[ccp4bb] Protein Expression and Purification Scientist

[Andres PALENCIA]

Dear colleagues 

The following position is available in Grenoble (France):
Protein Expression and Purification Scientist, Biochemist, Structural Biologist

Job Description
A research technician position is available in the group Structural Biology of 
Novel Drug Targets in Human Diseases (https://noveltargets-palencia.com 
), at the Institute for Advanced 
Biosciences (Grenoble) to work on the expression, purification of protein-RNA 
complexes for structural studies, and their interactions with inhibitors in the 
field of infectious diseases and cancer.
In addition to structural biology and biophysical techniques, our laboratory 
also uses a wide range of approaches, from biochemistry and genetics to in vivo 
animal studies (in collaboration). We seek an outstanding candidate with 
training in molecular biology, protein/RNA biochemistry, with a strong interest 
in structural biology –crystallography or cryo-electron microscopy (EM)– to 
support the study of novel protein drug targets.

The successful candidate will use the in-house IAB facilities for protein 
production in different systems; other structural biology facilities of the 
Partnership for Structural Biology in Grenoble (EMBL-ESRF-IBS-ILL, 
http://www.psb-grenoble.eu ); and will interact 
with industrial partners.

Applicants should possess experience in molecular biology and protein 
production by using mammalian cells, bacteria or insect cells. Experience in 
the assembly and purification of protein-RNA complexes, crystallization and/or 
preparation of samples for EM studies would be an advantage. Motivation to work 
in a multidisciplinary and international environment is fundamental.

The candidate will work in the heart of the French Alpes (Grenoble) at the 
Institute for Advanced Biosciences (IAB), where creativity and excellence are 
fundamental to advance biomedical research and science education.  The IAB is a 
research center of the University of Grenoble-Alpes, the French National 
Institute of Health and Medical Research (INSERM), and the French National 
Center for Scientific Research (CNRS). Grenoble provides access to 
state-of-the-art structural biology technologies available at the ESRF, EMBL, 
IBS and ILL. This includes new EM facilities equipped with Titan Krios, and 
Glacios/Falcon III. Other facilities include the ESRF synchrotron X-ray 
beamlines, high-field NMR at the IBS as well as the high-throughput 
crystallization platform at the EMBL, mammalian and insect cell facilities, and 
the biophysical platform. The lab has access to other synchrotrons: DLS, DESY, 
SOLEIL, and SLS.

Applicants should provide a motivation letter and a CV with contact information 
for two or more referees.
For additional information please visit:

Research Group Website: https://noveltargets-palencia.com 
   

Job Location: Grenoble, France

Position Type: Full-Time/Regular

Starting Contract: 24 Months (renewable)

Starting Date: Immediate to summer 2022

Contact: andres.palen...@univ-grenoble-alpes.fr 
 
*
*
Dr. Andrés Palencia
National Institute of Health and Medical Research (Inserm)
Institute for Advanced Biosciences (IAB), Grenoble, Inserm–UGA–CNRS
Group Leader of Structural Biology of Novel Drug Targets in Human Diseases
Webpage: https://noveltargets-palencia.com
Phone: +33 (0) 476 54 95 75
ORCID:   orcid.org/-0002-1805-319X 

*
Address:
Institute for Advanced Biosciences (IAB), Inserm–UGA–CNRS
Site Santé, Allée des Alpes,
38700 La Tronche, France
Email: andres.palen...@univ-grenoble-alpes.fr
*
*




To unsubscribe from the CCP4BB list, click the following link:
https://www.jiscmail.ac.uk/cgi-bin/WA-JISC.exe?SUBED1=CCP4BB=1

This message was issued to members of www.jiscmail.ac.uk/CCP4BB, a mailing list 
hosted by www.jiscmail.ac.uk, terms & conditions are available at 
https://www.jiscmail.ac.uk/policyandsecurity/

[ccp4bb] Baculovirus expression system

[Srivastava, Dhiraj]

Thank you every one for all your input. Our concern was whether there is any 
new advanced system than Bac-to-Bac or Bac-to-Bac is still pretty standard 
system for baculovirus expression. Based on all your inputs, it appears that we 
are not very outdated in our information about baculovirus expression system. 
There may be few newer systems but not much advanced than Bac-to-Bac and don't 
save significant amount of time and effort.

Thank you
Dhiraj



To unsubscribe from the CCP4BB list, click the following link:
https://www.jiscmail.ac.uk/cgi-bin/WA-JISC.exe?SUBED1=CCP4BB=1

This message was issued to members of www.jiscmail.ac.uk/CCP4BB, a mailing list 
hosted by www.jiscmail.ac.uk, terms & conditions are available at 
https://www.jiscmail.ac.uk/policyandsecurity/

Re: [ccp4bb] Baculovirus expression system

[Artem Evdokimov]

There are several but if you discount the transfection based ones (i.e.
direct DNA, no virus at all) then the speed is roughly the same - about
four weeks from clone to process. FlashBac works a bit faster because it
avoids the use of ecoli to recombine the bacmid but the time savings is
about a week only.

As to yield - it is very protein specific and you do get many variables in
play including promoters, cell lines, media additives and so on

Artem

On Mon, Feb 7, 2022, 11:25 AM Srivastava, Dhiraj <
dhiraj-srivast...@uiowa.edu> wrote:

> Hi All
>  sorry for the question not related to crystallography. What is
> the baculovirus expression system that people use these days to get good
> yield in less time?
>
> Thank you
> Dhiraj
>
> --
>
> To unsubscribe from the CCP4BB list, click the following link:
> https://www.jiscmail.ac.uk/cgi-bin/WA-JISC.exe?SUBED1=CCP4BB=1
>



To unsubscribe from the CCP4BB list, click the following link:
https://www.jiscmail.ac.uk/cgi-bin/WA-JISC.exe?SUBED1=CCP4BB=1

This message was issued to members of www.jiscmail.ac.uk/CCP4BB, a mailing list 
hosted by www.jiscmail.ac.uk, terms & conditions are available at 
https://www.jiscmail.ac.uk/policyandsecurity/

Re: [ccp4bb] Baculovirus expression system

[Anshul Assaiya]

Please follow the link

https://www.sciencedirect.com/topics/biochemistry-genetics-and-molecular-biology/baculovirus-expression-system

On Mon, 7 Feb 2022, 21:54 Srivastava, Dhiraj, 
wrote:

> Hi All
>  sorry for the question not related to crystallography. What is
> the baculovirus expression system that people use these days to get good
> yield in less time?
>
> Thank you
> Dhiraj
>
> --
>
> To unsubscribe from the CCP4BB list, click the following link:
> https://www.jiscmail.ac.uk/cgi-bin/WA-JISC.exe?SUBED1=CCP4BB=1
>



To unsubscribe from the CCP4BB list, click the following link:
https://www.jiscmail.ac.uk/cgi-bin/WA-JISC.exe?SUBED1=CCP4BB=1

This message was issued to members of www.jiscmail.ac.uk/CCP4BB, a mailing list 
hosted by www.jiscmail.ac.uk, terms & conditions are available at 
https://www.jiscmail.ac.uk/policyandsecurity/

Re: [ccp4bb] Baculovirus expression system

[Antony Oliver]

Dear Dhiraj,

It may be perceived as “slow”, but we (still) use the Bac-to-Bac system from 
ThermoFisher (previously Invitrogen).
This coupled with the pFastBac, MultiBac or biGBac vector systems generally 
works well;  some proteins/complexes may express better in High 5 cells over 
Sf9/Sf21.

With regards,

Antony.


Antony W Oliver FHEA, PhD
Faculty Senior Research Fellow
Genome Damage and Stability Centre
Science Park Road
University of Sussex
Falmer, Brighton, BN1 9RQ





(office): +44 (0)1273 678349
(lab): +44 (0)1273 677512

antony.oli...@sussex.ac.uk<mailto:antony.oli...@sussex.ac.uk>; (he/him)
https://www.sussex.ac.uk/lifesci/oliverlab
https://tinyurl.com/aw-oliver
https://orcid.org/-0002-2912-8273
http://www.sussex.ac.uk/lifesci/internal/staff/support

From: CCP4 bulletin board  on behalf of "Srivastava, 
Dhiraj" 
Reply to: "Srivastava, Dhiraj" 
Date: Monday, 7 February 2022 at 16:24
To: "CCP4BB@JISCMAIL.AC.UK" 
Subject: [ccp4bb] Baculovirus expression system

Hi All
 sorry for the question not related to crystallography. What is the 
baculovirus expression system that people use these days to get good yield in 
less time?

Thank you
Dhiraj





To unsubscribe from the CCP4BB list, click the following link:
https://www.jiscmail.ac.uk/cgi-bin/WA-JISC.exe?SUBED1=CCP4BB=1

This message was issued to members of www.jiscmail.ac.uk/CCP4BB, a mailing list 
hosted by www.jiscmail.ac.uk, terms & conditions are available at 
https://www.jiscmail.ac.uk/policyandsecurity/

[ccp4bb] Baculovirus expression system

[Srivastava, Dhiraj]

Hi All
 sorry for the question not related to crystallography. What is the 
baculovirus expression system that people use these days to get good yield in 
less time?

Thank you
Dhiraj



To unsubscribe from the CCP4BB list, click the following link:
https://www.jiscmail.ac.uk/cgi-bin/WA-JISC.exe?SUBED1=CCP4BB=1

This message was issued to members of www.jiscmail.ac.uk/CCP4BB, a mailing list 
hosted by www.jiscmail.ac.uk, terms & conditions are available at 
https://www.jiscmail.ac.uk/policyandsecurity/

Re: [ccp4bb] Protein expression (codon bias)

[00000c2488af9525-dmarc-request]

I did crystallise a protein expressed in M. smegmatis a while ago (early 90's)! The cloning was done by Ying Zhang:https://www.jhsph.edu/faculty/directory/profile/786/ying-zhangIt might be worth dropping him a line. That's all I can suggest, sorry!!Good luck.Jon CooperOn 7 Jul 2020 10:07, Matthew Snee  wrote:

Hi all




I'm designing genes for _expression_ in M. smegmatis (safe host for Mtb proteins), but its not possible (or advisable due to the GC content) to optimise for

mycobacterial _expression_.




Would anyone with experience be able to tell me if its fine to stick with the E. coli codon optimisation, or if there is an advantage going with b. subtilis (or another G+ organism that is in Thermo's list).




Best wishes




Matthew.



To unsubscribe from the CCP4BB list, click the following link:
https://www.jiscmail.ac.uk/cgi-bin/WA-JISC.exe?SUBED1=CCP4BB=1




To unsubscribe from the CCP4BB list, click the following link:
https://www.jiscmail.ac.uk/cgi-bin/WA-JISC.exe?SUBED1=CCP4BB=1

[ccp4bb] Protein expression (codon bias)

[Matthew Snee]

Hi all

I'm designing genes for expression in M. smegmatis (safe host for Mtb 
proteins), but its not possible (or advisable due to the GC content) to 
optimise for
mycobacterial expression.

Would anyone with experience be able to tell me if its fine to stick with the 
E. coli codon optimisation, or if there is an advantage going with b. subtilis 
(or another G+ organism that is in Thermo's list).

Best wishes

Matthew.



To unsubscribe from the CCP4BB list, click the following link:
https://www.jiscmail.ac.uk/cgi-bin/WA-JISC.exe?SUBED1=CCP4BB=1

This message was issued to members of www.jiscmail.ac.uk/CCP4BB, a mailing list 
hosted by www.jiscmail.ac.uk, terms & conditions are available at 
https://www.jiscmail.ac.uk/policyandsecurity/

Re: [ccp4bb] protein expression in human cells

[Zhijie Li]

Hi all,

If anybody is interested in non-viral stable expression, we have a 
piggybac-based, doxycycline-inducible system. It is the reference 40 in the 
lentiviral paper that Tomas directed to.  We’d be happy to distribute the 
plasmids.

Zhijie


> On Jan 25, 2020, at 3:26 AM, Tomas Malinauskas  
> wrote:
> 
> Hi Gloria,
> 
> two key papers describing expression (transient and lentivirus-based)
> of proteins in HEK293 cells we use to make milligrams of proteins for
> crystallization and cryo-EM:
> 
> Acta Crystallogr D Biol Crystallogr. 2006 Oct;62(Pt 10):1243-50. Epub
> 2006 Sep 19.
> A time- and cost-efficient system for high-level protein production in
> mammalian cells.
> Aricescu AR, Lu W, Jones EY.
> PMID: 17001101
> 
> Nat Protoc. 2018 Dec;13(12):2991-3017. doi: 10.1038/s41596-018-0075-9.
> Lentiviral transduction of mammalian cells for fast, scalable and
> high-level production of soluble and membrane proteins.
> Elegheert J, Behiels E, Bishop B, Scott S, Woolley RE, Griffiths SC,
> Byrne EFX, Chang VT, Stuart DI, Jones EY, Siebold C, Aricescu AR.
> PMID: 30455477
> 
> Hope that helps,
> Tomas
> 
> 
> Dr. Tomas Malinauskas
> University of Oxford
> Wellcome Centre for Human Genetics
> Division of Structural Biology
> Roosevelt Drive
> Oxford OX3 7BN
> United Kingdom
> to...@strubi.ox.ac.uk
> tomas.malinaus...@gmail.com
> 
>> On Fri, Jan 24, 2020 at 11:50 PM Gloria Borgstahl  
>> wrote:
>> 
>> Hello CCP4-ers,
>> I was wondering what people have found to be the best human cell line 
>> expression system for making a large quantity of purified recombinant 
>> protein.
>> Any information and protocols would be greatly appreciated.
>> Happy 2020, Gloria
>> 
>> 
>> 
>> To unsubscribe from the CCP4BB list, click the following link:
>> https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB=1
> 
> 
> 
> To unsubscribe from the CCP4BB list, click the following link:
> https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB=1



To unsubscribe from the CCP4BB list, click the following link:
https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB=1

Re: [ccp4bb] protein expression in human cells

[Tomas Malinauskas]

Hi Gloria,

two key papers describing expression (transient and lentivirus-based)
of proteins in HEK293 cells we use to make milligrams of proteins for
crystallization and cryo-EM:

Acta Crystallogr D Biol Crystallogr. 2006 Oct;62(Pt 10):1243-50. Epub
2006 Sep 19.
A time- and cost-efficient system for high-level protein production in
mammalian cells.
Aricescu AR, Lu W, Jones EY.
PMID: 17001101

Nat Protoc. 2018 Dec;13(12):2991-3017. doi: 10.1038/s41596-018-0075-9.
Lentiviral transduction of mammalian cells for fast, scalable and
high-level production of soluble and membrane proteins.
Elegheert J, Behiels E, Bishop B, Scott S, Woolley RE, Griffiths SC,
Byrne EFX, Chang VT, Stuart DI, Jones EY, Siebold C, Aricescu AR.
PMID: 30455477

Hope that helps,
Tomas


Dr. Tomas Malinauskas
University of Oxford
Wellcome Centre for Human Genetics
Division of Structural Biology
Roosevelt Drive
Oxford OX3 7BN
United Kingdom
to...@strubi.ox.ac.uk
tomas.malinaus...@gmail.com

On Fri, Jan 24, 2020 at 11:50 PM Gloria Borgstahl  wrote:
>
> Hello CCP4-ers,
> I was wondering what people have found to be the best human cell line 
> expression system for making a large quantity of purified recombinant protein.
> Any information and protocols would be greatly appreciated.
> Happy 2020, Gloria
>
> 
>
> To unsubscribe from the CCP4BB list, click the following link:
> https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB=1



To unsubscribe from the CCP4BB list, click the following link:
https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB=1

Re: [ccp4bb] protein expression in human cells

[David Briggs]

For general information, HEKs were derived from a legally aborted foetus the in 
the Netherlands in 1973. Not "killed children".

