On Jan 6, 2006, at 4:12, chen li wrote:
Hi all,
I have a big file (2.7G) containing multiple records
in this format:
gi|618748|dbj|D21618.1| MUS74F01 mouse embryonal
carcinoma cell line F9 Mus mus culus cDNA clone 74F01,
mRNA sequence
GCTGCCTCGACGATCTTCGCTTGCNTCCTCGCTCGCTGTCCCGTTGTCCTAGCCCGCC
Hi Xicheng,
Thanks. I search the list before I post the question
but I can't find similar topics. Could you please tell
me some ealier posts? Also I try to use your code to
read a very small file containing only these two
records. Here is what I got:
This is record 1.
This is sequence:
This is re
> Word wrapping possibly mangled the example records,
> could you please
> upload a handful of them in a file somewhere?
>
> -- fxn
Hi,
I am just a newbie. What is word wrapping? Is it a
perl module or something else?
Thanks,
Li
chen li am Freitag, 6. Januar 2006 11.27:
> Hi Xicheng,
Hi Chen
> Thanks. I search the list before I post the question
> but I can't find similar topics. Could you please tell
> me some ealier posts? Also I try to use your code to
> read a very small file containing only these two
> records. Here
Hello,
about closure I read the
Perl literacy course
lecture #9 Closures
Shlomo Yona http://cs.haifa.ac.il/~shlomo/
The explanations are clear but in this example:
(it's an excerpt of an example of Shlomo)
#!/usr/bin/perl
use warnings;
use strict;
my $sumform = make_binary('$_[0] + $_[
root am Freitag, 6. Januar 2006 13.15:
> Hello,
> about closure I read the
>
> Perl literacy course
>
> lecture #9 Closures
>
> Shlomo Yona http://cs.haifa.ac.il/~shlomo/
>
>
> The explanations are clear but in this example:
> (it's an excerpt of an example of Shlomo)
>
> #!/usr/bin/perl
> use war
chen li wrote:
Each record starts with ">". I want to read each
record once at a time.I hear about a special variable
call $/ might do the job but not sure how to use it. I
wonder if anyone could help me out.
See `perldoc perlvar` and search for INPUT_RECORD_SEPARATOR.
Here is a simple script
Hi,
I have an array of many objects and I want to call a method on
each of these objects and the save the returned values into an array:
my @return_values;
foreach my $retrievedObject (@array_of_objects) {
push (@return_values , $retrievedObject->method );
}
The problem is this code runs too sl
On 1/6/06, Sai Tong <[EMAIL PROTECTED]> wrote:
> I have an array of many objects and I want to call a method on
> each of these objects and the save the returned values into an array:
> my @return_values;
> foreach my $retrievedObject (@array_of_objects) {
> push (@return_values , $retrievedObject
sub make_binary
{
my $vars = shift;
return eval "sub { $vars; }";
}
I understand the mechanism of the closure, but I don't figure out how
the anonymous subroutine puts the two arguments in $_[0] and in $_[1] ?
Its evaling a string and $vars is being interpolated so the eval, in
that e
On 1/5/06, chen li <[EMAIL PROTECTED]> wrote:
> Each record starts with ">". I want to read each
> record once at a time.I hear about a special variable
> call $/ might do the job but not sure how to use it.
The perlvar manpage documents $/ and all of Perl's other special
variables. In particular,
On 1/5/06, Rahul <[EMAIL PROTECTED]> wrote:
> if (fork() == 0){
Because your process table can become full and temporarily prevent
forking new processes, you should check the return value of fork
whenever you're making more than N processes. The value of N depends
upon a number of factors, so I
On 1/6/06, Sai Tong <[EMAIL PROTECTED]> wrote:
> The problem is this code runs too slowly for a large array of objects.
> Its seems that it might be a little too slow to "push" each
> returned value into @return_values . Can anyone suggest the best way to
> improve the speed of putting the returne
I am trying to set up a routine to trap signals so that I can pass it to
a sub that will act on the signals and it does not seem to be
functioning as I would think.
SAMPLE:
I will admit some of the code was taken from the camel book. :) I do
have use strict on.
my $name = "\n";
my $i = 0;
def
Leif Ericksen wrote:
> I am trying to set up a routine to trap signals so that I can pass it to
> a sub that will act on the signals and it does not seem to be
> functioning as I would think.
>
> SAMPLE:
> I will admit some of the code was taken from the camel book. :) I do
> have use strict on
Actually not quite what you thought on the output...
$ ./myt.pl
ZERO:0 => SIG{'ZERO'} = &sigcat
HUP:1=> SIG{'HUP'} = &sigcat
INT:2=> SIG{'INT'} = &sigcat
QUIT:3 => SIG{'QUIT'} = &sigcat
ILL:4=> SIG{'ILL'} = &sigcat
TRAP:5 => SIG{'TRAP'} = &sigcat
ABRT:6 => SIG{'ABRT'} = &sigcat
Please bottom post...
Leif Ericksen wrote:
> Actually not quite what you thought on the output...
> $ ./myt.pl
> ZERO:0 => SIG{'ZERO'} = &sigcat
> HUP:1=> SIG{'HUP'} = &sigcat
> INT:2=> SIG{'INT'} = &sigcat
> QUIT:3 => SIG{'QUIT'} = &sigcat
> ILL:4=> SIG{'ILL'} = &sigcat
> TRAP:5
On Fri, 2006-01-06 at 15:58 -0700, Wiggins d'Anconia wrote:
> Please bottom post...
>
> Leif Ericksen wrote:
> > Actually not quite what you thought on the output...
> > $ ./myt.pl
> > ZERO:0 => SIG{'ZERO'} = &sigcat
> > HUP:1=> SIG{'HUP'} = &sigcat
> > INT:2=> SIG{'INT'} = &sigcat
> > Q
Leif Ericksen am Samstag, 7. Januar 2006 00.12:
> On Fri, 2006-01-06 at 15:58 -0700, Wiggins d'Anconia wrote:
> > Please bottom post...
> >
> > Leif Ericksen wrote:
> > > Actually not quite what you thought on the output...
> > > $ ./myt.pl
> > > ZERO:0 => SIG{'ZERO'} = &sigcat
> > > HUP:1=>
Hi Shawn,
I use the your code to do the job:
#!/usr/bin/perl
use strict;
use warnings;
use Data::Dumper;
my $filename='sequence.fasta';
open (DATA,$filename) or die;
{local $/ = '>';
while( ){
print Dumper \$_;
}
}
exit;
And I get the following output:
$VAR1 = \'>';
$VAR1 =
Hi,
I would suggest you use the built-in BioPerl method for reading
fasta (or other) format, for example:
sub get_sequence_from_fasta
{
#designed for getting sequences into array from a file (fasta format),
#input: file name
use Bio::SeqIO;
my $file = shift;
my @seqs= ();
I thought this would be easy but I can not get it to work - can someone
please help me:
Problem: I have a file of 7.5 million records that are pipe delimted, the
first field is a record
number. I want to search for around 10 records with a specific record number
and if they
meet that condition
Daniel Gladstone wrote:
I thought this would be easy but I can not get it to work - can someone
please help me:
Problem: I have a file of 7.5 million records that are pipe delimted,
the first field is a record
number. I want to search for around 10 records with a specific record
number and
This is the person that gave me the direction I needed to get my signals
working.. (Sorry for the top post here... I wanted the most important
part out first..)
For the actual FULL code that I am working with at present see the
bottom of the message.
On Sat, 2006-01-07 at 01:14 +0100, John Doe w
24 matches
Mail list logo
