On Friday 11 June 2004 07:50, Ramprasad A Padmanabhan wrote:
Hi,
I have written a web based utility that requires to login to several
machines and do some routine tasks
MY script uses Net::Telnet and works fine on most machines
I use the the login() method to login to the servers
The
Hi All,
In continuation to my earlier mail I am putting my code here for generating
the two dimensional array
foreach $k (0 ..$n_fac-1) {
for ($i=1;$i=$N;$i++) {
$x[$k][$i] = $low[$k] + ($high[$k] - $low[$k])* $random[$i];
}
}
I
hi to all,
i have a file $seq, in following format:
gi|37182815|gb|AY358849.1| gi|2353725|gb|AF015490.1|AF015490 100.00 16 0 0 544 559 320
335 4.2 32.21
gi|37182815|gb|AY358849.1| gi|1335960|gb|U55203.1|BTU55203 100.00 16 0 0 544 559 380
395 4.2 32.21
gi|37182815|gb|AY358849.1|
Hi Ziggy
You got me wrong. Anyway thanks for example.
Take a look here:
#!/usr/bin/perl
@str = ();
push @str, sm:a\n;
push @str, sm:b\n;
push @str, BBB\n;
push @str, /sm:b\n;
push @str, sm:cs\n;#- watch this line
push @str, sm:c no=\1\\n;
push @str, CCC1\n;
push @str, /sm:c\n;
push
aditi gupta wrote:
hi to all,
i have a file $seq, in following format:
gi|37182815|gb|AY358849.1| gi|2353725|gb|AF015490.1|AF015490 100.00 16 0 0 544 559 320 335 4.2 32.21
gi|37182815|gb|AY358849.1| gi|1335960|gb|U55203.1|BTU55203 100.00 16 0 0 544 559 380 395 4.2 32.21
Hi Aditi.
During the split, what you have specifid is to match:
gi OR 37182815 OR gb OR AY358849.1 ...
That's what is giving the result you have. I.e. the | means OR in a
regexp like the one used in split...
Easiest solution is to escape the pipe character, i.e.:
Hello all,
I want a script to move all 'expired files' to a folder.
So I wrote the script below.
However, a problem came out: the find function run everything
in the address, including the entire folders structure!!!
I want to move those files and files only. What can I do?
(*note: the OS is
Stephan Hochhaus wrote:
A question I assume can be answered using regexp, unfortunately I am
just starting my way into it. I have a bunch of words that I want to
split, so that the first letters (minus n) and the last n-letters are
seperated.
n is user defined and therefore not static.
Sudhindra K S wrote:
Hi
Hello,
I have a file with lines as shown below
//abc/... - //xyz/...
//abc1/... - //xyz1/...
Now i want to split the lines at - and get the string on the left in one
array and the string on the right in another array.
ie: array1 = (//abc, //abc1) and array2
You can use the -d file test to check if the file is a directory before moving it.
unless(-d $whatever_file){
do whatever...
-Original Message-
From: Shu Hung () [mailto:[EMAIL PROTECTED]
Sent: Fri 6/11/2004 3:50 AM
To: Perl Beginner Mail Group
Cc:
Subject: search and move
Edward Wijaya wrote:
Hi groups,
Hello,
I have a file which contain many many of this line (Fasta Format):
YNL331C
CAATATGCGAGGGACCTACATGTTGA
CATGACAATGAATTCTATTGAA
YKL071W
ATAATTATTCCTGTTTCTTTAACCTG
GTGTACAAACACTTAAGC
What I would like to do is to concatenate the
John W. Krahn wrote:
This should do what you want:
$/ = '';
while ( ) {
next unless s/\s+\S.*//;
chomp;
tr/\n//d;
print $_\n;
}
After seeing your data file change that to:
$/ = '';
while ( ) {
next unless s/\S+.*\n//;
chomp;
tr/\n//d;
print $_\n;
Hello,
anyone know how to change the color space of an image from cmyk to rgb
using perl?
I don´t know if it´s possible without use ImageMagick
Thanks!
--
To unsubscribe, e-mail: [EMAIL PROTECTED]
For additional commands, e-mail: [EMAIL PROTECTED]
http://learn.perl.org/
Has anyone ever come accross this wied problem before
I have a script which pulls records from a DB then loops into a form and
shows each record, with the id no being concatenated to the field name
to give a unique record id.
