[Samtools-help] Problems with picard 1.119. CollectAlignmentMetrics and CollectInsertSizeMetrics
Hi, When I run CollectAlignmentMetrics and CollectInsertSizeMetrics using the latest Picard 1.119 I get the following error message. The same command line when run on a previous version of Picard (tried 1.107 and 1.96) runs without issues and produces output. The BAM file was generated using STAR and was sorted using Picard SortSam. Thanks in advance for your help K Picked up _JAVA_OPTIONS: -Djava.io.tmpdir=/scratch/RED/tmp/ [Wed Oct 08 00:15:12 PDT 2014] picard.analysis.CollectInsertSizeMetrics HISTOGRAM_FILE=/gpfs/scratch/RED/tmp/InsertSize/3966/gpfs/archive/RED/RNA-Seq/Processed/STARaln.human-bamQC-SortByCo ordinates/InsertSize/O2_5.InsertSize.pdf METRIC_ACCUMULATION_LEVEL=[ALL_READS] INPUT=/gpfs/scratch/RED/tmp/InsertSize/3966/gpfs/archive/RED/RNA-Seq/Processed/STARaln.human-bamfiles-SortByC oordinates/O2_5.coord.bam OUTPUT=/gpfs/scratch/RED/tmp/InsertSize/3966/gpfs/archive/RED/RNA-Seq/Processed/STARaln.human-bamQC-SortByCoordinates/InsertSize/O2_5.InsertSize.qcstats REFERENCE _SEQUENCE=/gpfs/scratch/RED/tmp/InsertSize/3966/gpfs/reference/v1/Homo-sapiens/GRCh37.p12/WholeGenome/genome.fa TMP_DIR=[/scratch/RED/tmp/InsertSize/3966] VERBOSITY=WARN ING VALIDATION_STRINGENCY=SILENTDEVIATIONS=10.0 MINIMUM_PCT=0.05 ASSUME_SORTED=true STOP_AFTER=0 QUIET=false COMPRESSION_LEVEL=5 MAX_RECORDS_IN_RAM=50 CREATE_INDEX=false CREATE_MD5_FILE=false [Wed Oct 08 00:15:12 PDT 2014] Executing as @ussdgsphpccmp06 on Linux 2.6.32-358.el6.x86_64 amd64; Java HotSpot(TM) 64-Bit Server VM 1.7.0_67-b01; Picard version: 1.119(d44cdb51745f5e8075c826430a39d8 a61f1dd832_1408991805) IntelDeflater [Wed Oct 08 00:15:12 PDT 2014] picard.analysis.CollectInsertSizeMetrics done. Elapsed time: 0.00 minutes. Runtime.totalMemory()=2026373120 To get help, see http://picard.sourceforge.net/index.shtml#GettingHelp Exception in thread main java.lang.NullPointerException at htsjdk.samtools.reference.ReferenceSequenceFileWalker.get(ReferenceSequenceFileWalker.java:87) at picard.analysis.SinglePassSamProgram.makeItSo(SinglePassSamProgram.java:113) at picard.analysis.SinglePassSamProgram.doWork(SinglePassSamProgram.java:53) at picard.cmdline.CommandLineProgram.instanceMain(CommandLineProgram.java:183) at picard.cmdline.CommandLineProgram.instanceMainWithExit(CommandLineProgram.java:124) at picard.analysis.CollectInsertSizeMetrics.main(CollectInsertSizeMetrics.java:83) child process exited with value 1 Konstantinos Mavrommatis, PhD Senior Bioinformatics Scientist, Celgene Corp, San Francisco +1 415 839 7061 * THIS ELECTRONIC MAIL MESSAGE AND ANY ATTACHMENT IS CONFIDENTIAL AND MAY CONTAIN LEGALLY PRIVILEGED INFORMATION INTENDED ONLY FOR THE USE OF THE INDIVIDUAL OR INDIVIDUALS NAMED ABOVE. If the reader is not the intended recipient, or the employee or agent responsible to deliver it to the intended recipient, you are hereby notified that any dissemination, distribution or copying of this communication is strictly prohibited. If you have received this communication in error, please reply to the sender to notify us of the error and delete the original message. Thank You. -- Meet PCI DSS 3.0 Compliance Requirements with EventLog Analyzer Achieve PCI DSS 3.0 Compliant Status with Out-of-the-box PCI DSS Reports Are you Audit-Ready for PCI DSS 3.0 Compliance? Download White paper Comply to PCI DSS 3.0 Requirement 10 and 11.5 with EventLog Analyzer http://pubads.g.doubleclick.net/gampad/clk?id=154622311iu=/4140/ostg.clktrk___ Samtools-help mailing list Samtools-help@lists.sourceforge.net https://lists.sourceforge.net/lists/listinfo/samtools-help
