local/src/Python-2.3.5/Objects -L/usr/local/src/Python-2.3.5 LDFLAGS= all: main main: utm.o utmmodule.o $(CC) $(CFLAGS) -shared -fPIC -Xlinker -export-dynamic -lpython2.3 -o utm.so --- -- http://mail.python.org/mailman/listinfo/python-list
Re: python24.zip
Robin Becker wrote: if the importers are tested statically how does a filesystem path ever manage to get back into the loop if it was ever found missing? In other words if things (eg python24.zip) are found not importable/usable in one pass how do they get reinstated? I think (but see the code yourself) that only the successful importers are cached. Regards, Martin -- http://mail.python.org/mailman/listinfo/python-list
Re: reference counting and file objects
Peter wrote: Does the idiom: lines = file(myfile,r).readlines() have any better guarantee of being closed automatically? Yes. The file object only lives on the evaluation stack, and that is discarded in any case when the function terminates (whether through a return or through an exception). In addition, the object is released as soon as readlines returns. Regards, Martin -- http://mail.python.org/mailman/listinfo/python-list
Re: pygame 1.6 for windows (python2.4)
bc wrote: Hi All, Does anyone have any info concerning the windows pygame 1.6 for python2.4? It doesn't seem to be available yet. Will pygame1.6 for python23 work with python24? Have you been to the site? 1.6 is available, and there are versions for Python2.3 and Python2.4 http://www.pygame.org/download.shtml Will McGugan -- http://www.willmcgugan.com .join( [ {'*':'@','^':'.'}.get(c,None) or chr(97+(ord(c)-84)%26) for c in jvyy*jvyyzpthtna^pbz ] ) -- http://mail.python.org/mailman/listinfo/python-list
Re: reference counting and file objects
Martin v. Löwis [EMAIL PROTECTED] writes: lines = file(myfile,r).readlines() have any better guarantee of being closed automatically? Yes. The file object only lives on the evaluation stack, and that is discarded in any case when the function terminates (whether through a return or through an exception). In addition, the object is released as soon as readlines returns. It's released even if the exception is raised inside readlines? -- http://mail.python.org/mailman/listinfo/python-list
Re: PIL and line drawing
Fredrik Lundh [EMAIL PROTECTED] wrote in news:[EMAIL PROTECTED]: rzed [EMAIL PROTECTED] wrote: if you have 1.1.5, you can use the width option to control the line width. see: I'm glad to see that addition. I was surprised to see that 'width' is actually doubled in the resulting line, though. I suppose the code adds and subtracts the specified width from the specified coordinate point(?). hmm. that sure sounds a lot like a bug I though I had fixed. Ah, I see that I was using VERSION = 1.1.5b1 which I have now upgraded to 1.1.5. Retesting ... nope, same thing. Specifying a width of 10, I get a line of width 20. ImageDraw shows: # $Id: ImageDraw.py 2134 2004-10-06 08:55:20Z fredrik $ -- rzed -- http://mail.python.org/mailman/listinfo/python-list
Re: Dr. Dobb's Python-URL! - weekly Python news and links (May 24)
In article [EMAIL PROTECTED], Rocco Moretti [EMAIL PROTECTED] wrote: Simon Brunning wrote: QOTW: If you're sick of answering newbie questions, and don't think you can do so politely, for the sake of the community, DON'T! You're not that necessary. - Joal Heagney Taken out of context, Joal's comments might seem a bit rude and abrasive - I don't think they were meant that way. People really should look at the context of the quote - it'a actually a very constructive suggestion. (If the direct link works:) http://groups-beta.google.com/group/comp.lang.python/msg/6330925dcecb6bdb . . . General principle: if in doubt about the significance of an item in Python-URL!, assume that it's intended in a constructive way. In our emphasis on brevity, though, we sometimes abbreviate to the point that ambiguity obscures the civility. Thanks to Mr. Moretti for his well-referenced observation. -- http://mail.python.org/mailman/listinfo/python-list
Re: Is Python suitable for a huge, enterprise size app?