(As a side note, such use of emotive language is counter-productive and often 
the tool of those who seek remove reproductive rights and autonomy from women. 
I'm certain we wouldn't want to be tarred with that brush.)

That said, use CHOs if you have an issue with HEKs. The only potential problem 
would be if what you wanted to study required authentic human 
post-translational modifications, and even then, I imagine CHOs would still be 
a suitable surrogate in the majority of cases.

Cheers,

Dave


--
Dr David C. Briggs
Senior Laboratory Research Scientist
Signalling and Structural Biology Lab
The Francis Crick Institute
London, UK
==
about.me/david_briggs

From: Petr Kolenko 
Sent: Saturday, January 25, 2020 7:10:06 AM
To: David Briggs ; CCP4BB@JISCMAIL.AC.UK 

Subject: RE: [ccp4bb] protein expression in human cells


Dear colleagues,

I wonder if there were a bit less controversial possibility. No matter if that 
was less efficient. Would there be an option of using human cell lines that do 
not origin from killed children? As far as I know, the HEK cells do. Sometimes, 
the science can be pretty cruel.

I am sorry for opening of this topic on a crystallographic forum, but so far, 
nobody has convinced me that I am allowed to work with these cell lines from a 
humanity (and Christian) point of view.

Best regards,

Petr





From: CCP4 bulletin board  On Behalf Of David Briggs
Sent: Saturday, January 25, 2020 7:49 AM
To: CCP4BB@JISCMAIL.AC.UK
Subject: Re: [ccp4bb] protein expression in human cells



Hi Gloria,

Another vote here for HEK 293 Expi or Freestyle.

The off-the-shelf transfection reagents are super expensive, but I make my own 
(happy to share protocols with anyone interested) and we normally get a few mgs 
of protein per litre of suspension culture -- certainly enough for 
crystallography.

If budget is an issue, semi-stable transfection of adherent HEK293s is much 
cheaper but the turnaround from vector to protein is much slower (a few weeks 
rather than a few days), and growing up panels of mutants can be quite tedious.

Cheers & good luck

Dave



--

Dr David C. Briggs

Senior Laboratory Research Scientist

Signalling and Structural Biology Lab

The Francis Crick Institute

London, UK

==

about.me/david_briggs





From: CCP4 bulletin board mailto:CCP4BB@JISCMAIL.AC.UK>> 
on behalf of Rezaul Karim 
<1e364c8f16de-dmarc-requ...@jiscmail.ac.uk<mailto:1e364c8f16de-dmarc-requ...@jiscmail.ac.uk>>
Sent: Saturday, January 25, 2020 1:31:02 AM
To: CCP4BB@JISCMAIL.AC.UK<mailto:CCP4BB@JISCMAIL.AC.UK> 
mailto:CCP4BB@JISCMAIL.AC.UK>>
Subject: Re: [ccp4bb] protein expression in human cells



In our lab, we see Expi293F works very good.



Thanks,
Reza



Md. Rezaul Karim
Graduate student, PhD Program in Integrated Biomedical Sciences

Morsani College of Medicine
University of South Florida
E-mail: reza...@yahoo.com<mailto:reza...@yahoo.com>, 
rez...@health.usf.edu<mailto:rez...@health.usf.edu>

Phone: +1-954-937-8487





On Friday, January 24, 2020, 4:51:11 PM EST, Gloria Borgstahl 
mailto:gborgst...@gmail.com>> wrote:





Hello CCP4-ers,

I was wondering what people have found to be the best human cell line 
expression system for making a large quantity of purified recombinant protein.

Any information and protocols would be greatly appreciated.

Happy 2020, Gloria





To unsubscribe from the CCP4BB list, click the following link:
https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB=1<https://eur03.safelinks.protection.outlook.com/?url=https%3A%2F%2Fwww.jiscmail.ac.uk%2Fcgi-bin%2Fwebadmin%3FSUBED1%3DCCP4BB%26A%3D1=02%7C01%7C%7C8d9cb69fc73147febb4308d7a1659dc1%7C4eed7807ebad415aa7a99170947f4eae%7C0%7C0%7C637155330121696788=qqIBXCSemuXhA57kmQV0LSsi951HzMK%2BcdBE0Pr3YvI%3D=0>





To unsubscribe from the CCP4BB list, click the following link:
https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB=1<https://eur03.safelinks.protection.outlook.com/?url=https%3A%2F%2Fwww.jiscmail.ac.uk%2Fcgi-bin%2Fwebadmin%3FSUBED1%3DCCP4BB%26A%3D1=02%7C01%7C%7C8d9cb69fc73147febb4308d7a1659dc1%7C4eed7807ebad415aa7a99170947f4eae%7C0%7C0%7C637155330121706793=RKNGSjCxiqW039sHw7FZu8rGyh%2FXmWYUYd8%2BkBkgb4w%3D=0>

The Francis Crick Institute Limited is a registered charity in England and 
Wales no. 1140062 and a company registered in England and Wales no. 06885462, 
with its registered office at 1 Midland Road London NW1 1AT





To unsubscribe from the CCP4BB list, click the following link:
https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB=1<https://eur03.safelinks.protection.outlook.com/?url=https%3A%2F%2

Re: [ccp4bb] protein expression in human cells

[Petr Kolenko]

Dear colleagues,
I wonder if there were a bit less controversial possibility. No matter if that 
was less efficient. Would there be an option of using human cell lines that do 
not origin from killed children? As far as I know, the HEK cells do. Sometimes, 
the science can be pretty cruel.
I am sorry for opening of this topic on a crystallographic forum, but so far, 
nobody has convinced me that I am allowed to work with these cell lines from a 
humanity (and Christian) point of view.
Best regards,
Petr


From: CCP4 bulletin board  On Behalf Of David Briggs
Sent: Saturday, January 25, 2020 7:49 AM
To: CCP4BB@JISCMAIL.AC.UK
Subject: Re: [ccp4bb] protein expression in human cells

Hi Gloria,
Another vote here for HEK 293 Expi or Freestyle.
The off-the-shelf transfection reagents are super expensive, but I make my own 
(happy to share protocols with anyone interested) and we normally get a few mgs 
of protein per litre of suspension culture -- certainly enough for 
crystallography.
If budget is an issue, semi-stable transfection of adherent HEK293s is much 
cheaper but the turnaround from vector to protein is much slower (a few weeks 
rather than a few days), and growing up panels of mutants can be quite tedious.
Cheers & good luck
Dave


--
Dr David C. Briggs
Senior Laboratory Research Scientist
Signalling and Structural Biology Lab
The Francis Crick Institute
London, UK
==
about.me/david_briggs


From: CCP4 bulletin board mailto:CCP4BB@JISCMAIL.AC.UK>> 
on behalf of Rezaul Karim 
<1e364c8f16de-dmarc-requ...@jiscmail.ac.uk<mailto:1e364c8f16de-dmarc-requ...@jiscmail.ac.uk>>
Sent: Saturday, January 25, 2020 1:31:02 AM
To: CCP4BB@JISCMAIL.AC.UK<mailto:CCP4BB@JISCMAIL.AC.UK> 
mailto:CCP4BB@JISCMAIL.AC.UK>>
Subject: Re: [ccp4bb] protein expression in human cells

In our lab, we see Expi293F works very good.

Thanks,
Reza

Md. Rezaul Karim
Graduate student, PhD Program in Integrated Biomedical Sciences
Morsani College of Medicine
University of South Florida
E-mail: reza...@yahoo.com<mailto:reza...@yahoo.com>, 
rez...@health.usf.edu<mailto:rez...@health.usf.edu>
Phone: +1-954-937-8487


On Friday, January 24, 2020, 4:51:11 PM EST, Gloria Borgstahl 
mailto:gborgst...@gmail.com>> wrote:


Hello CCP4-ers,
I was wondering what people have found to be the best human cell line 
expression system for making a large quantity of purified recombinant protein.
Any information and protocols would be greatly appreciated.
Happy 2020, Gloria



To unsubscribe from the CCP4BB list, click the following link:
https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB=1<https://eur03.safelinks.protection.outlook.com/?url=https%3A%2F%2Fwww.jiscmail.ac.uk%2Fcgi-bin%2Fwebadmin%3FSUBED1%3DCCP4BB%26A%3D1=02%7C01%7C%7Cdd4cd6f62475425a3afa08d7a1364e92%7C4eed7807ebad415aa7a99170947f4eae%7C0%7C0%7C637155126940120399=XEh8QKGrpCzQSR7EFXkx9uwNaJQGeUEZz6dmh%2FUQgso%3D=0>



To unsubscribe from the CCP4BB list, click the following link:
https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB=1<https://eur03.safelinks.protection.outlook.com/?url=https%3A%2F%2Fwww.jiscmail.ac.uk%2Fcgi-bin%2Fwebadmin%3FSUBED1%3DCCP4BB%26A%3D1=02%7C01%7C%7Cdd4cd6f62475425a3afa08d7a1364e92%7C4eed7807ebad415aa7a99170947f4eae%7C0%7C0%7C637155126940120399=XEh8QKGrpCzQSR7EFXkx9uwNaJQGeUEZz6dmh%2FUQgso%3D=0>

The Francis Crick Institute Limited is a registered charity in England and 
Wales no. 1140062 and a company registered in England and Wales no. 06885462, 
with its registered office at 1 Midland Road London NW1 1AT



To unsubscribe from the CCP4BB list, click the following link:
https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB=1



To unsubscribe from the CCP4BB list, click the following link:
https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB=1

Re: [ccp4bb] protein expression in human cells

[David Briggs]

Hi Gloria,

Another vote here for HEK 293 Expi or Freestyle.

The off-the-shelf transfection reagents are super expensive, but I make my own 
(happy to share protocols with anyone interested) and we normally get a few mgs 
of protein per litre of suspension culture -- certainly enough for 
crystallography.

If budget is an issue, semi-stable transfection of adherent HEK293s is much 
cheaper but the turnaround from vector to protein is much slower (a few weeks 
rather than a few days), and growing up panels of mutants can be quite tedious.

Cheers & good luck

Dave



--
Dr David C. Briggs
Senior Laboratory Research Scientist
Signalling and Structural Biology Lab
The Francis Crick Institute
London, UK
==
about.me/david_briggs


From: CCP4 bulletin board  on behalf of Rezaul Karim 
<1e364c8f16de-dmarc-requ...@jiscmail.ac.uk>
Sent: Saturday, January 25, 2020 1:31:02 AM
To: CCP4BB@JISCMAIL.AC.UK 
Subject: Re: [ccp4bb] protein expression in human cells

In our lab, we see Expi293F works very good.

Thanks,
Reza

Md. Rezaul Karim
Graduate student, PhD Program in Integrated Biomedical Sciences
Morsani College of Medicine
University of South Florida
E-mail: reza...@yahoo.com, rez...@health.usf.edu
Phone: +1-954-937-8487


On Friday, January 24, 2020, 4:51:11 PM EST, Gloria Borgstahl 
 wrote:


Hello CCP4-ers,
I was wondering what people have found to be the best human cell line 
expression system for making a large quantity of purified recombinant protein.
Any information and protocols would be greatly appreciated.
Happy 2020, Gloria



To unsubscribe from the CCP4BB list, click the following link:
https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB=1<https://eur03.safelinks.protection.outlook.com/?url=https%3A%2F%2Fwww.jiscmail.ac.uk%2Fcgi-bin%2Fwebadmin%3FSUBED1%3DCCP4BB%26A%3D1=02%7C01%7C%7Cdd4cd6f62475425a3afa08d7a1364e92%7C4eed7807ebad415aa7a99170947f4eae%7C0%7C0%7C637155126940120399=XEh8QKGrpCzQSR7EFXkx9uwNaJQGeUEZz6dmh%2FUQgso%3D=0>



To unsubscribe from the CCP4BB list, click the following link:
https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB=1<https://eur03.safelinks.protection.outlook.com/?url=https%3A%2F%2Fwww.jiscmail.ac.uk%2Fcgi-bin%2Fwebadmin%3FSUBED1%3DCCP4BB%26A%3D1=02%7C01%7C%7Cdd4cd6f62475425a3afa08d7a1364e92%7C4eed7807ebad415aa7a99170947f4eae%7C0%7C0%7C637155126940120399=XEh8QKGrpCzQSR7EFXkx9uwNaJQGeUEZz6dmh%2FUQgso%3D=0>

The Francis Crick Institute Limited is a registered charity in England and 
Wales no. 1140062 and a company registered in England and Wales no. 06885462, 
with its registered office at 1 Midland Road London NW1 1AT



To unsubscribe from the CCP4BB list, click the following link:
https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB=1

[ccp4bb] protein expression in human cells

[Gloria Borgstahl]

Hello CCP4-ers,
I was wondering what people have found to be the best human cell line
expression system for making a large quantity of purified recombinant
protein.
Any information and protocols would be greatly appreciated.
Happy 2020, Gloria



To unsubscribe from the CCP4BB list, click the following link:
https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB=1

[ccp4bb] Protein expression and purification: 12 months fixed term contract at Vertex Pharmaceutical

[Sarah Vial]

Dear All,

There is an opportunity to join the Protein Biochemistry team at Vertex 
Pharmaceuticals based in the UK as a Research Scientist (Protein expression and 
purification). Please see the advert in the link below. Interested candidates 
should apply directly through our website. Please do not send applications 
through to me directly. Applicants must be eligible to work in UK. The position 
is for a 12 month fixed term contract.

https://sjobs.brassring.com/TGWebHost/jobdetails.aspx?partnerid=25119=5134=10715BR


Best wishes
Sarah


This email message and any attachments are confidential and intended for use by 
the addressee(s) only. If you are not the intended recipient, please notify me 
immediately by replying to this message, and destroy all copies of this message 
and any attachments. Thank you.



To unsubscribe from the CCP4BB list, click the following link:
https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB=1

Re: [ccp4bb] Glycoprotein expression strategy

[Bernhard Rupp]

I would not discard the insect expression right away. In yeast or similar
you risk hyperglycosilation while sf tend to have paucimannose and
relatively homogeneous glcnac2man5 decorations. It can be hard (and
expensive) to homogeneously deglyc enzymatically but not sure if you also
want to crystallize the prot. You can prep eg pngasef yourself.