However if I have this
mike wrote:
Has anyone ever come accross this wied problem before
I have a script which pulls records from a DB then loops into a form
and shows each record, with the id no being concatenated to the field
name to give a unique record id.
However if I have this
On Jun 10, 2004, at 9:46 PM, Beau E. Cox wrote:
Hi -
I am trying to come up with a simple, elegant word parsing script,
that:
* takes a scalar string, and
* splits it into words separating on white space, commas,
and a set of delimiters: '' // () {} [] ##, and
* returns the array of words.
Is this what you need?
#!/usr/bin/perl
use strict;
# List of required columns separated by ', ', must match names in 'Fields:'
my $req_fields = shift || 'Subject id, % identity, alignment length,
mismatches, q. start, q. end';
# Split into array
my @req_fields = split /, /, $req_fields;
# Print
From: dan [EMAIL PROTECTED]
Experiencing a little, if not more, difficulty in attempting to
achieve what's probably a simple task. Here's the situation.
The user presses a button. The website takes them to a page where they
can sign up for a selected package, entering a username and
If you split the line like this:
@seqs=split(/gi|37182815|gb|AY358849.1|/,$seq);
It means the fields are separated by 'gi' or '37182815' or 'gb' or
'AY358849.1'. I don't think this is what you are looking for...
From the previous post, it seems the file is separated by tabs, so
What would I need to call SQL Plus into action for PERL?
-
Do you Yahoo!?
Friends. Fun. Try the all-new Yahoo! Messenger
jason corbett wrote:
What would I need to call SQL Plus into action for PERL?
If you just need to execute SQL statements, use the DBI module and talk
directly to the database.
If you need to run existing sqlplus reports, use any of the standard
facilities like system(), backticks, pipe open,
Hi,
I have written a web based utility that requires to login to several
machines and do some routine tasks
MY script uses Net::Telnet and works fine on most machines
I use the the login() method to login to the servers
The problem comes when the server sometimes has a different prompt
All...
I am fairly new to Perl...
But I am in the middle of writing a program where I need to add the
ability to have a module directory, so to speak, where others can write
modules, place them in the module directory, and have them executed by
the main program... Of course, there are
Tim Johnson :
You can use the -d file test to check if the file is a directory before moving it.
unless(-d $whatever_file){
do whatever...
-Original Message-
From: Shu Hung () [mailto:[EMAIL PROTECTED]
Sent: Fri 6/11/2004 3:50 AM
To: Perl Beginner Mail Group
Cc:
Subject: search
Do what I'd like to be able to do is:
my ($find,$replacewith,$case) = $dbh-selectrow_array($query);
$string =~ s/$find/$replace/gi if $case;
$string =~ s/$find/$replace/g if !$case;
Since a user could put whatever they want in the database what should
I do to make that work so its safe?
If there
All...
I am fairly new to Perl...
But I am in the middle of writing a program where I need to add the
ability to have a module directory, so to speak, where others can write
modules, place them in the module directory, and have them executed by
the main program... Of course, there are
Hello,
anyone know how to change the color space of an image from cmyk to rgb
using perl?
I don´t know if it´s possible without use ImageMagick
Thanks!
Something wrong with PerlMagick?
A quick glance revealed Graphics::ColorObject on CPAN that appears to do
what you want.
What technique can I use to take a quick SQL query and get the data back in columns
and rows? I am trying to make a format template, but I would like a way to make a
quick display template that will work with all my simple SQL queries.
Thanks,
JC
This works:
---BEGIN CODE---
#!/usr/bin/perl
use warnings;
use strict;
$/ = '';
while (DATA) {
s/(.*?\n.*?)\n/$1/s;
print;
}
__DATA__
YNL331C
CAATATGCGAGGGACCTACATGTTGA
CATGACAATGAATTCTATTGAA
YKL071W
ATAATTATTCCTGTTTCTTTAACCTG
GTGTACAAACACTTAAGC
---END CODE---
I am trying to execute a perl script from html. However this is to be
executed by a certain user and the script also updates files in the
system. Is there a was I can do a chuser and set the s-bit.