Re: [Samtools-help] Problems with picard 1.119. CollectAlignmentMetrics and CollectInsertSizeMetrics
Could it be that you are using Java 1.7? Picard used to run on Java 1.6 only. From the Website: The Picard command-line tools are packaged as executable jar files. They require Java 1.6. They can be invoked as follows: Best John On 08 Oct 2014, at 9:49 38am, Konstantinos Mavrommatis kmavromma...@celgene.com wrote: Hi, When I run CollectAlignmentMetrics and CollectInsertSizeMetrics using the latest Picard 1.119 I get the following error message. The same command line when run on a previous version of Picard (tried 1.107 and 1.96) runs without issues and produces output. The BAM file was generated using STAR and was sorted using Picard SortSam. Thanks in advance for your help K Picked up _JAVA_OPTIONS: -Djava.io.tmpdir=/scratch/RED/tmp/ [Wed Oct 08 00:15:12 PDT 2014] picard.analysis.CollectInsertSizeMetrics HISTOGRAM_FILE=/gpfs/scratch/RED/tmp/InsertSize/3966/gpfs/archive/RED/RNA-Seq/Processed/STARaln.human-bamQC-SortByCo ordinates/InsertSize/O2_5.InsertSize.pdf METRIC_ACCUMULATION_LEVEL=[ALL_READS] INPUT=/gpfs/scratch/RED/tmp/InsertSize/3966/gpfs/archive/RED/RNA-Seq/Processed/STARaln.human-bamfiles-SortByC oordinates/O2_5.coord.bam OUTPUT=/gpfs/scratch/RED/tmp/InsertSize/3966/gpfs/archive/RED/RNA-Seq/Processed/STARaln.human-bamQC-SortByCoordinates/InsertSize/O2_5.InsertSize.qcstats REFERENCE _SEQUENCE=/gpfs/scratch/RED/tmp/InsertSize/3966/gpfs/reference/v1/Homo-sapiens/GRCh37.p12/WholeGenome/genome.fa TMP_DIR=[/scratch/RED/tmp/InsertSize/3966] VERBOSITY=WARN ING VALIDATION_STRINGENCY=SILENTDEVIATIONS=10.0 MINIMUM_PCT=0.05 ASSUME_SORTED=true STOP_AFTER=0 QUIET=false COMPRESSION_LEVEL=5 MAX_RECORDS_IN_RAM=50 CREATE_INDEX=false CREATE_MD5_FILE=false [Wed Oct 08 00:15:12 PDT 2014] Executing as @ussdgsphpccmp06 on Linux 2.6.32-358.el6.x86_64 amd64; Java HotSpot(TM) 64-Bit Server VM 1.7.0_67-b01; Picard version: 1.119(d44cdb51745f5e8075c826430a39d8 a61f1dd832_1408991805) IntelDeflater [Wed Oct 08 00:15:12 PDT 2014] picard.analysis.CollectInsertSizeMetrics done. Elapsed time: 0.00 minutes. Runtime.totalMemory()=2026373120 To get help, see http://picard.sourceforge.net/index.shtml#GettingHelp Exception in thread main java.lang.NullPointerException at htsjdk.samtools.reference.ReferenceSequenceFileWalker.get(ReferenceSequenceFileWalker.java:87) at picard.analysis.SinglePassSamProgram.makeItSo(SinglePassSamProgram.java:113) at picard.analysis.SinglePassSamProgram.doWork(SinglePassSamProgram.java:53) at picard.cmdline.CommandLineProgram.instanceMain(CommandLineProgram.java:183) at picard.cmdline.CommandLineProgram.instanceMainWithExit(CommandLineProgram.java:124) at picard.analysis.CollectInsertSizeMetrics.main(CollectInsertSizeMetrics.java:83) child process exited with value 1 Konstantinos Mavrommatis, PhD Senior Bioinformatics Scientist, Celgene Corp, San Francisco +1 415 839 7061 * THIS ELECTRONIC MAIL MESSAGE AND ANY ATTACHMENT IS CONFIDENTIAL AND MAY CONTAIN LEGALLY PRIVILEGED INFORMATION INTENDED ONLY FOR THE USE OF THE INDIVIDUAL OR INDIVIDUALS NAMED ABOVE. If the reader is not the intended recipient, or the employee or agent responsible to deliver it to the intended recipient, you are hereby notified that any dissemination, distribution or copying of this communication is strictly prohibited. If you have received this communication in error, please reply to the sender to notify us of the error and delete the original message. Thank You. -- Meet PCI DSS 3.0 Compliance Requirements with EventLog Analyzer Achieve PCI DSS 