[aroma.affymetrix] Re: Accessing individual probe intensities
Hi Henrik,
Thanks a lot for your reply.
I am aware that probes/cells are not annotated just like probesets or
transcript clusters, so I just didn't explain my problem properly. I
have already done the analysis at the exon and transcript level using
your ExonRmaPlm() with mergeGroups=TRUE or FALSE for each case so that
part of the analysis, the one most people are interested in, is fine.
I am interested in mapping intensities to sequences of nucleotides: I
have downloaded Affymetrix's library files and in one of them one can
find the target sequence corresponding to each probe identity/index
- from 1 to 6.5 million - that can be uniquely obtained using the
(x,y) coordinates of the probe on the cdf file. The reason is that I
would like to compare the performance of Exon arrays to NGS and that's
why the individual probes are so important for me. So my question is
whether it is possible to perform an analysis at the sequence level.
Yet another question, maybe too general, I have also noticed that in
some cases the 4 probes interrogating the same exon (Probe Selection
Region) have extremely different intensities. Do you think it is a
consequence of the GC content of the individual probes or would you
blame it on cross-hybridazation? Would you somehow correct the probe
intensities by their GC content?
Again, thank you very much for your answer and for providing this
discussion group that gets direct support. I find it extremely useful.
Best regards,
María
On Jul 10, 1:40 am, Henrik Bengtsson henrik.bengts...@aroma-
project.org wrote:
Hi Maria.
On Wed, Jul 6, 2011 at 5:59 AM, Maria Rodrigo-Domingo mrod...@gmail.com
wrote:
Hi all,
I am using aroma.affymetrix for an analysis on Human Exon Array data
and would need to access the individual probe intensities mappeda to
probe_id after background correction and normalization. Is there an
easy way to do this? Below you can see what I have tried so far.
With the notation onhttp://www.aroma-project.org/node/37I am looking
at object csN - data at probe-level after BC and QN
affyBatch - extractAffyBatch(csN)
# I get an error message about package huex10stv2cdf not being
available from Bioconductor.
Yes, that approach, which tries to extract a Bioconductor AffyBatch
object, is basically just a convenient wrapper around ReadAffy() of
the affy package, and that is what needs a 'huex10stv2cdf' package.
probes_matrix - extractMatrix(csN, cells=NULL, field=c(intensities,
stdvs, pixels), drop=FALSE, verbose=verbose) # I do not get any
information about which probe the intensity belongs to
It might be that you've missed that *probes* (aka *cells* as we prefer
to call them) do *not* have annotations in Affymetrix arrays. It is
only *probesets* (aka *unit groups*) that have annotations.
Probesets, which are defined by the CDF you choose, specifies which
sets of probes should be grouped together.
For example, if you know you are interested in probes 1040-1054, you
can extra their probe intensities across all arrays in the
AffymetrixCelSet ('csN') as you do:
cells - 1040:1054;
Y - extractMatrix(csN, cells=cells, field=c(intensities, stdvs,
pixels), drop=FALSE, verbose=verbose);
str(Y)
num [1:15, 1:6] 37 32 96 214 706 29 39 218 39 792 ...
- attr(*, dimnames)=List of 2
..$ : NULL
..$ : chr [1:6] huex_wta_cerebellum_A huex_wta_cerebellum_B ...
Note how there are column names, which corresponds to the array/sample
names, but there are no row names simply because probes don't have
names. Probes are specified by the (x,y) coordinates on the array and
there is a one-to-one mapping (x,y) - probe index. You can read
more about this in the help of the affxparser package:
help(2. Cell coordinates and cell indices, package=affxparser)
intensities - getIntensities(csN)
# no probe or array information
Same reason as above. (Also, I recommend to use extractMatrix()
instead of getIntensities()).
unitIntensities - getUnitIntensities(csN, verbose=verbose)
# I get transcript and probeset information and the individual
intensities of the 4 probes in each probeset, but numbered 1 to 4, so
No we're getting closer. The getUnitIntensities() returns a list
structure containing probe intensities. The list structure reflects
the structure of the CDF, i.e. which cells belongs to which unit
groups. Note how the items in the list have names. These are the so
called unit names. Each item in turn consists of a sublist, which
corresponds to the units groups. They also have names which are the
so called group names.
I still cannot map them to their target sequence.
Q. So, does this mean that you are interested in finding the genomic
location of each probe? Is that the kind of annotation you are
looking for when you ask for probe_id? Note that when they designed
the custom CDFs for FIRMA, they did map the 25-mer probes to the
genome by their sequences, cf.