Best br


On Thu, Jul 12, 2018, 05:56 WENHE ZHONG 
wrote:

> Dear Community,
>
> A little bit out of topic here. An enzyme we like to use in our assay is
> commercially available. However, we found some unfavorable activities that
> probably from the contaminants from this commercial source. We checked the
> company website and found out this enzyme was purified from the original
> organism without tag for enhancing purification. No purity data was shown
> as well.
>
> So we want to see whether we can produce the recombinant protein with tag.
> After checking the literatures, this enzyme is a N-linked glycosylated
> protein (glycan attached to 3 asparagine residues) and is from
> fungi Penicillium citrinum. These 3 glycosylations probably affect protein
> folding, stability and its location in the cell. Currently we have three
> options here:
>
> 1. Express this enzyme in yeast which is a similar system compared to
> Penicillium citrinum. His6 tag will be added to the N- or C- terminal of
> this protein.
> 2. Express this enzyme in the periplasm of E.coli. However, no
> glycosylation system in E.coli. Only one paper published in a not well
> known journal used this method. But the result is not very conclusive to
> us. If their claim is correct, the glycosylation at this enzyme is not
> essential for protein production.
> 3. Express this enzyme in insect cells. More complicated and advanced
> glycosylation system in insect cells compared to fungi.
>
> Anyone has experience with glycoprotein? It will be very helpful if I can
> have your advice. Thank you.
>
> Kind regards,
> Wenhe
>
>
> --
>
> To unsubscribe from the CCP4BB list, click the following link:
> https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB=1
>



To unsubscribe from the CCP4BB list, click the following link:
https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB=1

Re: [ccp4bb] Glycoprotein expression strategy

[Artem Evdokimov]

Dear Wenhe,

>From my perspective you have quite a few options. Notably, the presence of
glycosylation in the native host does not always (or even often) mean that
you *must* have the protein in the native glyco-state in order to be
'right'. Very often glycosylation sites can be trimmed (by e.g. Kifunensine
and similar compounds) or mutated out. When one mutates glycosylation sites
one runs a significant risk of stopping export - meaning that without
correct glycosylaton some proteins do not secrete. This is very much
protein dependent and host dependent but I have personally experienced
about a dozen cases (out of hundreds which went just fine). So it's not a
#1 item to be scared of.

Options:

1. refold from IB in E. coli
2. secrete into periplasm in E. coli
3. secrete into media from a gram-positive organism (e.g. Bacillus)
4. secrete from yeast
5. secrete from insect cells
6. secrete from mammalian cells

For you it seems that 5 and  6 may be a bit of an overkill, but it all
depends on the nature of the protein you're working with :) I normally
recommend 1 and 6 to 'bracket' the probability spread (1 is very easy but
often not very successful whereas 6 is expensive but is often very
successful, and both are very fast).

Artem

- Cosmic Cats approve of this message

On Wed, Jul 11, 2018 at 11:54 PM, WENHE ZHONG 
wrote:

> Dear Community,
>
> A little bit out of topic here. An enzyme we like to use in our assay is
> commercially available. However, we found some unfavorable activities that
> probably from the contaminants from this commercial source. We checked the
> company website and found out this enzyme was purified from the original
> organism without tag for enhancing purification. No purity data was shown
> as well.
>
> So we want to see whether we can produce the recombinant protein with tag.
> After checking the literatures, this enzyme is a N-linked glycosylated
> protein (glycan attached to 3 asparagine residues) and is from
> fungi Penicillium citrinum. These 3 glycosylations probably affect protein
> folding, stability and its location in the cell. Currently we have three
> options here:
>
> 1. Express this enzyme in yeast which is a similar system compared to
> Penicillium citrinum. His6 tag will be added to the N- or C- terminal of
> this protein.
> 2. Express this enzyme in the periplasm of E.coli. However, no
> glycosylation system in E.coli. Only one paper published in a not well
> known journal used this method. But the result is not very conclusive to
> us. If their claim is correct, the glycosylation at this enzyme is not
> essential for protein production.
> 3. Express this enzyme in insect cells. More complicated and advanced
> glycosylation system in insect cells compared to fungi.
>
> Anyone has experience with glycoprotein? It will be very helpful if I can
> have your advice. Thank you.
>
> Kind regards,
> Wenhe
>
>
> --
>
> To unsubscribe from the CCP4BB list, click the following link:
> https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB=1
>



To unsubscribe from the CCP4BB list, click the following link:
https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB=1

[ccp4bb] Glycoprotein expression strategy

[WENHE ZHONG]

Dear Community,

A little bit out of topic here. An enzyme we like to use in our assay is 
commercially available. However, we found some unfavorable activities that 
probably from the contaminants from this commercial source. We checked the 
company website and found out this enzyme was purified from the original 
organism without tag for enhancing purification. No purity data was shown as 
well. 

So we want to see whether we can produce the recombinant protein with tag. 
After checking the literatures, this enzyme is a N-linked glycosylated protein 
(glycan attached to 3 asparagine residues) and is from fungi Penicillium 
citrinum. These 3 glycosylations probably affect protein folding, stability and 
its location in the cell. Currently we have three options here:

1. Express this enzyme in yeast which is a similar system compared to 
Penicillium citrinum. His6 tag will be added to the N- or C- terminal of this 
protein.
2. Express this enzyme in the periplasm of E.coli. However, no glycosylation 
system in E.coli. Only one paper published in a not well known journal used 
this method. But the result is not very conclusive to us. If their claim is 
correct, the glycosylation at this enzyme is not essential for protein 
production.
3. Express this enzyme in insect cells. More complicated and advanced 
glycosylation system in insect cells compared to fungi. 

Anyone has experience with glycoprotein? It will be very helpful if I can have 
your advice. Thank you.

Kind regards,
Wenhe




To unsubscribe from the CCP4BB list, click the following link:
https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB=1

Re: [ccp4bb] Glycoprotein expression question

[Zhijie Li]

Hi Bernhard,

I guess you knew all these and is really asking for people's experience, 
but please excuse me to start from the theory: N-glycans in eukaryotes 
are known to be involved in glycoprotein folding in the ER. They allow 
the nascent protein to get into the calnexin/calreticulin cycle in which 
these lectins/chaperones can recruit the disulfide isomerase ERP57. The 
N-glycans also serve as degradation signals in the ERAD pathways, where 
certain structures signify the cells that all efforts had failed on this 
molecule. Of course, for recombinant overproduction of proteins, these 
factors can both be dispensible: the bad proteins, as long as they can 
get secreted, might get preferentially lost during purification or 
crystallization. In fact considering that N-glycans either tether the 
not-so-folded protein to the Cxn/Crt cycle, or direct the terminally ill 
proteins to degradation, and that the quality control of cells could be 
leaky (which I think was exploited in some CFTR-related cases), one may 
even expect that in certain cases not-so-badly folded proteins may get 
to the surface easier if it does not contain N-glycans - pure 
conjectures though. But indeed there are a lot of disulfide-containing 
eukaryotic proteins that are completely not N-glycosylated in certain 
species while fairly well N-glycosylated (to the common extent of ~1 
site /80-100 residues) in many other species (although the surfaces of 
the proteins will be significantly different too). So, it seems that the 
requirement for N-glycan - chaperone - ERAD may not be very strong for 
every protein.


On the other hand, the first GlcNAc in the N-glycan is sometimes found 
to be very closely associated with the amino acid components of 
proteins, even half-inserted into the folded domain (eg., 1HCN, A/NAG94 
), which is a consequence of the co-translational addition of the 
N-glycans. In such case I would expect that the removal of the 
particular N-glycan by mutagenesis may be quite destructive to folding 
in certain cases. I know that there are reports in which people removed 
N-glycans one by one and observed very significant differences among 
sites on secretion/solubility.


So, my view is that many of the N-glycan sites are removable by 
mutagenesis, but certain sites are not. Therefore if one is faced with 
highly N-glycosylated proteins, it is more of a matter of luck or 
thoroughness if he/she starts to explore the combination of mutations. 
To complicate this further, one may also consider trying different ways 
of mutating the sites - besides changing the Asn to Asp, one can also 
consider mutating the S/T at the third position, which is in fact often 
how an N-glycosylation site gets lost among species. There is also the 
space of the Asn mutants to explore. What I did in the past was mutating 
the Asn to Gln, which does not introduce a charge difference.


Zhijie


On 11/04/2017 4:34 PM, Bernhard Rupp wrote:


Hi Fellows,

a humble question for our glyco-expressionists:

I have mutated out the Asns of the N-glycoslation consensus sites for Asp

(Asp simply because the PNGaseF treated protein stays stable so I 
thought that might be a good guess)


and indeed the unglycosilated mutant expresses well and gets secreted 
as planned.


But rumor has it that glycoproteins that are mutated to non-glyc often 
are not processed correctly and


that we had just dumb luck.

May I poll the educated opinion of the erudite here?

Cheers, BR

--

Bernhard Rupp

Crystallographiae Vindicis Militum Ordo

http://www.hofkristallamt.org/

b...@hofkristallamt.org 

+1 925 209 7429

+43 767 571 0536

--

:(){ :|: & };:

--

[ccp4bb] Fwd: Re: [ccp4bb] Glycoprotein expression question

[radu]

Hi Savvas,

Thank you for kindly pointing to our review. Bernhard, in my experience your
case is a rare exception rather than the rule, so indeed lucky. Adrian
summarised very nicely the wide impact glycans may have on folding,
trafficking and/or function. To keep things simple, there is no need to mutate
the N-glycosilation sites for structural work (other than perhaps to probe
their impact, but people don't seem to do this normally). PMID: 17355862
describes how to deal with these if the aim is to improve crystal quality. For
cryo-EM, glycans should definitely stay on. Why would one risk solving
meaningless structures?

Best wishes,

Radu

-- 
Radu Aricescu
MRC Laboratory of Molecular Biology
Francis Crick Avenue
Cambridge Biomedical Campus
Cambridge CB2 0QH, U.K.
tel: +44-(0)1223-267049
fax: +44-(0)1223-268305


 Original message 
>Date: Wed, 12 Apr 2017 10:24:10 +0200
>From: CCP4 bulletin board <CCP4BB@JISCMAIL.AC.UK> (on behalf of Savvas
Savvides <savvas.savvi...@ugent.be>)
>Subject: Re: [ccp4bb] Glycoprotein expression question
>To: CCP4BB@JISCMAIL.AC.UK
>
>Dear Bernhard
>Our campaigns over the years aiming to produce mammalian cytokines and the
ectodomains of cytokine receptors via eukaryotic expression systems (mainly
in several HEK293 flavors) for structural biology, have taught us that the
N-linked glycosylation issue remains a very empirical exercise. Our protein
targets are typically 15-70 kDa and have 2-6 predicted N-linked glycosylation
sites. For instance, we have seen that elimination of even one such site by
mutagenesis can abrogate protein secretion. So for those cases one may even
make an argument for a glycosylation ‘hotspot'.  Also, eliminating all
possible N-linked glycosylation sites at once in the couple of cases tried
has been synonymous with zero protein secretion. Our consensus of the
‘magic combo’ in terms of expression levels and stability is a reduction
of N-linked glycosylation sites by up to 1/3. Such reduced levels of
glycosylation also appear to be amenable for enzymatic glycan trimming in
subsequent stages of sample preparation with good results.
>The article http://dx.doi.org/10.1016/j.sbi.2013.04.003 by Aricescu and Owens
may provide some additional perspectives.
>
>best wishes
>Savvas
>
>
>> On 11 Apr 2017, at 22:34, Bernhard Rupp <hofkristall...@gmail.com> wrote:
>>
>> Hi Fellows,
>>
>> a humble question for our glyco-expressionists:
>>
>> I have mutated out the Asns of the N-glycoslation consensus sites for Asp
>> (Asp simply because the PNGaseF treated protein stays stable so I thought
that might be a good guess)
>> and indeed the unglycosilated mutant expresses well and gets secreted as
planned.
>>
>> But rumor has it that glycoproteins that are mutated to non-glyc often are
not processed correctly and
>> that we had just dumb luck.
>>
>> May I poll the educated opinion of the erudite here?
>>
>> Cheers, BR
>>
>> --
>> Bernhard Rupp
>> Crystallographiae Vindicis Militum Ordo
>> http://www.hofkristallamt.org/
>> b...@hofkristallamt.org
>> +1 925 209 7429
>> +43 767 571 0536
>> --
>> :(){ :|: & };:
>> --

Re: [ccp4bb] Glycoprotein expression question

[Savvas Savvides]

Dear Bernhard
Our campaigns over the years aiming to produce mammalian cytokines and the 
ectodomains of cytokine receptors via eukaryotic expression systems (mainly in 
several HEK293 flavors) for structural biology, have taught us that the 
N-linked glycosylation issue remains a very empirical exercise. Our protein 
targets are typically 15-70 kDa and have 2-6 predicted N-linked glycosylation 
sites. For instance, we have seen that elimination of even one such site by 
mutagenesis can abrogate protein secretion. So for those cases one may even 
make an argument for a glycosylation ‘hotspot'.  Also, eliminating all possible 
N-linked glycosylation sites at once in the couple of cases tried has been 
synonymous with zero protein secretion. Our consensus of the ‘magic combo’ in 
terms of expression levels and stability is a reduction of N-linked 
glycosylation sites by up to 1/3. Such reduced levels of glycosylation also 
appear to be amenable for enzymatic glycan trimming in subsequent stages of 
sample preparation with good results.  
The article http://dx.doi.org/10.1016/j.sbi.2013.04.003 by Aricescu and Owens 
may provide some additional perspectives.
 
best wishes
Savvas


> On 11 Apr 2017, at 22:34, Bernhard Rupp  wrote:
> 
> Hi Fellows,
>  
> a humble question for our glyco-expressionists: 
>  
> I have mutated out the Asns of the N-glycoslation consensus sites for Asp 
> (Asp simply because the PNGaseF treated protein stays stable so I thought 
> that might be a good guess) 
> and indeed the unglycosilated mutant expresses well and gets secreted as 
> planned. 
>  
> But rumor has it that glycoproteins that are mutated to non-glyc often are 
> not processed correctly and 
> that we had just dumb luck. 
>  
> May I poll the educated opinion of the erudite here?
>  
> Cheers, BR
>  
> --
> Bernhard Rupp
> Crystallographiae Vindicis Militum Ordo
> http://www.hofkristallamt.org/
> b...@hofkristallamt.org
> +1 925 209 7429
> +43 767 571 0536
> --
> :(){ :|: & };:
> --

Re: [ccp4bb] Glycoprotein expression question

[Adriana Erica Miele]

Good morning, Bernhard,

I do not think that you had pure luck (though serendipity helps a lot). You 
said that the PNGaseF treated protein was indeed stable, that was already a 
good hint.

In my little experience with N- and O-glycoproteins, with not a high percentage 
of sugar content, I saw a difference.
N-glycosylated proteins with Asn mutated to Asp tend to be more stable, because 
you are putting negative charges on the surface.
O-glycosylated proteins expressed unglycosylated or mutated do not gain in 
stability, and are prone to precipitation (whenever they are expressed). This 
is possibly due to the fact that  -OH on the surface have not the same effect 
as the negative charges.
Moreover, in the few entries in the PDB with O-linked sugars, these seems to be 
like un umbrella, covering/masking a larger portion of the protein's surface. 
Hence trimming the sugars off will expose potentially "sticky" parts.

That's my 2 cents.