3.0 Compliant Status with Out-of-the-box PCI DSS Reports Are you Audit-Ready for PCI DSS 3.0 Compliance? Download White paper Comply to PCI DSS 3.0 Requirement 10 and 11.5 with EventLog Analyzer http://pubads.g.doubleclick.net/gampad/clk?id=154622311iu=/4140/ostg.clktrk___ Samtools-help mailing list Samtools-help@lists.sourceforge.net https://lists.sourceforge.net/lists/listinfo/samtools-help -- Meet PCI DSS 3.0 Compliance Requirements with EventLog Analyzer Achieve PCI DSS 3.0 Compliant Status with Out-of-the-box PCI DSS Reports Are you Audit-Ready for PCI DSS 3.0 Compliance? Download White paper Comply to PCI DSS 3.0 Requirement 10 and 11.5 with EventLog Analyzer http://pubads.g.doubleclick.net/gampad/clk?id=154622311iu=/4140/ostg.clktrk___ Samtools-help mailing list Samtools-help@lists.sourceforge.net https://lists.sourceforge.net/lists/listinfo/samtools-help
Re: [Samtools-help] How to create consensus sequence
Hi Sami, I'm not sure why that wouldn't work. TRy samtools mpileup -f ref.fasta sorted.bam | less and see what you get. If that works I'd expect bcf output would work. Colin On 8 October 2014 16:32, Sami Pietilä sami.piet...@gmail.com wrote: Hi Colin, Thanks for a reply! Novocraft package looks interesting. However, I am not quite sure how to use it in this case. I have a bam file containing the alignments and a fasta file for the reference sequences. I am not able to produce VCF (at least with samtools) because mpileup does not give anything. Is there a way of using novoutil to generate a consensus sequence(s) from bam without having a vcf file? Many thanks Sami 2014-10-08 5:47 GMT+03:00 Colin Hercus co...@novocraft.com: Hi Sami, You can use novoutil iupac to generate a new consensus sequence from an original fasta and a vcf file. There's options for selecting variant quality and whether to include indel calls. It can also lift over coordinates on a bed file when applying inserts. It's free to use and part of Novoalign download at www.novocraft.com. Kind Regards, Colin On 7 October 2014 21:22, Sami Pietilä sami.piet...@gmail.com wrote: Hi, I haven't been able to create a consensus sequence with samtools. I have a ref.fasta containing just one sequence and then sorted.bam containing alignments against the reference. samtools mpileup -uf ref.fasta sorted.bam | bcftools view -cg - gives nothing after #CHROMPOSIDREF.. line. IGV is able to give the consensus sequence (see below). Is there a way to get a consensus sequence using samtools? Thanks /Sami NNN NNN NNN NNN NNTCACCAGGGC GACGATGCGTAGCCGGCCTGAGAGGGTGGACGGCCACACTGGGACTGAGACACGGCCCAGACTCCTACGGGAGGCAGCAGTA GGGAA NNNCAATAAGTATCCCGCCTAGTACGG CCGCAAGGYTGAAACTCAAAGGAATTGACGCCCGCACAAGCGGTGGAGYATGTGGTTTAATTCGAMGCAACGCGAAGAA CCTTACCAGGTCTTGACATCNN NNN NNN NNN NNN NNN -- Meet PCI DSS 3.0 Compliance Requirements with EventLog Analyzer Achieve PCI DSS 3.0 Compliant Status with Out-of-the-box PCI DSS Reports Are you Audit-Ready for PCI DSS 3.0 Compliance? Download White paper Comply to PCI DSS 3.0 Requirement 10 and 11.5 with EventLog Analyzer http://pubads.g.doubleclick.net/gampad/clk?id=154622311iu=/4140/ostg.clktrk ___ Samtools-help mailing list Samtools-help@lists.sourceforge.net https://lists.sourceforge.net/lists/listinfo/samtools-help -- Meet PCI DSS 3.0 Compliance Requirements with EventLog Analyzer Achieve PCI DSS 3.0 Compliant Status with Out-of-the-box PCI DSS Reports Are you Audit-Ready for PCI DSS 3.0 Compliance? Download White paper Comply to PCI DSS 3.0 Requirement 10 and 11.5 with EventLog Analyzer http://pubads.g.doubleclick.net/gampad/clk?id=154622311iu=/4140/ostg.clktrk___ Samtools-help mailing list Samtools-help@lists.sourceforge.net https://lists.sourceforge.net/lists/listinfo/samtools-help