Re: [aroma.affymetrix] Re: Accessing individual probe intensities
Hi. On Sun, Jul 10, 2011 at 11:05 PM, Maria Rodrigo-Domingo mrod...@gmail.com wrote: Hi Henrik, Thanks a lot for your reply. I am aware that probes/cells are not annotated just like probesets or transcript clusters, so I just didn't explain my problem properly. I have already done the analysis at the exon and transcript level using your ExonRmaPlm() with mergeGroups=TRUE or FALSE for each case so that part of the analysis, the one most people are interested in, is fine. I am interested in mapping intensities to sequences of nucleotides: I have downloaded Affymetrix's library files and in one of them one can find the target sequence corresponding to each probe identity/index - from 1 to 6.5 million - that can be uniquely obtained using the (x,y) coordinates of the probe on the cdf file. I'm not 100% sure I know what your asking for, but maybe the following helps. When doing: Y - extractMatrix(csN, cells=cells, field=c(intensities, stdvs, pixels), drop=FALSE, verbose=verbose); the returned Y is a JxI matrix, where J is the number of cells requested (==length(cells)) and I is the number of arrays (==nbrOfArrays(csN)). Argument 'cells' is an index vector specifying the cells for which the intensities should be retrieved. If NULL, it's the same as cells - 1:nbrOfArrays(csN). You can specify any subset or order you'd like - the rows of Y will be ordered accordingly. So, with the above you will know the cell index for each row in Y. From the cell index you can obtain the one-to-one (x,y) cell coordinate (see my previous message). With (x,y) it sounds like you can retrieve the target sequence you'd like from Affymetrix or other annotation data sources - is that correct? If this is not enough, I'm not sure what kind of mapping you're looking for. If you are interested in the 25-mer *probe* sequences, they are readily available in the Aroma Cell Sequence (ACS) file: http://aroma-project.org/chipTypes/HuEx-1_0-st-v2 For example: cdf - getCdf(csN); acs - getAromaCellSequenceFile(cdf); acs AromaCellSequenceFile: Name: HuEx-1_0-st-v2 Tags: HB20080710 Full name: HuEx-1_0-st-v2,HB20080710 Pathname: annotationData/chipTypes/HuEx-1_0-st-v2/HuEx-1_0-st-v2,HB20080710.acs File size: 162.50 MB (170394012 bytes) RAM: 0.00 MB Number of data rows: 6553600 File format: v1 Dimensions: 6553600x26 Column classes: raw, raw, raw, raw, raw, raw, raw, raw, raw, raw, raw, raw, raw, raw, raw, raw, raw, raw, raw, raw, raw, raw, raw, raw, raw, raw Number of bytes per column: 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 , 1, 1, 1, 1, 1, 1, 1, 1 Footer: createdOn20080710 22:05:44 PDT/createdOnplatformAffymetrix/platfo rmchipTypeHuEx-1_0-st-v2/chipTypesrcFilefilenameHuEx-1_0-st-v2.probe.ta b/filenamefilesize553438704/filesizechecksum1ff5d5bd59bd7345ecbab1973097 247e/checksum/srcFile Chip type: HuEx-1_0-st-v2 Platform: Affymetrix cells - c(1024, 10902:10905); readSequences(acs, cells=cells) [1] CCTGCTGGTATCCTGGGAACCAGGT ATTATTTGAATGGAGATGGTTACAT [3] TTTGTGGTTTAGAATGTCAGCCCAT TAGTGGTTGCCATAAGTCTTACCAT [5] NA As you see, all sequences are not known, but several are. You can also retrieve the probe sequence data in other ways, e.g. readSequenceMatrix(acs, cells=cells) [,1] [,2] [,3] [,4] [,5] [,6] [,7] [,8] [,9] [,10] [1,] C C T G C T G G T A [2,] A T T A T T T G A A [3,] T T T G T G G T T T [4,] T A G T G G T T G C [5,] NA NA NA NA NA NA NA NA NA NA [,11] [,12] [,13] [,14] [,15] [,16] [,17] [,18] [,19] [1,] T C C T G G G A A [2,] T G G A G A T G G [3,] A G A A T G T C A [4,] C A T A A G T C T [5,] NANANANANANANANANA [,20] [,21] [,22] [,23] [,24] [,25] [1,] C C A G G T [2,] T T A C A T [3,] G C C C A T [4,] T A C C A T [5,] NANANANANANA attr(,map) NAACGT 00 01 02 03 04 The reason is that I would like to compare the performance of Exon arrays to NGS and that's why the individual probes are so important for me. So my question is whether it is possible to perform an analysis at the sequence level. To perform an analysis at the sequence level is rather vague - it sounds like a research project in itself. To compare arrays and NGS estimates, why not compare at the summaries transcript of exon levels? (Also, make sure to search the literature for studies comparing exon arrays with NGS). Yet another question, maybe too general, I have also noticed that in some cases the 4 probes interrogating the same exon (Probe Selection Region) have extremely different intensities. Do you think it is a consequence of the GC content of the individual probes or would you blame it on cross-hybridazation? Would you somehow correct the probe intensities by their GC content? I'm sure there is no simple answer, but if you look at the early Affymetrix gene-expression