Philip Tham
--
To unsubscribe, e-mail: [EMAIL PROTECTED]
For additional commands, e-mail: [EMAIL
I would like a tool (eventually to be used online) that could convert MS =
Word documents into PDF files. I've reviewed CPAN and was surprised to =
not find any modules that would accomplish this task. Can anybody =
provide guidance to me on how I could produce a module to accomplish =
this? I
JupiterHost.Net wrote:
Do what I'd like to be able to do is:
my ($find,$replacewith,$case) = $dbh-selectrow_array($query);
$string =~ s/$find/$replace/gi if $case;
$string =~ s/$find/$replace/g if !$case;
Since a user could put whatever they want in the database what should
I do to make that work
Bob Showalter [EMAIL PROTECTED] wrote:
jason corbett wrote:
What would I need to call SQL Plus into action for PERL?
If you just need to execute SQL statements, use the DBI module
and talk directly to the database.
If you need to run existing sqlplus reports, use any of the
standard
Hi
I wanted to run the command
Command.pl abc cde def
I used http://www.address/command.pl?abccdedef
However the script is passing only one argument abccdedef to the
script.
How do I achieve the above.
Philip Tham
MMS Lab support
Desk 425 580 1670
--
To unsubscribe, e-mail: [EMAIL
This is certainly shorter, but I doubt it fully adheres to your intent. It
produces the same output as your procedure for this string, but it is
possible that I changed some of the meaning of what you were trying to do:
---BEGIN CODE---
#!/usr/bin/perl
use warnings;
use strict;
print
Tham, Philip wrote:
Hi
Hello,
I wanted to run the command
Command.pl abc cde def
I used http://www.address/command.pl?abccdedef
However the script is passing only one argument abccdedef to the
script.
How do I achieve the above.
You need to use CGI..
#!/usr/bin/perl
use strict;
use
Randy W. Sims wrote:
JupiterHost.Net wrote:
Do what I'd like to be able to do is:
my ($find,$replacewith,$case) = $dbh-selectrow_array($query);
$string =~ s/$find/$replace/gi if $case;
$string =~ s/$find/$replace/g if !$case;
Since a user could put whatever they want in the database what
should
Hi,
I am making use of use CGI qw(:standard); to create my form. I need to
amend the size of a submit button and need to tell the button which script
to call (ie. action=test.cgi). Where can I find documentation on all the
attributes of the components, or an example for my two queries would be
On Fri, 11 Jun 2004, Werner Otto wrote:
I am making use of use CGI qw(:standard); to create my form. I need to
amend the size of a submit button and need to tell the button which script
to call (ie. action=test.cgi). Where can I find documentation on all the
attributes of the components,
On 11 Jun 2004, at 09:57, Werner Otto wrote:
I am making use of use CGI qw(:standard); to create my form. I need to
amend the size of a submit button
print $query-submit(-name='button_name',
-size=15,
-value='value');
and need to tell the button
HI
Any help will be greatly appreciated.
The below statement is my parsing statement. It may be antiquated but it
works.
I want to process input from a select form that has two names and two name
values
name=group1 , value1=
name=group2 , value2=
IN the below
-Original Message-
From: Charles K. Clarkson [mailto:[EMAIL PROTECTED]
Sent: Wednesday, June 09, 2004 9:19 PM
To: 'Catriona Pure Scents'; [EMAIL PROTECTED]
Subject: RE: help with adjusting log file data?
From: Catriona Pure Scents mailto:[EMAIL PROTECTED] wrote:
: Hi Charles,
HI
Any help will be greatly appreciated.
The below statement is my parsing statement. It may be antiquated but it
works.
If it does then you wouldn't need to ask right? It is antiquated, very,
and shouldn't be used when there are much better ways to do this,
specifically the CGI module.
Is this 2004? or 1994? I forgot.
On Fri, Jun 11, 2004 at 08:09:52PM +1000, William Kolln wrote:
HI
Any help will be greatly appreciated.
The below statement is my parsing statement. It may be antiquated but it
works.
I want to process input from a select form that has two names and
Only re-inforced what you already stated, yep the truth hurts, doesn't
mean it isn't the truth. Don't worry, I won't, and good chance others
won't either.
http://www.catb.org/~esr/faqs/smart-questions.html
http://danconia.org
Having viewed your website, I can understand your reply.
Next
Owen Cook wrote:
On Fri, 11 Jun 2004, Werner Otto wrote:
I am making use of use CGI qw(:standard); to create my form. I need to
amend the size of a submit button and need to tell the button which script
to call (ie. action=test.cgi). Where can I find documentation on all the
attributes of
46 matches
Mail list logo