Re: [Samtools-help] How to create consensus sequence
Hi Colin, Running following command: samtools mpileup -f ref.fasta sorted.bam | less shows: --- less output --- [mpileup] 1 samples in 1 input files mpileup Set max per-file depth to 8000 (END) Many Thanks Sami 2014-10-08 12:18 GMT+03:00 Colin Hercus co...@novocraft.com: Hi Sami, I'm not sure why that wouldn't work. TRy samtools mpileup -f ref.fasta sorted.bam | less and see what you get. If that works I'd expect bcf output would work. Colin On 8 October 2014 16:32, Sami Pietilä sami.piet...@gmail.com wrote: Hi Colin, Thanks for a reply! Novocraft package looks interesting. However, I am not quite sure how to use it in this case. I have a bam file containing the alignments and a fasta file for the reference sequences. I am not able to produce VCF (at least with samtools) because mpileup does not give anything. Is there a way of using novoutil to generate a consensus sequence(s) from bam without having a vcf file? Many thanks Sami 2014-10-08 5:47 GMT+03:00 Colin Hercus co...@novocraft.com: Hi Sami, You can use novoutil iupac to generate a new consensus sequence from an original fasta and a vcf file. There's options for selecting variant quality and whether to include indel calls. It can also lift over coordinates on a bed file when applying inserts. It's free to use and part of Novoalign download at www.novocraft.com. Kind Regards, Colin On 7 October 2014 21:22, Sami Pietilä sami.piet...@gmail.com wrote: Hi, I haven't been able to create a consensus sequence with samtools. I have a ref.fasta containing just one sequence and then sorted.bam containing alignments against the reference. samtools mpileup -uf ref.fasta sorted.bam | bcftools view -cg - gives nothing after #CHROMPOSIDREF.. line. IGV is able to give the consensus sequence (see below). Is there a way to get a consensus sequence using samtools? Thanks /Sami NNN NNN NNN NNN NNTCACCAGGGC GACGATGCGTAGCCGGCCTGAGAGGGTGGACGGCCACACTGGGACTGAGACACGGCCCAGACTCCTACGGGAGGCAGCAGTA GGGAA NNNCAATAAGTATCCCGCCTAGTACGG CCGCAAGGYTGAAACTCAAAGGAATTGACGCCCGCACAAGCGGTGGAGYATGTGGTTTAATTCGAMGCAACGCGAAGAA CCTTACCAGGTCTTGACATCNN NNN NNN NNN NNN NNN -- Meet PCI DSS 3.0 Compliance Requirements with EventLog Analyzer Achieve PCI DSS 3.0 Compliant Status with Out-of-the-box PCI DSS Reports Are you Audit-Ready for PCI DSS 3.0 Compliance? Download White paper Comply to PCI DSS 3.0 Requirement 10 and 11.5 with EventLog Analyzer http://pubads.g.doubleclick.net/gampad/clk?id=154622311iu=/4140/ostg.clktrk ___ Samtools-help mailing list Samtools-help@lists.sourceforge.net https://lists.sourceforge.net/lists/listinfo/samtools-help -- Meet PCI DSS 3.0 Compliance Requirements with EventLog Analyzer Achieve PCI DSS 3.0 Compliant Status with Out-of-the-box PCI DSS Reports Are you Audit-Ready for PCI DSS 3.0 Compliance? Download White paper Comply to PCI DSS 3.0 Requirement 10 and 11.5 with EventLog Analyzer http://pubads.g.doubleclick.net/gampad/clk?id=154622311iu=/4140/ostg.clktrk___ Samtools-help mailing list Samtools-help@lists.sourceforge.net https://lists.sourceforge.net/lists/listinfo/samtools-help
[Samtools-help] HardFiltering variants