Best regards,
Adriana

Re: [ccp4bb] Glycoprotein expression question

[Goldman, Adrian]

I think it completely depends on the protein: in some proteins, they are 
required for folding; in some (eg Fcs), they are not required for folding but 
for function); in some, some of them are required and others not; in some they 
are required _during_ folding, but afterwards they can be removed without 
affecting apparent stability.  We had that experience with some UDP glycosyl 
transferases.

Adrian


> On 12 Apr 2017, at 07:52, Jan Dohnalek  wrote:
> 
> We had experience with a relatively small glycoprotein - when glycosylation 
> sites were deleted, solubility went drastically down - we could not express 
> soluble any more. Back to eukaryotic expression system which worked.
> 
> So may be you were really lucky.
> 
> Jan
> 
> 
> On Tue, Apr 11, 2017 at 10:34 PM, Bernhard Rupp  > wrote:
> Hi Fellows,
> 
> 
> 
> a humble question for our glyco-expressionists:
> 
> 
> 
> I have mutated out the Asns of the N-glycoslation consensus sites for Asp
> 
> (Asp simply because the PNGaseF treated protein stays stable so I thought 
> that might be a good guess)
> 
> and indeed the unglycosilated mutant expresses well and gets secreted as 
> planned.
> 
> 
> 
> But rumor has it that glycoproteins that are mutated to non-glyc often are 
> not processed correctly and
> 
> that we had just dumb luck.
> 
> 
> 
> May I poll the educated opinion of the erudite here?
> 
> 
> 
> Cheers, BR
> 
> 
> 
> --
> 
> Bernhard Rupp
> 
> Crystallographiae Vindicis Militum Ordo
> 
> http://www.hofkristallamt.org/ 
> b...@hofkristallamt.org 
> +1 925 209 7429 
> +43 767 571 0536 
> --
> 
> :(){ :|: & };:
> 
> --
> 
> 
> 
> 
> 
> 
> --
> Jan Dohnalek, Ph.D
> Institute of Biotechnology
> Academy of Sciences of the Czech Republic
> Biocev
> Prumyslova 595
> 252 50 Vestec near Prague
> Czech Republic
> 
> Tel. +420 325 873 758



signature.asc
Description: Message signed with OpenPGP using GPGMail

Re: [ccp4bb] Glycoprotein expression question

[Jan Dohnalek]

We had experience with a relatively small glycoprotein - when glycosylation
sites were deleted, solubility went drastically down - we could not express
soluble any more. Back to eukaryotic expression system which worked.

So may be you were really lucky.

Jan


On Tue, Apr 11, 2017 at 10:34 PM, Bernhard Rupp 
wrote:

> Hi Fellows,
>
>
>
> a humble question for our glyco-expressionists:
>
>
>
> I have mutated out the Asns of the N-glycoslation consensus sites for Asp
>
> (Asp simply because the PNGaseF treated protein stays stable so I thought
> that might be a good guess)
>
> and indeed the unglycosilated mutant expresses well and gets secreted as
> planned.
>
>
>
> But rumor has it that glycoproteins that are mutated to non-glyc often are
> not processed correctly and
>
> that we had just dumb luck.
>
>
>
> May I poll the educated opinion of the erudite here?
>
>
>
> Cheers, BR
>
>
>
> --
>
> Bernhard Rupp
>
> Crystallographiae Vindicis Militum Ordo
>
> http://www.hofkristallamt.org/
>
> b...@hofkristallamt.org
>
> +1 925 209 7429 <(925)%20209-7429>
>
> +43 767 571 0536 <+43%207675%20710536>
>
> --
>
> :(){ :|: & };:
>
> --
>
>
>



-- 
Jan Dohnalek, Ph.D
Institute of Biotechnology
Academy of Sciences of the Czech Republic
Biocev
Prumyslova 595
252 50 Vestec near Prague
Czech Republic

Tel. +420 325 873 758

[ccp4bb] Glycoprotein expression question

[Bernhard Rupp]

Hi Fellows,

 

a humble question for our glyco-expressionists: 

 

I have mutated out the Asns of the N-glycoslation consensus sites for Asp 

(Asp simply because the PNGaseF treated protein stays stable so I thought
that might be a good guess) 

and indeed the unglycosilated mutant expresses well and gets secreted as
planned. 

 

But rumor has it that glycoproteins that are mutated to non-glyc often are
not processed correctly and 

that we had just dumb luck. 

 

May I poll the educated opinion of the erudite here?

 

Cheers, BR

 

--

Bernhard Rupp

Crystallographiae Vindicis Militum Ordo

  http://www.hofkristallamt.org/

  b...@hofkristallamt.org

+1 925 209 7429

+43 767 571 0536

--

:(){ :|: & };:

--

 

Re: [ccp4bb] Protein expression

[Reza Khayat]

Hi,

I’ve received a number of concurring suggestions. Some have requested more 
detail about the experiments. Here are the details.

1. Cells: BL21(DE3)
2. Plasmid: pET28a (T7 promoter)
3. Media: TB
4. Protein: cytoplasmic
5. Expression: Grow at 37degC until OD600=0.6, cool to 20degC, induce with 1mM 
IPTG, grow 16hrs at 20degC, centrifuge.
6. Lysis method: Sonication via micro-tip/macro-tip. Small culture produces 
soluble protein where as large culture produces insoluble protein. We first 
thought it may be due to poor lysis, thus equivalent amount of cells from 3 and 
500ml cultures were lysed with the micro-tip. Same results were observed.

Best wishes,
Reza

Reza Khayat, PhD
Assistant Professor
City College of New York
160 Convent Ave, MR-1135
New York, NY 10031
(212) 650-6070
rkha...@ccny.cuny.edumailto:rkha...@ccny.cuny.edu


On Mar 19, 2015, at 11:15 PM, John Fisher 
johncfishe...@gmail.commailto:johncfishe...@gmail.com wrote:

Hi Reza.
Clearly nobody needs to know anything about what protein you are specifically 
working on; that being said, in order to avoid a potentially endless email 
string of expert advices, please include everything detail-wise regarding your 
expression system, culture conditions, induction, and lysis method for BOTH the 
3 ml and 500 ml expression trials. You will get, I imagine, amazing advices 
likely specific enough to solve the problem without your having to chase your 
tail.
Best,
John Fisher

John C. Fisher, M.D./PhD

On Thu, Mar 19, 2015 at 2:33 PM, Reza Khayat 
rkha...@ccny.cuny.edumailto:rkha...@ccny.cuny.edu wrote:
Hi,

We can express quite a bit of soluble protein when growing 3ml cultures. 
However, the protein becomes insoluble (inclusion bodies) when we scale up to 
500ml cultures. Has anyone experienced such a problem, and found a solution to 
it? Thanks.

Best wishes,
Reza

Reza Khayat, PhD
Assistant Professor
Department of Chemistry
City College of New York
New York, NY 10031
http://www.khayatlab.org/
212-650-6070tel:212-650-6070

Re: [ccp4bb] Protein expression

[El Sahili Abbas]

Hi Reza,

A few month ago I had a the exact same problem and we checked everything 
we could think of but without any improvement. Finally we were able to 
solve the problem only by subcloning the ORF into another plasmid (pET9a 
or pET29b). The big difference being the His tag position (C-ter or 
N-ter) might be critical for some protein solubility in large scale 
protein expression.


Hope it could help

Abbas


Le 20/03/2015 11:56, Reza Khayat a écrit :

Hi,

I’ve received a number of concurring suggestions. Some have requested 
more detail about the experiments. Here are the details.


1. Cells: BL21(DE3)
2. Plasmid: pET28a (T7 promoter)
3. Media: TB
4. Protein: cytoplasmic
5. Expression: Grow at 37degC until OD600=0.6, cool to 20degC, induce 
with 1mM IPTG, grow 16hrs at 20degC, centrifuge.
6. Lysis method: Sonication via micro-tip/macro-tip. Small culture 
produces soluble protein where as large culture produces insoluble 
protein. We first thought it may be due to poor lysis, thus equivalent 
amount of cells from 3 and 500ml cultures were lysed with the 
micro-tip. Same results were observed.


Best wishes,
Reza

Reza Khayat, PhD
Assistant Professor
City College of New York
160 Convent Ave, MR-1135
New York, NY 10031
(212) 650-6070
rkha...@ccny.cuny.edu mailto:rkha...@ccny.cuny.edu


On Mar 19, 2015, at 11:15 PM, John Fisher johncfishe...@gmail.com 
mailto:johncfishe...@gmail.com wrote:


Hi Reza.
Clearly nobody needs to know anything about what protein you are 
specifically working on; that being said, in order to avoid a 
potentially endless email string of expert advices, please include 
everything detail-wise regarding your expression system, culture 
conditions, induction, and lysis method for BOTH the 3 ml and 500 ml 
expression trials. You will get, I imagine, amazing advices likely 
specific enough to solve the problem without your having to chase 
your tail.

Best,
John Fisher

John C. Fisher, M.D./PhD

On Thu, Mar 19, 2015 at 2:33 PM, Reza Khayat rkha...@ccny.cuny.edu 
mailto:rkha...@ccny.cuny.edu wrote:


Hi,

We can express quite a bit of soluble protein when growing 3ml
cultures. However, the protein becomes insoluble (inclusion
bodies) when we scale up to 500ml cultures. Has anyone
experienced such a problem, and found a solution to it? Thanks.

Best wishes,

Reza

Reza Khayat, PhD

Assistant Professor

Department of Chemistry

City College of New York

New York, NY 10031

http://www.khayatlab.org/

212-650-6070 tel:212-650-6070






--

El Sahili Abbas
Ph.D. Student
(+33) 01.69.82.42.49
abbas.el-sah...@lebs.cnrs-gif.fr

Solange Moréra Team
Structural Microbiology  Enzymology
Institut for Integrative Biology of the Cell (I2BC)
Biochemistry, Biophysic and Structural Biology (B3S) Departement
CNRS-Gif campus
Bat 34, Avenue de la Terrasse
91190 Gif sur Yvette

Re: [ccp4bb] Protein expression

[Reza Khayat]

Hi,

Cultures are being properly cooled prior to induction (water bath supplemented 
with ice).

Reza

Reza Khayat, PhD
Assistant Professor
Department of Chemistry
City College of New York
New York, NY 10031
http://www.khayatlab.org/
212-650-6070

From: lieh low [mailto:liehy...@gmail.com]
Sent: Friday, March 20, 2015 8:06 AM
To: Reza Khayat
Cc: CCP4BB@JISCMAIL.AC.UK
Subject: Re: [ccp4bb] Protein expression

Reza,
someone might have mentioned this, it takes longer time to cool down larger 
culture, we turn down the temp of the shaker when OD is about 0.4. For some 
protocol, we even use ice to cool the flask down before induction. You might 
also want to consider a lower induction temp, like 16degC. Maybe your protein 
is just temp sensitive.

ray

On Fri, Mar 20, 2015 at 6:56 AM, Reza Khayat 
rkha...@ccny.cuny.edumailto:rkha...@ccny.cuny.edu wrote:
Hi,

I’ve received a number of concurring suggestions. Some have requested more 
detail about the experiments. Here are the details.

1. Cells: BL21(DE3)
2. Plasmid: pET28a (T7 promoter)
3. Media: TB
4. Protein: cytoplasmic
5. Expression: Grow at 37degC until OD600=0.6, cool to 20degC, induce with 1mM 
IPTG, grow 16hrs at 20degC, centrifuge.
6. Lysis method: Sonication via micro-tip/macro-tip. Small culture produces 
soluble protein where as large culture produces insoluble protein. We first 
thought it may be due to poor lysis, thus equivalent amount of cells from 3 and 
500ml cultures were lysed with the micro-tip. Same results were observed.

Best wishes,
Reza

Reza Khayat, PhD
Assistant Professor
City College of New York
160 Convent Ave, MR-1135
New York, NY 10031
(212) 650-6070tel:%28212%29%20650-6070
rkha...@ccny.cuny.edumailto:rkha...@ccny.cuny.edu

On Mar 19, 2015, at 11:15 PM, John Fisher 
johncfishe...@gmail.commailto:johncfishe...@gmail.com wrote:

Hi Reza.
Clearly nobody needs to know anything about what protein you are specifically 
working on; that being said, in order to avoid a potentially endless email 
string of expert advices, please include everything detail-wise regarding your 
expression system, culture conditions, induction, and lysis method for BOTH the 
3 ml and 500 ml expression trials. You will get, I imagine, amazing advices 
likely specific enough to solve the problem without your having to chase your 
tail.
Best,
John Fisher

John C. Fisher, M.D./PhD

On Thu, Mar 19, 2015 at 2:33 PM, Reza Khayat 
rkha...@ccny.cuny.edumailto:rkha...@ccny.cuny.edu wrote:
Hi,

We can express quite a bit of soluble protein when growing 3ml cultures. 
However, the protein becomes insoluble (inclusion bodies) when we scale up to 
500ml cultures. Has anyone experienced such a problem, and found a solution to 
it? Thanks.

Best wishes,
Reza

Reza Khayat, PhD
Assistant Professor
Department of Chemistry
City College of New York
New York, NY 10031
http://www.khayatlab.org/
212-650-6070tel:212-650-6070

Re: [ccp4bb] Protein expression

[lieh low]

Reza,
someone might have mentioned this, it takes longer time to cool down larger
culture, we turn down the temp of the shaker when OD is about 0.4. For some
protocol, we even use ice to cool the flask down before induction. You
might also want to consider a lower induction temp, like 16degC. Maybe your
protein is just temp sensitive.

ray

On Fri, Mar 20, 2015 at 6:56 AM, Reza Khayat rkha...@ccny.cuny.edu wrote:

  Hi,

  I’ve received a number of concurring suggestions. Some have requested
 more detail about the experiments. Here are the details.

  1. Cells: BL21(DE3)
 2. Plasmid: pET28a (T7 promoter)
 3. Media: TB
 4. Protein: cytoplasmic
 5. Expression: Grow at 37degC until OD600=0.6, cool to 20degC, induce with
 1mM IPTG, grow 16hrs at 20degC, centrifuge.
 6. Lysis method: Sonication via micro-tip/macro-tip. Small culture
 produces soluble protein where as large culture produces insoluble protein.
 We first thought it may be due to poor lysis, thus equivalent amount of
 cells from 3 and 500ml cultures were lysed with the micro-tip. Same results
 were observed.

  Best wishes,
 Reza

 Reza Khayat, PhD
 Assistant Professor
 City College of New York
 160 Convent Ave, MR-1135
 New York, NY 10031
 (212) 650-6070
 rkha...@ccny.cuny.edu


  On Mar 19, 2015, at 11:15 PM, John Fisher johncfishe...@gmail.com
 wrote:

  Hi Reza.
 Clearly nobody needs to know anything about what protein you are
 specifically working on; that being said, in order to avoid a potentially
 endless email string of expert advices, please include everything
 detail-wise regarding your expression system, culture conditions,
 induction, and lysis method for BOTH the 3 ml and 500 ml expression trials.
 You will get, I imagine, amazing advices likely specific enough to solve
 the problem without your having to chase your tail.
 Best,
 John Fisher

  John C. Fisher, M.D./PhD

 On Thu, Mar 19, 2015 at 2:33 PM, Reza Khayat rkha...@ccny.cuny.edu
 wrote:

  Hi,



 We can express quite a bit of soluble protein when growing 3ml cultures.
 However, the protein becomes insoluble (inclusion bodies) when we scale up
 to 500ml cultures. Has anyone experienced such a problem, and found a
 solution to it? Thanks.