Dieter Maurer wrote: Could you elaborate a bit? Large peak memory use means that the application got a large address space. What garantees that the residual memory use (after the peak) is compact and not evenly spread across the address space. nothing guarantees that, of course. but I've never seen that happen. and I'm basing my comments on observed behaviour in real systems, not on theoretical worst-case scenarios. every time I've seen serious fragmentation, it's been related to leaks, not peak memory usage. /F -- http://mail.python.org/mailman/listinfo/python-list
Re: Linux Python Module using PythonC/ API
Hi Jeff thanx for the reply I'm a complete noob when it comes to Linux and trying to learn how to manage the compilation process of the same objects that work on windows. The complete linking line is this. -- all: main main: utm.o utmmodule.o $(CC) $(CFLAGS) -shared -fPIC -Xlinker -export-dynamic -lpython2.3 -o utm.so --- If you could direct me into how to properly link the stuff into the .so file, I'd appreciate it. I will check to see if the symbols are effectively exported to the .so file. In windows I found it pretty easy to create the module files as dlls. Thanx David -- http://mail.python.org/mailman/listinfo/python-list
Re: python24.zip
Steve Holden [EMAIL PROTECTED] writes on Sun, 22 May 2005 16:19:10 -0400: ... Indeed I have written PEP 302-based code to import from a relational database, but I still don't believe there's any satisfactory way to have [such a hooked import mechanism] be a first-class component of an architecture that specifically requires an os.py to exist in the file store during initialization. I wasn't asking for an import hook mechanism (since I already knew these to exist), but for a way to allow such mechanisms to be the sole import support for certain implementations. We do not have os.py (directly) on the file system. It lives (like everything else) in a zip archive. This works because the zipimporter is put on sys.path_hook before the interpreter starts executing Python code. Thus, all you have to do: use a different Python startup and ensure that you special importer (able to import e.g. os) is already set up, before you start executing Python code. Dieter -- http://mail.python.org/mailman/listinfo/python-list
Re: python24.zip
Martin v. Löwis [EMAIL PROTECTED] writes on Sun, 22 May 2005 21:24:41 +0200: ... What do you mean, unable to? It just doesn't. The original question was: why does Python put non-existing entries on 'sys.path'. Your answer seems to be: it just does not do it -- but it might be changed if someone does the work. This fine with me. ... In the past, there was a silent guarantee that you could add items to sys.path, and only later create the directories behind these items. I don't know whether people rely on this guarantee. I do not argue that Python should prevent adding non-existing items on path. This would not work as Python may not know what existing means (due to path_hooks). I only argue that it should not *itself* (automatically) put items on path where it knows the responsible importers and knows (or can easily determine) that they are non existing for them. ... The application was Zope importing about 2.500 modules from 2 zip files zope.zip and python24.zip. This resulted in about 12.500 opens -- about 4 times more than would be expected -- about 10.000 of them failing opens. I see. Out of curiosity: how much startup time was saved when sys.path was explicitly stripped to only contain these two zip files? I cannot tell you precisely because it is very time consuming to analyse cold start timing behavior (it requires a reboot for each measurement). We essentially have the following numbers only: warm startcold start (filled OS caches)(empty OS caches) from file system5s 13s from ZIP archives 4s 8s frozen 3s 5s The ZIP archive time was measured after a patch to import.c that prevents Python to view a ZIP archive member as a directory when it cannot find the currently looked for module (of course, this lookup fails also when the archive member is viewed as a directory). Furthermore, all C-extensions were loaded via a meta_path hook (and not sys.path) and sys.path contained just the two Zip archives. These optimizations led to about 3.000 opens (down from originally 12.500). I would expect that importing 2500 modules takes *way* more time than doing 10.000 failed opens. You may be wrong: searching for non existing files may cause disk io which is several orders of magnitude slower that CPU activities. The comparison between warm start (few disc io) and cold start (much disc io) tells you that the import process is highly io dominated (for cold starts). I know that this does not prove that the failing opens contribute significantly. However, a colleague reported that the import.c patch (essential for the reduction of the number of opens) resulted in significant (but not specified) improvements. Dieter -- http://mail.python.org/mailman/listinfo/python-list
PAM authentication?
I would like my application to be able to authenticate through PAM. Is there any code out there that implements this? All I could find was PyPAM (http://www.pangalactic.org/PyPAM/), which doesn't look like it has been touched in almost 6 years and requires python1.5. -- http://mail.python.org/mailman/listinfo/python-list
Re: I want to ask you the most important question of your life. The question is: Are you saved? It is not a question of how good you are, nor if you are a church member, but are you saved? Are you sure you will go to Heaven when you die? The reason some people don't know for sure if they are going to Heaven when they die is because they just don't know. The good news is that you can know for sure you are going to Heaven. May 24, 2005 10:49:20 am
In comp.os.linux.advocacy, [EMAIL PROTECTED] [EMAIL PROTECTED] wrote on 24 May 2005 07:48:47 -0700 [EMAIL PROTECTED]: THE MOST IMPORTANT QUESTION OF YOUR LIFE This is the most important question of your life. The question is: Are you saved? I'm tempted to ask if you're *shaved* (I'm not). Why you're asking this in technical groups is far from clear. God doesn't care if you're using Python, C, Matlab, Linux, or OSX, at least, not as far as I know. It is vaguely possible that the Almighty has in fact upgraded his internal communications network to include TCP/IP, MBone, and Etherial Prayer Protocol (EPP), but I'd prefer to see hard evidence. Followups to a slightly more logical place. :-) [rest snipped] -- #191, [EMAIL PROTECTED] It's still legal to go .sigless. -- http://mail.python.org/mailman/listinfo/python-list
Re: pygame 1.6 for windows (python2.4)
Thanks for the reply, Will... I have been to the site, but I get a URL not found error when I try the pygame 1.6 for python24 link; I guess I will just keep trying until the HTML is fixed. -- http://mail.python.org/mailman/listinfo/python-list
Re: PAM authentication?