Hi all, Knowing the fact that filtering variants manually, using thresholds on quality values, is subject to all sorts of caveats i am writing this to seek some suggestion for hard filtering variants as it is better than nothing. Could someone provide *generic recommendations* using samtools that should at least provide a starting point to analyse the data. Awaiting for suggestions!! -- Meet PCI DSS 3.0 Compliance Requirements with EventLog Analyzer Achieve PCI DSS 3.0 Compliant Status with Out-of-the-box PCI DSS Reports Are you Audit-Ready for PCI DSS 3.0 Compliance? Download White paper Comply to PCI DSS 3.0 Requirement 10 and 11.5 with EventLog Analyzer http://pubads.g.doubleclick.net/gampad/clk?id=154622311iu=/4140/ostg.clktrk___ Samtools-help mailing list Samtools-help@lists.sourceforge.net https://lists.sourceforge.net/lists/listinfo/samtools-help
Re: [Samtools-help] Problems with picard 1.119. CollectAlignmentMetrics and CollectInsertSizeMetrics
Could you let me know if you see a sequence dictionary next to the reference sequence fasta? The file would be named: /gpfs/scratch/RED/tmp/InsertSize/3966/gpfs/reference/v1/Homo-sapiens/ GRCh37.p12/WholeGenome/genome.dict Thanks, N On Wed, Oct 8, 2014 at 3:49 AM, Konstantinos Mavrommatis kmavromma...@celgene.com wrote: Hi, When I run CollectAlignmentMetrics and CollectInsertSizeMetrics using the latest Picard 1.119 I get the following error message. The same command line when run on a previous version of Picard (tried 1.107 and 1.96) runs without issues and produces output. The BAM file was generated using STAR and was sorted using Picard SortSam. Thanks in advance for your help K Picked up _JAVA_OPTIONS: -Djava.io.tmpdir=/scratch/RED/tmp/ [Wed Oct 08 00:15:12 PDT 2014] picard.analysis.CollectInsertSizeMetrics HISTOGRAM_FILE=/gpfs/scratch/RED/tmp/InsertSize/3966/gpfs/archive/RED/RNA-Seq/Processed/STARaln.human-bamQC-SortByCo ordinates/InsertSize/O2_5.InsertSize.pdf METRIC_ACCUMULATION_LEVEL=[ALL_READS] INPUT=/gpfs/scratch/RED/tmp/InsertSize/3966/gpfs/archive/RED/RNA-Seq/Processed/STARaln.human-bamfiles-SortByC oordinates/O2_5.coord.bam OUTPUT=/gpfs/scratch/RED/tmp/InsertSize/3966/gpfs/archive/RED/RNA-Seq/Processed/STARaln.human-bamQC-SortByCoordinates/InsertSize/O2_5.InsertSize.qcstats REFERENCE _SEQUENCE=/gpfs/scratch/RED/tmp/InsertSize/3966/gpfs/reference/v1/Homo-sapiens/GRCh37.p12/WholeGenome/genome.fa TMP_DIR=[/scratch/RED/tmp/InsertSize/3966] VERBOSITY=WARN ING VALIDATION_STRINGENCY=SILENTDEVIATIONS=10.0 MINIMUM_PCT=0.05 ASSUME_SORTED=true STOP_AFTER=0 QUIET=false COMPRESSION_LEVEL=5 MAX_RECORDS_IN_RAM=50 CREATE_INDEX=false CREATE_MD5_FILE=false [Wed Oct 08 00:15:12 PDT 2014] Executing as @ussdgsphpccmp06 on Linux 2.6.32-358.el6.x86_64 amd64; Java HotSpot(TM) 64-Bit Server VM 1.7.0_67-b01; Picard version: 1.119(d44cdb51745f5e8075c826430a39d8 a61f1dd832_1408991805) IntelDeflater [Wed Oct 08 00:15:12 PDT 2014] picard.analysis.CollectInsertSizeMetrics done. Elapsed time: 0.00 minutes. Runtime.totalMemory()=2026373120 To get help, see http://picard.sourceforge.net/index.shtml#GettingHelp Exception in thread main java.lang.NullPointerException at htsjdk.samtools.reference.ReferenceSequenceFileWalker.get(ReferenceSequenceFileWalker.java:87) at picard.analysis.SinglePassSamProgram.makeItSo(SinglePassSamProgram.java:113) at picard.analysis.SinglePassSamProgram.doWork(SinglePassSamProgram.java:53) at picard.cmdline.CommandLineProgram.instanceMain(CommandLineProgram.java:183) at picard.cmdline.CommandLineProgram.instanceMainWithExit(CommandLineProgram.java:124) at picard.analysis.CollectInsertSizeMetrics.main(CollectInsertSizeMetrics.java:83) child process exited with value 1 *Konstantinos Mavrommatis, PhD* Senior Bioinformatics Scientist, Celgene Corp, San Francisco *+1 415 839 7061 %2B1%20415%20839%207061* * THIS ELECTRONIC MAIL MESSAGE AND ANY ATTACHMENT IS CONFIDENTIAL AND MAY CONTAIN LEGALLY PRIVILEGED INFORMATION INTENDED ONLY FOR THE USE