Hi,
On Thu, Nov 26, 2015 at 08:28:13PM -0700, Eric Blake wrote:
> On 11/26/2015 04:52 PM, Linda Walsh wrote:
>
> >> Because every plain
> >> text line in a file must be terminated with a newline.
> >
> >That's only a recent POSIX definition. It's not related to
> > real life. When I
Bob Proulx wrote:
That example shows a completely different problem. It shows that your
input plain text files have no terminating newline, making them
officially[/sic/] not plain text files but binary files.
Because every plain
text line in a file must be terminated with a newline.
On 11/26/2015 04:52 PM, Linda Walsh wrote:
>> Because every plain
>> text line in a file must be terminated with a newline.
>
>That's only a recent POSIX definition. It's not related to
> real life. When I looked for a text file definition on google, nothing
> was mentioned about
-Original Message-
From: Assaf Gordon [mailto:assafgor...@gmail.com]
Sent: November 23, 2015 2:03 PM
To: Macdonald, Kim - BCCDC; 22...@debbugs.gnu.org
Subject: Re: bug#22001: Is it possible to tab separate concatenated files?
tag 22001 notabug
close 22001
stop
Hello Kim,
On 11/23/2015 03
Correcting myself:
On 11/23/2015 05:02 PM, Assaf Gordon wrote:
If you have a file (one file) with spaces and you wish to convert
them to tabs, consider the 'expand' command (then pipe to 'cat' if
needed).
"unexpand" will convert spaces to tabs,
"expand" will convert tabs to spaces.
Macdonald, Kim - BCCDC wrote:
> Sorry for the confusion - I wanted to add a tab (or even a new line)
> after each file that was concatenated. Actually a new line may be
> better.
>
> For Example:
> Concatenate the files like so:
> >gi|452742846|ref|NZ_CAFD01001.1| Salmonella enterica subsp.,
tag 22001 notabug
close 22001
stop
Hello Kim,
On 11/23/2015 03:50 PM, Macdonald, Kim - BCCDC wrote:
I’m just looking at the options for the cat command – I see there’s a
way to ignore tabs when they exist – but is there a way to tab
separate the files you’re concatenating with the cat command?
Hello Kim,
On 11/23/2015 06:09 PM, Bob Proulx wrote:
Macdonald, Kim - BCCDC wrote:
For Example:
Concatenate the files like so:
gi|452742846|ref|NZ_CAFD01001.1| Salmonella enterica subsp., whole genome
shotgun sequenceTTTCAGCATATATATAGGCCATCATACATAGCCATATAT
Thanks so much!!! I'll try these out now
Kim
-Original Message-
From: Assaf Gordon [mailto:assafgor...@gmail.com]
Sent: November 23, 2015 3:48 PM
To: Bob Proulx; Macdonald, Kim - BCCDC
Cc: 22...@debbugs.gnu.org
Subject: Re: bug#22001: Is it possible to tab separate concatenated files
Hi!
I'm just looking at the options for the cat command - I see there's a way to
ignore tabs when they exist - but is there a way to tab separate the files
you're concatenating with the cat command?
Thanks,
Kim
10 matches
Mail list logo