 Best wishes,

 Reza



 Reza Khayat, PhD

 Assistant Professor

 Department of Chemistry

 City College of New York

 New York, NY 10031

 http://www.khayatlab.org/

 212-650-6070

Re: [ccp4bb] Protein expression

[Raji Edayathumangalam]

Hi Reza,

In addition to the many useful suggestions already made, I would suggest
lowering the final concentrations of IPTG. In many cases, 1mM IPTG
interferes with expression levels and/or solubility. This suggestion does
not address your concern for why things become ugly in going from 3mL to
500mL (for which there can be many many explanations), but its worth a try
before you head off to make many more clones.

Cheers and best wishes,
Raji



On Thu, Mar 19, 2015 at 3:33 PM, Reza Khayat rkha...@ccny.cuny.edu wrote:

  Hi,



 We can express quite a bit of soluble protein when growing 3ml cultures.
 However, the protein becomes insoluble (inclusion bodies) when we scale up
 to 500ml cultures. Has anyone experienced such a problem, and found a
 solution to it? Thanks.



 Best wishes,

 Reza



 Reza Khayat, PhD

 Assistant Professor

 Department of Chemistry

 City College of New York

 New York, NY 10031

 http://www.khayatlab.org/

 212-650-6070

Re: [ccp4bb] Protein expression

[Tiit Lukk]

Dear Reza,

It sounds to me like an aeration issue. I don't of course know how the 3 ml
culture is grown, but if say the small culture is less perfectly aerated
and slightly anaerobic, slower growth would mean slower metabolism and
slower protein production as well so things do not build up so easily in
inclusion bodies. I've had something like this happen in the past. The case
I'm talking about was that the protein did not express in aerobic
conditions (4 L flask, 500 mL of culture), when I increased the liquid
volume to 2-3L in the flask, the culture became slightly anaerobic and
protein production turned on. Perhaps this is your case as well. Might be
worth a shot!

Cheers,
-Tiit


--
Tiit Lukk
Staff Scientist
CHESS
200L Wilson Lab
Ithaca, NY 14853
phone: 607-255-5717
e-mail: tl...@cornell.edu
url: http://www.chess.cornell.edu

On Thu, Mar 19, 2015 at 3:33 PM, Reza Khayat rkha...@ccny.cuny.edu wrote:

  Hi,



 We can express quite a bit of soluble protein when growing 3ml cultures.
 However, the protein becomes insoluble (inclusion bodies) when we scale up
 to 500ml cultures. Has anyone experienced such a problem, and found a
 solution to it? Thanks.



 Best wishes,

 Reza



 Reza Khayat, PhD

 Assistant Professor

 Department of Chemistry

 City College of New York

 New York, NY 10031

 http://www.khayatlab.org/

 212-650-6070

Re: [ccp4bb] Protein expression

[Artem Evdokimov]

Question: you're taking a 3-ml equivalent out of 500 ml culture, and
processing it as if it was a 3ml culture? Or are you basing the result on
processing the entire 500ml?

Reason I ask this is simply to make sure your extraction/purification
timing is the same in both cases. It matters!

Assuming that the protein really is not soluble at 500ml and is somewhat
soluble at 3ml - which expression set up are you using? IPTG or
autoinduction? more details is better. For example, if you use IPTG - how
do you determine when to induce - OD? or some other measure?

The advice to change aeration is solid. Try it both ways, meaning up or
down - it could go either way depending on the difference in your set up. A
3ml culture in a 24-well block at 800 rpm is MUCH better aerated than 500ml
culture in non-baffled 1L flask at 250rpm. You also may want to play with
temperature, and if you're not using AIM - try it out.

Artem

- Cosmic Cats approve of this message

On Thu, Mar 19, 2015 at 2:33 PM, Reza Khayat rkha...@ccny.cuny.edu wrote:

  Hi,



 We can express quite a bit of soluble protein when growing 3ml cultures.
 However, the protein becomes insoluble (inclusion bodies) when we scale up
 to 500ml cultures. Has anyone experienced such a problem, and found a
 solution to it? Thanks.



 Best wishes,

 Reza



 Reza Khayat, PhD

 Assistant Professor

 Department of Chemistry

 City College of New York

 New York, NY 10031

 http://www.khayatlab.org/

 212-650-6070

Re: [ccp4bb] Protein expression

[John Fisher]

Hi Reza.
Clearly nobody needs to know anything about what protein you are
specifically working on; that being said, in order to avoid a potentially
endless email string of expert advices, please include everything
detail-wise regarding your expression system, culture conditions,
induction, and lysis method for BOTH the 3 ml and 500 ml expression trials.
You will get, I imagine, amazing advices likely specific enough to solve
the problem without your having to chase your tail.
Best,
John Fisher

John C. Fisher, M.D./PhD

On Thu, Mar 19, 2015 at 2:33 PM, Reza Khayat rkha...@ccny.cuny.edu wrote:

  Hi,



 We can express quite a bit of soluble protein when growing 3ml cultures.
 However, the protein becomes insoluble (inclusion bodies) when we scale up
 to 500ml cultures. Has anyone experienced such a problem, and found a
 solution to it? Thanks.



 Best wishes,

 Reza



 Reza Khayat, PhD

 Assistant Professor

 Department of Chemistry

 City College of New York

 New York, NY 10031

 http://www.khayatlab.org/

 212-650-6070

Re: [ccp4bb] over-expression strategies

[Fernandez, Elias J]

Yes, the gene's been codon-optimized. The predicted mRNA structure appears 
stronger in the optimized version than the native, where it is high too. And, 
expression levels are unchanged. Elias


From: CCP4 bulletin board [CCP4BB@JISCMAIL.AC.UK] on behalf of Elias Fernandez 
[efern...@utk.edu]
Sent: Thursday, September 12, 2013 10:22 AM
To: CCP4BB@JISCMAIL.AC.UK
Subject: [ccp4bb] over-expression strategies

Dear CCP4ers,
We’ve been struggling with little (nearly none) expression of our protein, in 
both E coli and with in vitro transcription/translation methods. It appears 
that our mRNA has high 2’ structure with a low dG (theoretically ~760kcal/mol). 
If this is indeed the source of our problem, are there any potential strategies 
to either disrupt the mRNA structure chemically (in E coli or in vitro) or with 
 thermophile expression systems for expression at higher temperatures?
Regards,
Elias

Re: [ccp4bb] over-expression strategies

[Phoebe A. Rice]

Something I recently learned from a friend: try changing the 4th base in the 
coding sequence to G (e.g. ATGGxx...) and the ribosome will like it better.  We 
tried it recently on a frustrating construct and it worked like a charm.


From: CCP4 bulletin board [CCP4BB@JISCMAIL.AC.UK] on behalf of Fernandez, Elias 
J [efern...@utk.edu]
Sent: Friday, September 13, 2013 7:03 AM
To: CCP4BB@JISCMAIL.AC.UK
Subject: Re: [ccp4bb] over-expression strategies


Yes, the gene's been codon-optimized. The predicted mRNA structure appears 
stronger in the optimized version than the native, where it is high too. And, 
expression levels are unchanged. Elias


From: CCP4 bulletin board [CCP4BB@JISCMAIL.AC.UK] on behalf of Elias Fernandez 
[efern...@utk.edu]
Sent: Thursday, September 12, 2013 10:22 AM
To: CCP4BB@JISCMAIL.AC.UK
Subject: [ccp4bb] over-expression strategies

Dear CCP4ers,
We’ve been struggling with little (nearly none) expression of our protein, in 
both E coli and with in vitro transcription/translation methods. It appears 
that our mRNA has high 2’ structure with a low dG (theoretically ~760kcal/mol). 
If this is indeed the source of our problem, are there any potential strategies 
to either disrupt the mRNA structure chemically (in E coli or in vitro) or with 
 thermophile expression systems for expression at higher temperatures?
Regards,
Elias

Re: [ccp4bb] over-expression strategies

[Bosch, Juergen]

Is your gene of interest smaller than 750bp ?
Then I would synthesize the gene with IDT and optimize it for E.coli that's 139$
Jürgen

..
Jürgen Bosch
Johns Hopkins Bloomberg School of Public Health
Department of Biochemistry  Molecular Biology
Johns Hopkins Malaria Research Institute
615 North Wolfe Street, W8708
Baltimore, MD 21205
Phone: +1-410-614-4742
Lab:  +1-410-614-4894
Fax:  +1-410-955-3655
http://lupo.jhsph.edu

On Sep 12, 2013, at 10:23, Elias Fernandez 
efern...@utk.edumailto:efern...@utk.edu wrote:

Dear CCP4ers,
We’ve been struggling with little (nearly none) expression of our protein, in 
both E coli and with in vitro transcription/translation methods. It appears 
that our mRNA has high 2’ structure with a low dG (theoretically ~760kcal/mol). 
If this is indeed the source of our problem, are there any potential strategies 
to either disrupt the mRNA structure chemically (in E coli or in vitro) or with 
 thermophile expression systems for expression at higher temperatures?
Regards,
Elias

[ccp4bb] over-expression strategies

[Elias Fernandez]

Dear CCP4ers,

We've been struggling with little (nearly none) expression of our protein,
in both E coli and with in vitro transcription/translation methods. It
appears that our mRNA has high 2' structure with a low dG (theoretically
~760kcal/mol). If this is indeed the source of our problem, are there any
potential strategies to either disrupt the mRNA structure chemically (in E
coli or in vitro) or with  thermophile expression systems for expression at
higher temperatures?

Regards,

Elias

Re: [ccp4bb] yeast expression

[xaravich ivan]

Hi Alan,
Is there a specific reason to choose Saccharomyces? I know a lot of labs
use Pichia for protein production. I think you might look into it.




On Mon, Aug 5, 2013 at 5:55 AM, Alan F Scott alan.sc...@bristol.ac.ukwrote:

  Dear All,

  Sorry for the off-topic post. I am looking to overproduce a protein for
 crystallography purposes in *Saccharomyces cerevisiae*. Nobody in my lab
 has ever overproduced a protein in yeast before so I need to try producing
 a control protein first. Does anybody know an *E. coli *or yeast protein
 which can be easily produced in *Saccharomyces *in large quantities
 please? Thanks for any suggestions.

 Best wishes,

 Alan

[ccp4bb] yeast expression

[Alan F Scott]

Dear All,

 Sorry for the off-topic post. I am looking to overproduce a protein 
for crystallography purposes in /Saccharomyces cerevisiae/. Nobody in my 
lab has ever overproduced a protein in yeast before so I need to try 
producing a control protein first. Does anybody know an /E. coli /or 
yeast protein which can be easily produced in /Saccharomyces /in large 
quantities please? Thanks for any suggestions.


Best wishes,

Alan

Re: [ccp4bb] yeast expression

[David Mueller]

We used expression of full length beta-galatosidase in yeast for a lab
class.  Simple to purify, simple to assay.


On Mon, Aug 5, 2013 at 6:55 AM, Alan F Scott alan.sc...@bristol.ac.ukwrote:

  Dear All,

  Sorry for the off-topic post. I am looking to overproduce a protein for
 crystallography purposes in *Saccharomyces cerevisiae*. Nobody in my lab
 has ever overproduced a protein in yeast before so I need to try producing
 a control protein first. Does anybody know an *E. coli *or yeast protein
 which can be easily produced in *Saccharomyces *in large quantities
 please? Thanks for any suggestions.

 Best wishes,

 Alan




-- 
David M. Mueller
Biochemistry and Molecular Biology
The Chicago Medical School
Rosalind Franklin University of Medicine and Science
 Green Bay Road
North Chicago, IL 60064
*david.muel...@rosalindfranklin.edu
http://lmb-il.org/index.html
*Office: 847-578-8606
FAX: 847-578-3240

[ccp4bb] no expression

[Jahan Alikhajeh]

Dear friends,

 I am sorry for off-topic though it may be related indirectly!
 I mutated a 60kDa protein (changing from X--Pro). After doing all the steps, 
I sequenced the expression vector. It seems everything is fine, even with 
promoter, but, I can't express it. I tried different Tempratures, IPTG (with 
new Stock), media, but they didnot make any difference. Any suggestion is 
highly appreciated.

 Best,
 Jahan

Re: [ccp4bb] no expression

[Bosch, Juergen]

Some very stupid questions from my side:
- it is an expression vector and you are in frame with your gene of interest ?
- you are using E. coli strains suitable for expression ?
- have you tried adding glucose to the media to avoid leaky expression in case 
your protein is toxic to E. coli ?
- the wild type expresses well ? In the same vector  strain ?
- how do you determine if it was expressed ? Western blot of tag ?

Jürgen

Sent from my iPad

On May 5, 2012, at 16:17, Jahan Alikhajeh 
ja...@graduate.orgmailto:ja...@graduate.org wrote:

Dear friends,

I am sorry for off-topic though it may be related indirectly!
I mutated a 60kDa protein (changing from X--Pro). After doing all the steps, I 
sequenced the expression vector. It seems everything is fine, even with 
promoter, but, I can't express it. I tried different Tempratures, IPTG (e

with new Stock), media, but they didnot make any difference. Any suggestion is 
highly appreciated.

Best,
Jahan

Re: [ccp4bb] no expression

[Xiaodi Yu]

Plus check the insoluble part or the whole cell.

 

Date: Sat, 5 May 2012 16:30:06 -0400
From: jubo...@jhsph.edu
Subject: Re: [ccp4bb] no expression
To: CCP4BB@JISCMAIL.AC.UK

Some very stupid questions from my side:- it is an expression vector and you 
are in frame with your gene of interest ?- you are using E. coli strains 
suitable for expression ?- have you tried adding glucose to the media to avoid 
leaky expression in case your protein is toxic to E. coli ?- the wild type 
expresses well ? In the same vector  strain ?- how do you determine if it was 
expressed ? Western blot of tag ?
Jürgen 

Sent from my iPad
On May 5, 2012, at 16:17, Jahan Alikhajeh ja...@graduate.org wrote:

Dear friends,
 

 
I am sorry for off-topic though it may be related indirectly!
 
I mutated a 60kDa protein (changing from X--Pro). After doing all the steps, I 
sequenced the expression vector. It seems everything is fine, even with 
promoter, but, I can't express it. I tried different Tempratures, IPTG (e 
with new Stock), media, but they didnot make any difference. Any suggestion is 
highly appreciated.
 

 
Best,
 
Jahan
  

Re: [ccp4bb] mammalian expression vector

[A. Radu Aricescu]

Hi Jerry,

You may find that pcDNA3.1 won't give you the protein yields needed for 
crystallization. Have a look at PMID: 17001101 for an alternative. Your Kozak 
sequence looks good,

radu

--
A. Radu Aricescu, PhD
University Research Lecturer
MRC Career Development Award Fellow

University of Oxford
Wellcome Trust Centre for Human Genetics
Division of Structural Biology
Roosevelt Drive, Oxford OX3 7BN
United Kingdom
Phone: +44-1865-287564
Fax: +44-1865-287547


 Original message 
Date: Tue, 13 Mar 2012 19:36:30 -0700
From: CCP4 bulletin board CCP4BB@JISCMAIL.AC.UK (on behalf of Jerry McCully 
for-crystallizai...@hotmail.com)
Subject: [ccp4bb] mammalian expression vector  
To: CCP4BB@JISCMAIL.AC.UK

   Dear ALL;

 As an alternative strategy to avoid endotoxin,
   I plan to express the protein in mammalian cells.