OF THE INDIVIDUAL OR INDIVIDUALS NAMED ABOVE. If the reader is not the intended recipient, or the employee or agent responsible to deliver it to the intended recipient, you are hereby notified that any dissemination, distribution or copying of this communication is strictly prohibited. If you have received this communication in error, please reply to the sender to notify us of the error and delete the original message. Thank You. -- Meet PCI DSS 3.0 Compliance Requirements with EventLog Analyzer Achieve PCI DSS 3.0 Compliant Status with Out-of-the-box PCI DSS Reports Are you Audit-Ready for PCI DSS 3.0 Compliance? Download White paper Comply to PCI DSS 3.0 Requirement 10 and 11.5 with EventLog Analyzer http://pubads.g.doubleclick.net/gampad/clk?id=154622311iu=/4140/ostg.clktrk ___ Samtools-help mailing list Samtools-help@lists.sourceforge.net https://lists.sourceforge.net/lists/listinfo/samtools-help -- Meet PCI DSS 3.0 Compliance Requirements with EventLog Analyzer Achieve PCI DSS 3.0 Compliant Status with Out-of-the-box PCI DSS Reports Are you Audit-Ready for PCI DSS 3.0 Compliance? Download White paper Comply to PCI DSS 3.0 Requirement 10 and 11.5 with EventLog Analyzer http://pubads.g.doubleclick.net/gampad/clk?id=154622311iu=/4140/ostg.clktrk___ Samtools-help mailing list Samtools-help@lists.sourceforge.net https://lists.sourceforge.net/lists/listinfo/samtools-help
Re: [Samtools-help] HardFiltering variants
Depending on a) whether you’re dealing with human, another diploid organism or something else and b) what kind of data you have (wgs, exome, other) you might start with Heng’s CHM1 paper as an interesting read: http://arxiv.org/pdf/1404.0929.pdf -t On Oct 8, 2014, at 9:58 AM, mehar meharji.arumi...@helsinki.fi wrote: Hi all, Knowing the fact that filtering variants manually, using thresholds on quality values, is subject to all sorts of caveats i am writing this to seek some suggestion for hard filtering variants as it is better than nothing. Could someone provide generic recommendations using samtools that should at least provide a starting point to analyse the data. Awaiting for suggestions!! -- Meet PCI DSS 3.0 Compliance Requirements with EventLog Analyzer Achieve PCI DSS 3.0 Compliant Status with Out-of-the-box PCI DSS Reports Are you Audit-Ready for PCI DSS 3.0 Compliance? Download White paper Comply to PCI DSS 3.0 Requirement 10 and 11.5 with EventLog Analyzer http://pubads.g.doubleclick.net/gampad/clk?id=154622311iu=/4140/ostg.clktrk___ Samtools-help mailing list Samtools-help@lists.sourceforge.net https://lists.sourceforge.net/lists/listinfo/samtools-help -- Meet PCI DSS 3.0 Compliance Requirements with EventLog Analyzer Achieve PCI DSS 3.0 Compliant Status with Out-of-the-box PCI DSS Reports Are you Audit-Ready for PCI DSS 3.0 Compliance? Download White paper Comply to PCI DSS 3.0 Requirement 10 and 11.5 with EventLog Analyzer http://pubads.g.doubleclick.net/gampad/clk?id=154622311iu=/4140/ostg.clktrk___ Samtools-help mailing list Samtools-help@lists.sourceforge.net https://lists.sourceforge.net/lists/listinfo/samtools-help
[Samtools-help] Picard Release 1.122