Gary Wilson Jr wrote: I would like my application to be able to authenticate through PAM. Is there any code out there that implements this? All I could find was PyPAM (http://www.pangalactic.org/PyPAM/), which doesn't look like it has been touched in almost 6 years and requires python1.5. You can still use it. However what I don't like about it is that you need to run as root to actually use PAM. Otherwise the process can only authenticate its (effective?) user. So I switched to LDAP - and would like to see sasld being supported, but so far it's not wrapped I haven't found the time to do it myself. Diez -- http://mail.python.org/mailman/listinfo/python-list
Re: searching substrings with interpositions
Claudio Grondi wrote: Note: code below is intended to help to clarify things only, so that a bunch of examples can be tested. If you need bugfree production quality code, maybe someone else can provide it. Still not tested enough to ensure that it's bug free, but more concise. Here's one the implements the algorithm directly and another that uses a regexp. The latter should be the preferred approach. My intent was that the algorithm implements the given pattern so they should given identical results. # Doing the work ourselves def find_spread_substring(query, target, limit = None): stack = [] ti = qi = 0 Nq = len(query) Nt = len(target) delta = 0 while ti Nt: # We have a match if query[qi] == target[ti]: stack.append( (qi, ti, delta) ) qi = qi + 1 if qi == Nq: return [ti for (qi, ti, delta) in stack] ti = ti + 1 delta = 0 else: # No match while 1: # If we have a partial match, check if we've # gone over the limit. if stack: delta = delta + 1 if limit is not None and delta limit: # backtrack, treating it as an invalid match # (so retry this 'else:' block) qi, ti, delta = stack.pop() continue # No backtracking needed break # Advance to check the next character in the target ti = ti + 1 # Failure return None # Using regular expressions import re def find_spread_substring2(query, target, limit = None): if limit is None: template = (%s).*? else: template = (%%s).{,%d}? % (limit,) terms = [template % c for c in query] pattern = .join(terms) pat = re.compile(pattern) m = pat.search(target) if not m: return None return [m.start(i) for i in range(1, len(query)+1)] def test(): for (q, t, limit, is_valid) in ( (1010, 10001001, None, True), (1010, 100011, None, False), (1010, 100010, 3, True), (1010, 100010, 1, True), (1010, 110, 1, False), (1010, 0110, 2, True), (1010, 0110, 1, False), (1010, 010, None, False), ): result = find_spread_substring(q, t, limit) result2 = find_spread_substring2(q, t, limit) if result != result2: raise AssertionError( (result, result2) ) if result is not None: if limit is not None: # check that it's a proper subset for (x, y) in zip(result[:-1], result[1:]): # +1 because 'limit' is the maximum gap size if (y-x) limit+1: raise AssertionError((q, t, limit, result, x, y)) s = .join([t[i] for i in result]) if s != q: raise AssertionError((q, t, limit, result, s)) if result is None and not is_valid: pass elif result is not None and is_valid: pass else: raise AssertionError( (q, t, limit, is_valid, result) ) if __name__ == __main__: test() print All tests passed. Andrew [EMAIL PROTECTED] -- http://mail.python.org/mailman/listinfo/python-list
Re: python24.zip
Dieter Maurer wrote: The comparison between warm start (few disc io) and cold start (much disc io) tells you that the import process is highly io dominated (for cold starts). Correct. However, I would expect that the contents of existing directories is cached, and it might be that the absence of a directory on sys.path is also cached (I know Linux does negative dentry caching). I know that this does not prove that the failing opens contribute significantly. However, a colleague reported that the import.c patch (essential for the reduction of the number of opens) resulted in significant (but not specified) improvements. When I experimented with startup time for 2.4, I found that these calls don't matter at all in any significant way (atleast not for warm starts). Instead, I found that reducing the size of .pyc files, by sharing interned strings, gives more speedup (and indeed, 2.4 changed the marshal format to accommodate shared interned strings). So I would agree that IO makes a significant part of startup, but I doubt it is directory reading (unless perhaps you have an absent NFS server or some such). Regards, Martin -- http://mail.python.org/mailman/listinfo/python-list
Re: pygame 1.6 for windows (python2.4)
bc wrote: Thanks for the reply, Will... I have been to the site, but I get a URL not found error when I try the pygame 1.6 for python24 link; I guess I will just keep trying until the HTML is fixed. Does seem to be broken at the moment. I've uploaded a copy to my server.. http://www.willmcgugan.com/pygame-1.6.win32-py2.4.exe Will -- http://www.willmcgugan.com .join( [ {'*':'@','^':'.'}.get(c,None) or chr(97+(ord(c)-84)%26) for c in jvyy*jvyyzpthtna^pbz ] ) -- http://mail.python.org/mailman/listinfo/python-list