 As suggested by others, the typical vector is
   pcDNA3.1(+).  Does anyone have comments on this
   vector or recommend some other powerful vectors?

I am new to mammalian expression. I designed a
   Kozak sequence followed by a BSA signal peptide in
   order to clone the target into pcDNA3.1(+).

 Is it right?  Tentative Kozak sequence:
   GAGCTCGGATCCGCCACCATGAAGTGGGTAACCTTTCTCCTCCTCCTCTTCATCTCCGGTTCTGCCCT

  Thanks a lot,

   Jerry

[ccp4bb] mammalian expression vector

[Jerry McCully]

Dear ALL;

  As an alternative strategy to avoid endotoxin, I plan to express the 
protein in mammalian cells. 

  As suggested by others, the typical vector is pcDNA3.1(+).  Does anyone 
have comments on this vector or recommend some other powerful vectors?

 I am new to mammalian expression. I designed a Kozak sequence followed by 
a BSA signal peptide in order to clone the target into pcDNA3.1(+).

  Is it right?  Tentative Kozak sequence:  
GAGCTCGGATCCGCCACCATGAAGTGGGTAACCTTTCTCCTCCTCCTCTTCATCTCCGGTTCTGCCCT

   Thanks a lot,

Jerry
  

[ccp4bb] Protein expression, purification and crystallization

[Hena Dutta]

Dear Members of CCP4BB and PHENIXBB,

Can you suggest a reliable website where I can get basic and advanced
information on protein expression, purification and crystallization. I like
to read on the monitor.
Thanking you in advance...
Hena

Re: [ccp4bb] Protein expression, purification and crystallization

[Bernhard Rupp (Hofkristallrat a.D.)]

If you are eligible, I'd highly recommend the EMBO courses in Europe or the
CSHL courses in the US on those subjects. Reading is a good start but will
not be enough if you want to do real work.for strategy considerations, there
is always Ch 3 and 4 in le livre.  

 

Best, BR

From: CCP4 bulletin board [mailto:CCP4BB@JISCMAIL.AC.UK] On Behalf Of Hena
Dutta
Sent: Thursday, July 21, 2011 10:29 AM
To: CCP4BB@JISCMAIL.AC.UK
Subject: [ccp4bb] Protein expression, purification and crystallization

 

Dear Members of CCP4BB and PHENIXBB,

Can you suggest a reliable website where I can get basic and advanced
information on protein expression, purification and crystallization. I like
to read on the monitor.
Thanking you in advance...
Hena

Re: [ccp4bb] low expression and aggregation of protein

[m zhang]

Thanks, Lin. I am sorry for being short of information. I was actually not sure 
what kind of information is needed. Well, the cells were grown at 27 degree in 
Insect-Xpress. I tried to grow cells both in shaker and stationery flask. 
Anything else I can try?
Best,
Min



Date: Sat, 22 Jan 2011 21:57:02 +0100
Subject: Re: [ccp4bb] low expression and aggregation of protein
From: yyb...@gmail.com
To: mzhang...@hotmail.com
CC: CCP4BB@jiscmail.ac.uk

Actually, it is very difficult to say something just based on your simple 
information. You should give more informations about your work, for example, 
temperature, cuture, etc.
 
Best,
Lin


On Fri, Jan 21, 2011 at 8:12 PM, m zhang mzhang...@hotmail.com wrote:


Dear All, 


Recently I am trying to express a glycoprotein in Drosophila S2 cells. However, 
the expression yield is every low and most of the protein expressed aggregate. 
I was suggested making new constructs. But I am wondering if anyone here can 
give me some suggestions to improve it beyond that since I am new to 
glycoprotein? All your input will be greatly appreciated!



Regards,


Min
  

Re: [ccp4bb] low expression and aggregation of protein

[Yibin Lin]

Actually, it is very difficult to say something just based on your simple
information. You should give more informations about your work, for example,
temperature, cuture, etc.

Best,
Lin

On Fri, Jan 21, 2011 at 8:12 PM, m zhang mzhang...@hotmail.com wrote:

 Dear All,

 Recently I am trying to express a glycoprotein in Drosophila S2 cells.
 However, the expression yield is every low and most of the protein expressed
 aggregate. I was suggested making new constructs. But I am wondering if
 anyone here can give me some suggestions to improve it beyond that since I
 am new to glycoprotein? All your input will be greatly appreciated!

 Regards,

 Min

[ccp4bb] low expression and aggregation of protein

[m zhang]

Dear All,
Recently I am trying to express a glycoprotein in Drosophila S2 cells. However, 
the expression yield is every low and most of the protein expressed aggregate. 
I was suggested making new constructs. But I am wondering if anyone here can 
give me some suggestions to improve it beyond that since I am new to 
glycoprotein? All your input will be greatly appreciated!
Regards,
Min
  

Re: [ccp4bb] tRNA expression

[Martin Hallberg]

Hi,

Can you explain what you want to do? 

Do you just want more of some tRNA corresponding to a codon that is rare in E. 
coli you can use the pRare2 plasmid that you can easily isolate from the 
Rosetta2 strain (or use Rosetta2 directly if you don't mind).

If you just want some extra tRNA production for the AUA, AGA and AGG codons, 
there is also the pSJS1240 plasmid from the Kim lab that you can get from 
Addgene:  http://www.addgene.org/pgvec1?f=ccmd=findplidentifier=12234

You are right that an induced T7 promoter will give way too much tRNA. It will 
not only be wasteful, the tRNA modification machinery –  that is needed to make 
the tRNA fully functional – will not be able to keep up and this may create 
havoc.

Cheers,

Martin



On Nov 16, 2010, at 12:00 AM, Patrick Loll wrote:

 Here's an ignorant question: When people express an exogenous tRNA in E coli 
 (to overcome rare codon issues, for example, or to supply a cognate tRNA for 
 an orthogonal synthetase), what sorts of promoters are used?  
 
 My (ignorant) guess is that something as potent as the T7 promoter might be a 
 waste, since you don't need huge quantities of your tRNA, and you probably 
 don't want to divert resources away from message production for your target 
 gene. But I could be wrong.
 
 Any pointers to sequences that successfully direct tRNA production would be 
 welcome, so I could use them as design templates. 
 
 Thanks,
 
 Pat
 ---
 Patrick J. Loll, Ph. D.  
 Professor of Biochemistry  Molecular Biology
 Director, Biochemistry Graduate Program
 Drexel University College of Medicine
 Room 10-102 New College Building
 245 N. 15th St., Mailstop 497
 Philadelphia, PA  19102-1192  USA
 
 (215) 762-7706
 pat.l...@drexelmed.edu

[ccp4bb] tRNA expression

[Patrick Loll]

Here's an ignorant question: When people express an exogenous tRNA in E coli 
(to overcome rare codon issues, for example, or to supply a cognate tRNA for an 
orthogonal synthetase), what sorts of promoters are used?  

My (ignorant) guess is that something as potent as the T7 promoter might be a 
waste, since you don't need huge quantities of your tRNA, and you probably 
don't want to divert resources away from message production for your target 
gene. But I could be wrong.

Any pointers to sequences that successfully direct tRNA production would be 
welcome, so I could use them as design templates. 

Thanks,

Pat
---
Patrick J. Loll, Ph. D.  
Professor of Biochemistry  Molecular Biology
Director, Biochemistry Graduate Program
Drexel University College of Medicine
Room 10-102 New College Building
245 N. 15th St., Mailstop 497
Philadelphia, PA  19102-1192  USA

(215) 762-7706
pat.l...@drexelmed.edu

[ccp4bb] Confirming expression of a GPCR in HEK293

[Qing Lu]

Dear All,

Apologies for a non-ccp4 question. I am planning to express a GPCR in
HEK293T cell line by transfecting with the requisite cDNA for performing an
assay. I would like to confirm the expression of the protein in the cell
line by western blot or histochemical studies. Any pointers in this regard
would be helpful.

Thanks,

Qing Lu

Re: [ccp4bb] Confirming expression of a GPCR in HEK293

[Jacob Keller]

If I were you, I would just make a gfp-tagged construct--this is an easy way to 
make sure that the protein is there, and made it to the membrane. If necessary, 
you can blot for gfp, or add other tags in the process for alternative blotting 
(one on each side to make sure it is not cleaved, for example.)

Jacob

  - Original Message - 
  From: Qing Lu 
  To: CCP4BB@JISCMAIL.AC.UK 
  Sent: Thursday, September 02, 2010 7:42 PM
  Subject: [ccp4bb] Confirming expression of a GPCR in HEK293


  Dear All,

  Apologies for a non-ccp4 question. I am planning to express a GPCR in HEK293T 
cell line by transfecting with the requisite cDNA for performing an assay. I 
would like to confirm the expression of the protein in the cell line by western 
blot or histochemical studies. Any pointers in this regard would be helpful.

  Thanks,

  Qing Lu




***
Jacob Pearson Keller
Northwestern University
Medical Scientist Training Program
Dallos Laboratory
F. Searle 1-240
2240 Campus Drive
Evanston IL 60208
lab: 847.491.2438
cel: 773.608.9185
email: j-kell...@northwestern.edu
***

Re: [ccp4bb] Confirming expression of a GPCR in HEK293

[Pascal Egea]

Hi Qing,

I would recommend either the use of GFP as mentioned by Jacob or a his-tag
or a flag-tag. C-terminal tagging is preferred to prevent interference with
signal sequences at the N-terminus of the protein.
Flag tag is really good for detection , the commercial antibodies for
detection are really great, however it is not that great, in my hands, when
it comes to purification of a membrane protein (in presence of detergent) I
prefer his-tags to flag-tags in this case. You can use a his-flag to combine
both advantages.

Hope this helps



-- 
Pascal F. Egea, PhD
Assistant Professor
UCLA, David Geffen School of Medicine
Department of Biological Chemistry
314 Biomedical Sciences Research Building
office (310)-983-3515
lab  (310)-983-3516
email pe...@mednet.ucla.edu

[ccp4bb] Weird expression behavior

[Israel Sanchez]

Hello crystallographers in general and E.coli-protein producers in
particular,

I would like to share with all of you a strange behavior of two of my
expression constructs, looking for some advice or just know if anybody has
experienced something similar:

The scenario is the following one, I am trying to produce a NTPase domain of
around 20KDa of a human protein in E.coli. Initial cloning in a T7-based
vector with a N-terminal-hexa histidine tags produced big quantities of an
unfolded protein, in inclusion bodies. I tried all normal approaches to try
to make the construct soluble: lowing expression  temperature, lowing the
concentration of IPTG, different growing mediums, different E.coli strains,
... no success.
Then I decided to try some fusion-protein strategies, I cloned the same
construct as a fusion protein with GST and MBP. Then, I could see a good
soluble expression BUT only of the carrier protein (GST or MBP). Lowing
expression temperature or lowering IPTG concentration does not produce any
improvement. Both fusion-protein construct contain between the fusion
partner and my protein a 3C site for cleavage with this protease.

So, the question is, does E.coli may posses protease similar to 3C that may
explain the self-cleavage? why my ribosomes are not reaching until the end
of the construct?

Thank you so much for your attention, any comment and/or suggestion would be
highly apreciated



-- 
PhD. Israel Sanchez Fernandez
EM-lab
Departamento de Ciencia de Proteinas
CIB-CSIC Madrid España

Re: [ccp4bb] Weird expression behavior

[Ezra Peisach]

Been there, done that, got the T-shirt.

I do not believe there is a protease like 3C in E. coli.

That said - do you have any rare codons in your protein - that might 
cause the stall/termination in expression - leaving you a large amount 
of tag.  Have you followed through with purifictaion to see if you have 
low levels of full length expression?  If rare codons are a problem - 
multiple vendors have cell lines [such as BL21(DE3) RILP,  codonplus, etc.)


With regards to His tag causing inclusion bodies - there have been 
publications regarding solubility issues w/ His tags (I think Helena 
Berglund has a paper on this).


Have you considered (after taking rare codons into account), expression 
with no tag at all? pET3, pET11, etc.




Ezra

Israel Sanchez wrote:
Hello crystallographers in general and E.coli-protein producers in 
particular,


I would like to share with all of you a strange behavior of two of my 
expression constructs, looking for some advice or just know if anybody 
has experienced something similar:


The scenario is the following one, I am trying to produce a NTPase 
domain of around 20KDa of a human protein in E.coli. Initial cloning 
in a T7-based vector with a N-terminal-hexa histidine tags produced 
big quantities of an unfolded protein, in inclusion bodies. I tried 
all normal approaches to try to make the construct soluble: lowing 
expression  temperature, lowing the concentration of IPTG, different 
growing mediums, different E.coli strains, ... no success.
Then I decided to try some fusion-protein strategies, I cloned the 
same construct as a fusion protein with GST and MBP. Then, I could see 
a good soluble expression BUT only of the carrier protein (GST or 
MBP). Lowing expression temperature or lowering IPTG concentration 
does not produce any improvement. Both fusion-protein construct 
contain between the fusion partner and my protein a 3C site for 
cleavage with this protease.


So, the question is, does E.coli may posses protease similar to 3C 
that may explain the self-cleavage? why my ribosomes are not reaching 
until the end of the construct?


Thank you so much for your attention, any comment and/or suggestion 
would be highly apreciated 




--
PhD. Israel Sanchez Fernandez
EM-lab
Departamento de Ciencia de Proteinas
CIB-CSIC Madrid España

Re: [ccp4bb] Weird expression behavior

[Israel Sanchez]

I do have rare codons for E.coli in my construct, indeed I have two
stretches of 3 and 4 rare codons (arginines mainly), thus, I tried the
expression in BL21(DE3)-codon plus and Rosseta. But the result was the same
(GST or MBP alone).

Thanks again

2009/9/2 Ezra Peisach epeis...@gmail.com

 Been there, done that, got the T-shirt.

 I do not believe there is a protease like 3C in E. coli.

 That said - do you have any rare codons in your protein - that might cause
 the stall/termination in expression - leaving you a large amount of tag.
  Have you followed through with purifictaion to see if you have low levels
 of full length expression?  If rare codons are a problem - multiple vendors
 have cell lines [such as BL21(DE3) RILP,  codonplus, etc.)

 With regards to His tag causing inclusion bodies - there have been
 publications regarding solubility issues w/ His tags (I think Helena
 Berglund has a paper on this).

 Have you considered (after taking rare codons into account), expression
 with no tag at all? pET3, pET11, etc.