Picard Release 1.122 8 October 2014 - New Command Line Program GenotypeConcordance -- Calculates the concordance between genotype data for two samples in two different VCFs - one being considered the truth (or reference) the other being considered the call. The concordance is broken into separate results sections for SNPs and indels. Summary and detailed statistics are reported. Note that for any pair of variants to compare, only the alleles for the samples under interrogation are considered and MNP, Symbolic, and Mixed classes of variants are not included. - New Command Line Program UpdateVcfDictionary -- Updates the sequence dictionary of a VCF from another file (SAM, BAM, VCF, dictionary, interval_list, fasta, etc). - New Command Line Program VcfToIntervalList -- Create an interval list from a VCF - New Command Line Program MarkDuplicatesWithMateCigar -- A new tool with which to mark duplicates: This tool can replace MarkDuplicates if the input SAM/BAM has Mate CIGAR (MC) optional tags pre-computed (see the tools RevertOriginalBaseQualitiesAndAddMateCigar and FixMateInformation). This allows the new tool to perform a streaming duplicate marking routine (i.e. a single-pass). This tool cannot be used with alignments that have large gaps or reference skips, which happens frequently in RNA-seq data. There were many refactors of the old MarkDuplicates and MarkDuplicatesWithMateCigar, since the share common code. EstimateLibraryComplexity was caught up in this too. Many, many, many unit tests were added to were added to prove equivalency of MarkDuplicatesWithMateCigar to MarkDuplicates. This also exposed a few one in a million corner cases in MarkDuplicates both in duplicate marking as well as optical duplicate detection. This results in MarkDuplicates needing to write slightly larger temporary files when running. SamFileTester was also improved to handle the various test cases for duplicate marking testing. - Updates to IntervalList: -- Added capacity to create a simple interval list from a string (the name of the contig) -- Added the capacity to subtract one interval list from another (currently it would only work if they were both wrapped inside a container) - Updates to SamLocusIterator -- Performance optimizations gaining about 35% speed up... - Updates to MarkDuplicates: -- Removed unnecessary storage of a string in the Read Ends in Mark -- Clarifed the size of ReadEndsForMarkDuplicates - Updated the minimum number of times that the BAIT_INTERVALS (in CalculateHsMetrics) and TARGET_INTERVALS (in CollectTargetedMetrics) must be set to one. - Moved CollectHiSeqPfFailMetrics into picard public - Updates to documentation generation (internal): -- changed link to IntervalList.java documentation -- updated how _includes/command-line-usage.html is generated - Moved SAMSequenceDictionaryExtractor and tests from picard to htsjdk - George -- Meet PCI DSS 3.0 Compliance Requirements with EventLog Analyzer Achieve PCI DSS 3.0 Compliant Status with Out-of-the-box PCI DSS Reports Are you Audit-Ready for PCI DSS 3.0 Compliance? Download White paper Comply to PCI DSS 3.0 Requirement 10 and 11.5 with EventLog Analyzer http://pubads.g.doubleclick.net/gampad/clk?id=154622311iu=/4140/ostg.clktrk___ Samtools-help mailing list Samtools-help@lists.sourceforge.net https://lists.sourceforge.net/lists/listinfo/samtools-help
Re: [Samtools-help] samtools V1.1 DPR option
Hi Chushin, the DPR fields will now get trimmed also with -c, the fixed version is in github http://samtools.github.io/bcftools/ Cheers, Petr On 7 Oct 2014, at 20:02, Petr Danecek wrote: Thank you. I see what is the problem now, did not notice the -c in bcftools call command: The DPR output is currently supported only with -m, sorry. Petr On 7 Oct 2014, at 19:39, Koh, Chushin wrote: Hi Petr, Thank you for your reply. Here is the Version info 'grep' from the same VCF file: ##samtoolsVersion=1.1+htslib-1.1 ##bcftools_callVersion=1.1+htslib-1.1 With Regards, ChuShin. From: Petr Danecek [p...@sanger.ac.uk] Sent: Tuesday, October 07, 2014 12:28 PM To: Koh, Chushin Cc: samtools-help@lists.sourceforge.net Subject: Re: [Samtools-help] samtools V1.1 DPR option Hi ChuShin, only two values should appear on output at biallelic sites. I believe this was fixed some time ago http://github.com/samtools/bcftools/commit/91826ee6 Are you sure the output is really from bcftools v1.1? It's easy to check - there is a version string in the VCF header. Petr On 7 Oct 2014, at 18:24, Koh, Chushin wrote: Hi all, I need clarification on the DPR option (see an example output below). There are two alleles reported for each locus, however, the DPR field has 3 values at pos 6554 and 4 values at pos 6690. What does the 3rd and 4th value correspond to (e.g. what nucleotide) in these cases? Thanks! Cheers, ChuShin -- command: $ samtools mpileup -B -d 1 -t DP,DPR -uf reference.fa BAM_FILES| bcftools call -cv -o raw.vcf -- -- output: seq1 6554. G A 121.224 . DP=102;VDB=0.360777;SGB=17.9188;RPB=0.404703;MQB=2.10899e-12;MQSB=0.980733;BQB=0.730302;MQ0F=0.147059;AF1=0.293951;G3=0.669799,2.37878e-06,0.330198;HWE=6.51903e-05;AC1=10;DP4=43,35,21,3;MQ=42;FQ=122.706;PV4=0.0038602,0.458111,9.36477e-23,0.161162 GT:PL:DP:DPR1/1:61,15,0:5:0,5,0 0/0:0,9,103:3:3,0,0 0/0:0,24,211:8:8,0,00/0:0,30,238:10:10,0,0 0/0:0,36,255:12:12,0,0 0/0:0,18,166:6:6,0,00/0:0,30,239:10:10,0,0 0/0:0,0,0:0:0,0,0 0/0:0,21,196:7:7,0,01/1:99,21,0:7:0,7,0 0/0:0,24,219:8:8,0,0 0/0:0,24,222:8:8,0,01/1:18,21,0:7:0,7,0 0/0:0,0,0:0:0,0,0 1/1:28,9,0:3:0,3,0 0/0:0,18,190:6:6,0,00/1:22,6,0:2:0,2,0 seq1 6690. C T 999 . DP=152;VDB=0.981285;SGB=3.7794;RPB=0.326667;MQB=0;MQSB=8.54057e-07;BQB=1;MQ0F=0.151316;AF1=0.967821;AC1=33;DP4=1,1,86,64;MQ=35;FQ=15.3744;PV4=1,0.39789,0.00644419,0.357468 GT:PL:DP:DPR1/1:145,39,0:13:0,13,0,01/1:157,24,0:8:0,8,0,0 1/1:241,39,0:13:0,13,0,01/1:238,33,0:12:0,11,1,0 1/1:255,45,0:15:0,15,0,01/1:128,15,0:5:0,5,0,0 1/1:191,30,0:10:0,10,0,00/1:0,6,63:2:2,0,0,0 1/1:163,27,0:9:0,9,0,0 1/1:161,30,0:10:0,10,0,0 1/1:255,54,0:18:0,18,0,01/1:255,48,0:16:0,16,0,0 1/1:88,24,0:8:0,8,0,0 1/1:51,9,0:3:0,3,0,01/1:71,9,0:3:0,3,0,0 1/1:98,9,0:3:0,3,0,01/1:39,12,0:4:0,4,0,0 -- -- Meet PCI DSS 3.0 Compliance Requirements with EventLog Analyzer Achieve PCI DSS 3.0 Compliant Status with Out-of-the-box PCI DSS Reports Are you Audit-Ready for PCI DSS 3.0 Compliance? Download White paper Comply to PCI DSS 3.0 Requirement 10 and 11.5 with EventLog Analyzer http://pubads.g.doubleclick.net/gampad/clk?id=154622311iu=/4140/ostg.clktrk ___ Samtools-help mailing list Samtools-help@lists.sourceforge.net https://lists.sourceforge.net/lists/listinfo/samtools-help -- The Wellcome Trust Sanger Institute is operated by Genome Research Limited, a charity registered in England with number 1021457 and a company registered in England with number 2742969, whose registered office is 215 Euston Road, London, NW1 2BE. -- The Wellcome Trust Sanger Institute is operated by Genome Research Limited, a charity registered in England with number 1021457 and a company registered in England with number 2742969, whose registered office is 215 Euston Road, London, NW1 2BE. -- Meet PCI DSS 3.0 Compliance Requirements with EventLog Analyzer Achieve PCI DSS 3.0 Compliant Status with Out-of-the-box PCI DSS Reports Are you Audit-Ready for PCI DSS 3.0 Compliance? Download White paper Comply to PCI DSS 3.0 Requirement 10 and 11.5 with EventLog Analyzer http://pubads.g.doubleclick.net/gampad/clk?id=154622311iu=/4140/ostg.clktrk ___ Samtools-help mailing list Samtools-help@lists.sourceforge.net https://lists.sourceforge.net/lists/listinfo/samtools-help -- The Wellcome Trust Sanger Institute is operated by Genome Research Limited, a charity registered in