 Ezra


 Israel Sanchez wrote:

 Hello crystallographers in general and E.coli-protein producers in
 particular,

 I would like to share with all of you a strange behavior of two of my
 expression constructs, looking for some advice or just know if anybody has
 experienced something similar:

 The scenario is the following one, I am trying to produce a NTPase domain
 of around 20KDa of a human protein in E.coli. Initial cloning in a T7-based
 vector with a N-terminal-hexa histidine tags produced big quantities of an
 unfolded protein, in inclusion bodies. I tried all normal approaches to try
 to make the construct soluble: lowing expression  temperature, lowing the
 concentration of IPTG, different growing mediums, different E.coli strains,
 ... no success.
 Then I decided to try some fusion-protein strategies, I cloned the same
 construct as a fusion protein with GST and MBP. Then, I could see a good
 soluble expression BUT only of the carrier protein (GST or MBP). Lowing
 expression temperature or lowering IPTG concentration does not produce any
 improvement. Both fusion-protein construct contain between the fusion
 partner and my protein a 3C site for cleavage with this protease.

 So, the question is, does E.coli may posses protease similar to 3C that
 may explain the self-cleavage? why my ribosomes are not reaching until the
 end of the construct?

 Thank you so much for your attention, any comment and/or suggestion would
 be highly apreciated


 --
 PhD. Israel Sanchez Fernandez
 EM-lab
 Departamento de Ciencia de Proteinas
 CIB-CSIC Madrid España





-- 
PhD. Israel Sanchez Fernandez
EM-lab
Departamento de Ciencia de Proteinas
CIB-CSIC Madrid España

Re: [ccp4bb] Weird expression behavior

[Ezra Peisach]

A little tangental  You mentioned lowering the temperature - how 
low... Stratagene markets a call line - Arctic Express - that adds 
chaperones that are more active at lower temps.  I know someone who 
overcame inclusion body problems by expression at 16 using these cells. 
(I know someone else who regularly induces o/n at 16C w/ regular 
cells).  The only draw back is that these cells produce a protein that 
binds to NiNTA resin...


Good luck...

Re: [ccp4bb] Weird expression behavior

[Raji Edayathumangalam]

Hi Ezra and others,

Just thought I'd let you know that I have noticed that one or two of  
those E. coli proteins that love to bind Ni-affinity resin do not  
bind to Cobalt resin. Of course, there is always a price to pay (for  
the Co resin, in this case) :)!


Cheers,
Raji

---
Raji Edayathumangalam
Joint Research Fellow
Brigham and Women's Hospital/
Harvard Medical School
Brandeis University




On Sep 2, 2009, at 7:55 AM, Ezra Peisach wrote:

A little tangental  You mentioned lowering the temperature -  
how low... Stratagene markets a call line - Arctic Express - that  
adds chaperones that are more active at lower temps.  I know  
someone who overcame inclusion body problems by expression at 16  
using these cells. (I know someone else who regularly induces o/n  
at 16C w/ regular cells).  The only draw back is that these cells  
produce a protein that binds to NiNTA resin...


Good luck...

[ccp4bb] Protein Expression Group Leader Position

[sandra . jacob]

Associate Director Protein Expression Group, Novartis Institutes for 
Biomedical Research, Basel, Switzerland

Job description:
As Group Leader in the Structural Biology Platform (SBP) within the Center 
for Proteomic Chemistry you will lead a group dedicated to all aspects of 
protein expression including molecular biology and expression in insect 
cells and bacteria. You and the members of your group will work in a 
multidisciplinary environment to contribute to the discovery of new drugs. 
Your responsibility is to manage group resources in accordance with 
Platform priorities, to create and maintain an innovative, efficient, 
competitive and result-oriented research environment with high scientific 
standards, to develop and coach associates, and to recruit new talent. As 
a member of the scientific leadership team you will contribute to the 
overall strategy and priorities of the Platform. In addition, you will 
represent the Platform in protein production related matters.
Minimum requirements:
We are looking for a highly talented and motivated scientific leader with 
a PhD in biology or biochemistry, significant postdoctoral experience in 
an academic setting and more than 5 years of professional experience in 
the pharmaceutical or biotech industry. The ideal candidate will have a 
strong background in molecular biology and protein expression and should 
have a sound knowledge in drug discovery and biochemistry. Experience of 
working in the field of structural biology is an advantage. He/she should 
have excellent leadership skills and a passion for working in a 
professional, multi-disciplinary, team-oriented and science-driven 
environment. Outstanding oral and written communication skills are 
required as well as a high level of creativity and commitment.

Applications must be submitted on the Novartis web site (
http://www.novartis.com/ under careers, Job ID 50681BR).

[ccp4bb] Baculovirus expression and purification - off topic

[Narayanan Ramasubbu]

Dear All:
I have a peculiar problem with baculovirus expression of my protein. The 
native protein elutes in Tris gradient. This has no problems.
However, a mutant elutes in the wash. After further purification with 
size exclusion, I notice that this mutant is always associated with
some medium component that I cannot separate. I know this (?) because 
when lyophllized (not a sin for this protein), I get 15-30 mg
of protein (or colorless fluffy material) whereas protein estimation 
gives only about 5 mg. This amount is what I usually get for the native 
protein.
I have tried active charcoal, BioRex, ammonium sulfate precipitation and 
even hydroxyapatite columns but nothing seems to work to

separate the extra material from the protein.
Any insight would be of much help.
Thanks a lot
Subbu

Re: [ccp4bb] insect expression system

[Yong-Fu Li]

Thanks to all that replied. You might find this useful.



The question was: How to select an insect expression system for
mammalian/viral glycoproteins? The following is a summary of the replies.



*1. Baculovirus system*

1) For most proteins, the level of expression is far greater with
bacuovirus. (Dima Klenchin)

2) An interesting system: BacMam.

BacMam recombinant baculovirus in transporter expression: a study of BCRP
and OATP1B1. Protein Expr Purif. 2006 Jun;47(2):591-8. Epub 2006 Jan 30.
(Pius Stephen Padayatti)



*2. Drosophila system*

1) With S2 you can get away without figuring out if the virus works, then
again you probably need a stable cell line... (so which ever works...?)
(OBS! cant do SeMet labelling with S2!! or if someone can please tell me)
(Tommi Kajander)



2) We use S2 (drosophila cells) for generating our protein. Baculovirus is
much more complicated to get running  whereas S2 may generate slightly lower
amounts of protein, but you will be able to get a system up and running
quite quickly. In my experience I've had cases where I was only able to get
very low virus titres for use, whereas the drosophila cells were able to go
rapidly to expression for the same protein. The S2 cells are also a
non-lytic system, so your protein will not get degraded so easily as they
might in a lytic virus system. In my case I've tried them side-by-side and
found S2 cells to be best (but that's obviously just in one case). (Paul A.
McEwan)



*3. Just use mammalian system!*

1) Why would you worry about insect expression systems if you already can
secrete your constructs in mammalian cells? For such proteins, transient
expression in HEK cells for example gives higher yields than baculo, is
faster, cheaper, you can nicely control glycosylation, easily do Se-Met
labelling and so on. Here are some references (PMID): 17355862, 17001101,
16823037,  11788735, 16082028. (Radu Aricescu)



2) I couldn't agree more with Radu. We had great success in expressing mg
amounts of a secreted protein in HEK293 cells (with Radu's help :-) . The
same protein was initially expressed in Sf9 cells but with much lower
yields. Furthermore, we could very easily generate a stable HEK293 cell line
expressing the same protein (at similar levels with transient transfections)
with the Flp-In system in just a couple of weeks. We also have a LIC vector
which is compatible with the Flp-In system. (Vangelis Christodoulou)

[ccp4bb] insect expression system

[Yong-Fu Li]

Hi,

I searched my mail box for possible answers you have given but couldn't find
any. The question is about selecting insect expression systems for mammalian
or viral glycosylated proteins. There is confirmed expression of the target
proteins in mammalian cells. They are secreted into the media.

1) Baculovirus system
2) Drosophila system

Which system would you recommend for high expression and convenience?
Has anyone ever compared those systems side by side?

Any suggestions or references are greatly appreciated.

Yongfu Li

Re: [ccp4bb] insect expression system

[Dima Klenchin]

I searched my mail box for possible answers you have given but couldn't 
find any. The question is about selecting insect expression systems for 
mammalian or viral glycosylated proteins. There is confirmed expression of 
the target proteins in mammalian cells. They are secreted into the media.


1) Baculovirus system
2) Drosophila system

Which system would you recommend for high expression and convenience?


For most proteins, the level of expression is far greater with bacuovirus.

Dima

Re: [ccp4bb] insect expression system

[Pius Padayatti]

Hi,
 It is called Bacmam. Please see the following reference, it is not
the land mark reference, if you dig pubmed you should be able to find
the first description of the system.

BacMam recombinant baculovirus in transporter expression: a study of
BCRP and OATP1B1.
Protein Expr Purif. 2006 Jun;47(2):591-8. Epub 2006 Jan 30.
 Hope this is what you were looking for

Cheers
Pius Stephen Padayatti

On Wed, May 28, 2008 at 10:40 AM, Yong-Fu Li [EMAIL PROTECTED] wrote:
 Hi,

 I searched my mail box for possible answers you have given but couldn't find
 any. The question is about selecting insect expression systems for mammalian
 or viral glycosylated proteins. There is confirmed expression of the target
 proteins in mammalian cells. They are secreted into the media.

 1) Baculovirus system
 2) Drosophila system

 Which system would you recommend for high expression and convenience?
 Has anyone ever compared those systems side by side?

 Any suggestions or references are greatly appreciated.

 Yongfu Li



-- 
Pius S Padayatti
Department of Biochemistry,
Structural Biology Division,
School of Medicine, RT-500
Case Western Reserve University,
Cleveland, Ohio-44106, 216-368-6833

Re: [ccp4bb] insect expression system

[A. Radu Aricescu]

Dear Yong-fu,

Why would you worry about insect expression systems if you already can secrete 
your constructs in mammalian cells? For such proteins, transient expression in 
HEK cells for example gives higher yields than baculo, is faster, cheaper, you 
can nicely control glycosylation, easily do Se-Met labelling and so on.

Here are some references (PMID): 17355862, 17001101, 16823037,  11788735, 
16082028.

Radu

--
A. Radu Aricescu, PhD
University of Oxford
Wellcome Trust Centre for Human Genetics
Division of Structural Biology
Roosevelt Drive, Oxford OX3 7BN
United Kingdom
Phone: +44-1865-287551
Fax: +44-1865-287547


 Original message 
Date: Wed, 28 May 2008 10:40:16 -0400
From: Yong-Fu Li [EMAIL PROTECTED]  
Subject: [ccp4bb] insect expression system  
To: CCP4BB@JISCMAIL.AC.UK

   Hi,

   I searched my mail box for possible answers you have
   given but couldn't find any. The question is about
   selecting insect expression systems for mammalian or
   viral glycosylated proteins. There is confirmed
   expression of the target proteins in mammalian
   cells. They are secreted into the media.

   1) Baculovirus system
   2) Drosophila system

   Which system would you recommend for high expression
   and convenience?
   Has anyone ever compared those systems side by side?

   Any suggestions or references are greatly
   appreciated.

   Yongfu Li

Re: [ccp4bb] insect expression system

[Vangelis Christodoulou]

Hi Yongfu,

I couldn't agree more with Radu. We had great success in expressing mg  
amounts of a secreted protein in HEK293 cells (with Radu's help :-) .  
The same protein was initially expressed in Sf9 cells but with much  
lower yields.
Furthermore, we could very easily generate a stable HEK293 cell line  
expressing the same protein (at similar levels with transient  
transfections) with the Flp-In system in just a couple of weeks. We  
also have a LIC vector which is compatible with the Flp-In system.


Hope this helps,
Vangelis

--
Vangelis Christodoulou
Analist C
Anastassis (Tassos) Perrakis lab
The Netherlands Cancer Institute (B8.038)
Plesmanlaan 121, 1066 CX, Amsterdam
The Netherlands

tel: +31 (0)20 512 1963
Website: xtal.nki.nl/Tassos_group/

On May 28, 2008, at 7:36 PM, A. Radu Aricescu wrote:


Dear Yong-fu,

Why would you worry about insect expression systems if you already  
can secrete your constructs in mammalian cells? For such proteins,  
transient expression in HEK cells for example gives higher yields  
than baculo, is faster, cheaper, you can nicely control  
glycosylation, easily do Se-Met labelling and so on.


Here are some references (PMID): 17355862, 17001101, 16823037,   
11788735, 16082028.


Radu

--
A. Radu Aricescu, PhD
University of Oxford
Wellcome Trust Centre for Human Genetics
Division of Structural Biology
Roosevelt Drive, Oxford OX3 7BN
United Kingdom
Phone: +44-1865-287551
Fax: +44-1865-287547


 Original message 

Date: Wed, 28 May 2008 10:40:16 -0400
From: Yong-Fu Li [EMAIL PROTECTED]
Subject: [ccp4bb] insect expression system
To: CCP4BB@JISCMAIL.AC.UK

 Hi,

 I searched my mail box for possible answers you have
 given but couldn't find any. The question is about
 selecting insect expression systems for mammalian or
 viral glycosylated proteins. There is confirmed
 expression of the target proteins in mammalian
 cells. They are secreted into the media.

 1) Baculovirus system
 2) Drosophila system

 Which system would you recommend for high expression
 and convenience?
 Has anyone ever compared those systems side by side?

 Any suggestions or references are greatly
 appreciated.

 Yongfu Li

Re: [ccp4bb] Co-expression plasmids

[Raji Edayathumangalam]

I do use the Duet vectors extensively and they work just fine. I have trouble 
with my protein
complex, but that is solely related to my proteins. My lab mate has used these 
vectors very
successfully. 

I have been using pRSF-Duet and pETDuet1 more than pCDFDuet1 or pACYCDuet1 for 
no specific reason
except for a slight preference for the antibiotics. I avoid pACYCDuet1 (Cam 
resistance) since a lot
of expression cells I use have plasmids with Cam resistance.

Also, I recently heard about the chaperone co-expression from Takara and folks 
claim that this
system works well.

Also, some folks recommend pCOLD vectors (Takara). Might be worth looking into 
if you are shopping
anyway. I don't think these are for co-expression but it is just as easy to 
stitch in a T7 promoter
and RBS to incorporate additional genes.

Hope that helps.
Raji



-Included Message--
Date: 2-apr-2008 09:56:09 -0400
From: Mark J. van Raaij [EMAIL PROTECTED]
To: CCP4BB@JISCMAIL.AC.UK
Subject: [ccp4bb] Co-expression plasmids

Dear All,

Anyone have experience with the NovaGen Duet co-expression vectors? Or  
can recommend others?
http://www.emdbiosciences.com/html/NVG/Duet_Spot.html

Greetings,

Mark

Mark J. van Raaij
Dpto de Bioqu#237;mica, Facultad de Farmacia
Universidad de Santiago
15782 Santiago de Compostela
Spain
http://web.usc.es/~vanraaij/






-End of Included Message--

Re: [ccp4bb] Co-expression plasmids

[Anastassis Perrakis]

We have had good experience with the awfully simple minded approach  
of using two pET vectors with different antibiotic resistance.

Its the easiest thing to do, and it often works ...

Apologies for the shameless plugin, since there are many good papers  
on the subject, but you can read some hints and case studies at:


http://scripts.iucr.org/cgi-bin/paper?S0907444906031003

(its Open Access)

A.


On 2 Apr 2008, at 19:39, P Hubbard wrote:


Hi,

If you are expressing just two proteins, you could try a single pET  
vector with a pCDF vector. The only reason I'm suggesting this is  
that I had trouble with pET-Duet, but doing each one separately  
worked first time (plasmid size issue?). I used pET24-a and pCDF-1b  
- so I had one construct untagged, and the other with a cleavable  
His-tag.


Cheers

AGS

Date: Wed, 2 Apr 2008 15:55:27 +0200
From: [EMAIL PROTECTED]
Subject: [ccp4bb] Co-expression plasmids
To: CCP4BB@JISCMAIL.AC.UK

Dear All,

Anyone have experience with the NovaGen Duet co-expression vectors?  
Or can recommend others?

http://www.emdbiosciences.com/html/NVG/Duet_Spot.html

Greetings,

Mark

Mark J. van Raaij
Dpto de Bioquímica, Facultad de Farmacia
Universidad de Santiago
15782 Santiago de Compostela
Spain
http://web.usc.es/~vanraaij/





Get in touch in an instant. Get Windows Live Messenger now.

Re: [ccp4bb] Co-expression plasmids

[Raji Edayathumangalam]

I thought only I was having trouble with cloning into pETDuet1. But just to add 
to what someone just
said Yes, I had hell with trying to get one of my ~2kb fragments into 
pETDuet1 (5.4kb). Could be
a combination of vector size and insert size.. Who knows!

Sometimes, I do what Tasos says: Transform two plasmids into cells, either 
sequentially or
co-transform. I just play down the amount of each DNA to be used.

Raji


-Included Message--
Date: 2-apr-2008 09:56:09 -0400
From: Mark J. van Raaij [EMAIL PROTECTED]
To: CCP4BB@JISCMAIL.AC.UK
Subject: [ccp4bb] Co-expression plasmids

Dear All,

Anyone have experience with the NovaGen Duet co-expression vectors? Or  
can recommend others?
http://www.emdbiosciences.com/html/NVG/Duet_Spot.html

Greetings,

Mark

Mark J. van Raaij
Dpto de Bioqu#237;mica, Facultad de Farmacia
Universidad de Santiago
15782 Santiago de Compostela
Spain
http://web.usc.es/~vanraaij/






-End of Included Message--

Re: [ccp4bb] Co-expression plasmids

[P Hubbard]

Just to explain to people who've never had to do co-expression - if I remember 
correctly, conventional wisdom states that you can't have two different vectors 
with the same origin of replication in the same host (maybe someone might know 
more details as to why). However, as pointed out, it can be made to work.

Alas, not in my case!

CC: CCP4BB@JISCMAIL.AC.UK
From: [EMAIL PROTECTED]
Subject: Re: [ccp4bb] Co-expression plasmids
Date: Wed, 2 Apr 2008 19:59:09 +0200
To: [EMAIL PROTECTED]


We have had good experience with the awfully simple minded approach of using 
two pET vectors with different antibiotic resistance.Its the easiest thing to 
do, and it often works ...
Apologies for the shameless plugin, since there are many good papers on the 
subject, but you can read some hints and case studies at:
http://scripts.iucr.org/cgi-bin/paper?S0907444906031003
(its Open Access)
A.

On 2 Apr 2008, at 19:39, P Hubbard wrote:Hi,

If you are expressing just two proteins, you could try a single pET vector with 
a pCDF vector. The only reason I'm suggesting this is that I had trouble with 
pET-Duet, but doing each one separately worked first time (plasmid size 
issue?). I used pET24-a and pCDF-1b - so I had one construct untagged, and the 
other with a cleavable His-tag.

Cheers

AGS

Date: Wed, 2 Apr 2008 15:55:27 +0200
From: [EMAIL PROTECTED]
Subject: [ccp4bb] Co-expression plasmids
To: CCP4BB@JISCMAIL.AC.UK

Dear All,Anyone have experience with the NovaGen Duet co-expression vectors? Or 
can recommend others?
http://www.emdbiosciences.com/html/NVG/Duet_Spot.html
Greetings,MarkMark J. van RaaijDpto de Bioquímica, Facultad de 
FarmaciaUniversidad de Santiago15782 Santiago de 
CompostelaSpainhttp://web.usc.es/~vanraaij/


Get in touch in an instant. Get Windows Live Messenger now.

_
Get in touch in an instant. Get Windows Live Messenger now.
http://www.windowslive.com/messenger/overview.html?ocid=TXT_TAGLM_WL_Refresh_getintouch_042008

Re: [ccp4bb] Co-expression plasmids

[Brian Mark]

Hi Mark,

Proper co-expression in trans requires that you use plasmids each with  
different origins of replication and antibiotic markers, such as p15 +  
Kan and ColE1 + Amp.  I think the pET vectors of the DUET system use  
these two origins (p15 and ColE1).  This ensures much more efficient  
dual transformation and proper plasmid stability over time.  The two  
backbone constructions above are used in a variety of pET vectors, so  
if you look for this detail, you can co-transform and co-express from  
many available plasmids and customize as you like.  Suppliers will  
tell you the origins that are used in each of the plasmids they sell.


Cheers,

Brian

=
Brian L. Mark, MSc, PhD
Assistant Professor
Department of Microbiology
Room 418, Buller Building
University of Manitoba
Winnipeg, Manitoba
CANADA R3T 2N2

Phone (204) 480-1430
Fax (204) 474-7603
Web:  http://www.umanitoba.ca/science/microbiology/staff/mark/


On 2-Apr-08, at 8:55 AM, Mark J. van Raaij wrote:


Dear All,

Anyone have experience with the NovaGen Duet co-expression vectors?  
Or can recommend others?

http://www.emdbiosciences.com/html/NVG/Duet_Spot.html

Greetings,

Mark

Mark J. van Raaij
Dpto de Bioquímica, Facultad de Farmacia
Universidad de Santiago
15782 Santiago de Compostela
Spain
http://web.usc.es/~vanraaij/

Re: [ccp4bb] protein expression

[wu donghui]

Hi Chen,

In this case, it seems that linker region is of great importance for the
proper folding of the two linked domains. I have not much experience in
linker region design, generally use (GS)5-10 times. However it depends on
individual case. Anyone who has successful experience in linker region
design might share your success with others. Thanks a lot.

Regards,

Donghui


On 3/5/08, Daniel Jin [EMAIL PROTECTED] wrote:

 Hi,

 I have a protein with two independently folded domains. I can express
 either one in bacteria with pretty good expression yield. However, when I
 put them together with a linker, the expression drops significantly. I can
 barely see any soluble protein and most of it is now inclusion bodies. I
 used the same bacteria strain and expression/purification conditions. Is it
 normal? Any suggestion about how to improve? Many thanks.

 Best,
 Chen



 --
 Be a better friend, newshound, and know-it-all with Yahoo! Mobile. Try it
 now.http://us.rd.yahoo.com/evt=51733/*http://mobile.yahoo.com/;_ylt=Ahu06i62sR8HDtDypao8Wcj9tAcJ

Re: [ccp4bb] protein expression problem

[M T]

 I have been trying to express a rat protein in bacteria. The MBP-fusion
 expressed at very high level (~ 40 mg/L) while the GST-fusion and His-tag
 only gave inclusion bodies. The problem is that all protein runs in the void
 volume on a size-exclusion column (s-200, hepes, pH 7.4, 200 mM NaCl), no
 matter it is the intact MBP-fusion or cleaved sample. There is no Cys on
 this protein so there is unlikely any disulfide bond related problem.
 Anything I can do before I throw away this construct and try insect or
 mammalian cells? Thanks.


First of all, using a carrying protein (like GST, MBP) can be disconcerting.
These proteins are very soluble and can solubilize an insoluble protein in
testing condition. So you have something soluble but your protein of
interest can be misfolded or can precipitate when the carrying protein was
cleaved. So keep in mind that a soluble carried protein is not always a good
protein.

After this consideration you have a wide range of conditions to test.
- Solubility of your MBP-fusion: ultracentrifugation, thermal shift assay
(in different pH, salt, salt concentration), micro-dialysis
- Folding of your MBP-fusion: circular dichroism, 1D NMR (if you can,
compare with MBP alone)
- Aggregation/monodispersity of your MBP-fusion: DLS (in different pH, salt,
salt concentration)
- For gel filtration assays don't forget that MBP can dimerize

The second part of your tests can be expression conditions. Sometimes low
but native expression is better than high but carried or insoluble
expression.
- Medium
- Temperature
- Host cells (different E. coli, yeast, insect cells...)
- Inducing strength
- Co-expression with ligands or chaperones

And the last but not the least part of your tests can be refolding.
Inclusion body expression is the first step of your purification. If you
have his-tagged protein in inclusion body a one step purification can be
performed in denaturing conditions. A wide range of refolding conditions can
be tested:
- Flash dilution
- Dialysis
- Refolding by slow gradient on an Ni column (if you have an his tag)
- pH, salt, detergent conditions
- Chaperones
OD at 340 nm can monitor the refolding efficiency.

Good luck

Michel

Re: [ccp4bb] protein expression problem

[Raji Edayathumangalam]

I wholly agree with the below. I am not sure how well E.coli can correctly fold 
snaky
misfolded/unfolded protein that are chaperoned by folded tags! Not to rule out 
that tags do it
sometimes...

Folded by association for insoluble proteins has often not worked well for 
me. Sometimes, when it
'works' for me and my colleagues, removal of the tag leads to insoluble 
protein/aggregation etc.

I am dealing with SUMO tagged proteins that have enhanced solubility but severe 
degradation issues.

Screening for pH, buffers and all the good-old stuff folks have suggested here 
is a good approach.

Sometimes autoinduction protocols, which keep from 'overexpression' of protein 
in the cell might be
an approach to explore after the above tests.

Good luck!
Raji
 

First of all, using a carrying protein (like GST, MBP) can be disconcerting.
These proteins are very soluble and can solubilize an insoluble protein in
testing condition. So you have something soluble but your protein of
interest can be misfolded or can precipitate when the carrying protein was
cleaved. So keep in mind that a soluble carried protein is not always a good
protein.

Re: [ccp4bb] protein expression problem

[R.M. Garavito]

Chen and David,

Before adding detergent, be forewarned that the MPB in many fusions  
will not bind to an amylose column in the presence of most  
detergents, particularly maltoside detergents.  It has been the bane  
to us so we have engineered MBP vectors with His tags to deal with  
this.  What you might try, as suggested, the NDSBs or the addition of  
glycylglycine (to make 0.5-1.0M) to the growth media just before  
innoculation (don't worry about sterility with good antibiotic  
selection; autoclaving will just make a brown mess).  The  
glycylglycine trick can reduce aggregation.


Cheers,

Michael


R. Michael Garavito, Ph.D.
Professor of Biochemistry  Molecular Biology
513 Biochemistry Bldg.
Michigan State University
East Lansing, MI 48824-1319
Office:  (517) 355-9724 Lab:  (517) 353-9125
FAX:  (517) 353-9334Email:  [EMAIL PROTECTED]



On Jan 22, 2008, at 2:23 AM, David Briggs wrote:


Hi Chen,

You could try adding some detergent or other solubilising agent (eg
NDSBs) to your buffer.
Have you tried other pHs? If you are sat near to or on the pI of your
protein, it will be at its least soluble and more likely to aggregate.
I've had protein behave like yours at pH 7.5 but behave perfectly
(i.e. monodisperse) at pH 5.5.

As you can get you protein in inclusion bodies, have you considered
doing an inclusion body prep (using 'bugbuster' or something similar)
and then trying some refolding protocols?

Jungbauer A, Kaar W.
Current status of technical protein refolding.J Biotechnol. 2007 Feb
20;128(3):587-96.

Some people have had success with SUMO tags as well.

HTH,

Cheers,

David



On 22/01/2008, Daniel Jin [EMAIL PROTECTED] wrote:




Hi,

I have been trying to express a rat protein in bacteria. The MBP- 
fusion expressed at very high level (~ 40 mg/L) while the GST- 
fusion and His-tag only gave inclusion bodies. The problem is that  
all protein runs in the void volume on a size-exclusion column  
(s-200, hepes, pH 7.4, 200 mM NaCl), no matter it is the intact  
MBP-fusion or cleaved sample. There is no Cys on this protein so  
there is unlikely any disulfide bond related problem. Anything I  
can do before I throw away this construct and try insect or  
mammalian cells? Thanks.


Best,
Chen

 

Never miss a thing.   Make Yahoo your homepage.







--

David C. Briggs PhD
Father  Crystallographer
http://www.dbriggs.talktalk.net
AIM ID: dbassophile

Re: [ccp4bb] protein expression problem

[Chun Luo]

Hi Chen,

 

Since you recognize that this is a protein expression problem, the best way
to get return of your investment of efforts is to get soluble expression
instead of trying to solubilize the protein down stream.

 

Many good suggestions have been proposed. I just want to add one more thing
for you to try. Lower the induction temperature to 16C (or any temperature
between 10-30C). With all the tricks to make protein soluble in E. coli, low
induction temperature is the only universal method that works. Accelagen has
made all kinds of proteins and we have systematically tried many variables.
Only induction temperature matters for solubility, everything else just
gives you more or less proteins.

 

If your promoter is not tightly controlled, you may just let the E. coli
grow to saturation without induction, at low temperature of course. It
worked well for pGEX based vectors.

 

Many proteins give little soluble expression in E. coli. In those cases,
Baculovirus expression system is a great alternative. Once you have your
gene in a transfer vector, it takes about 3 weeks to know the soluble
expression level in insect cells and another 3 weeks to harvest 10 L cell
pellets. Currently technology allows you to scale up to 100s L in an
additional couple weeks. The material cost is actually similar to E. coli
expression. It's faster than trying to figure out how to solubilize a
protein.

 

Good luck.

 

Chun

 

Chun Luo, Ph.D. 
The Protein Expert
Accelagen, Inc. 
11585 Sorrento Valley Road, Suite 107 
San Diego, CA 92121 
TeL: 858-350-8085 ext 111 
Fax: 858-350-8001 
 mailto:[EMAIL PROTECTED] [EMAIL PROTECTED] 
www.accelagen.com 

 

 

  _  

From: CCP4 bulletin board [mailto:[EMAIL PROTECTED] On Behalf Of Daniel
Jin
Sent: Monday, January 21, 2008 10:56 PM
To: CCP4BB@JISCMAIL.AC.UK
Subject: [ccp4bb] protein expression problem

 

Hi,

 

I have been trying to express a rat protein in bacteria. The MBP-fusion
expressed at very high level (~ 40 mg/L) while the GST-fusion and His-tag
only gave inclusion bodies. The problem is that all protein runs in the void
volume on a size-exclusion column (s-200, hepes, pH 7.4, 200 mM NaCl), no
matter it is the intact MBP-fusion or cleaved sample. There is no Cys on
this protein so there is unlikely any disulfide bond related problem.
Anything I can do before I throw away this construct and try insect or
mammalian cells? Thanks.

 

Best,

Chen

  

  _  

Never miss a thing. Make Yahoo
http://us.rd.yahoo.com/evt=51438/*http:/www.yahoo.com/r/hs  your homepage.

[ccp4bb] protein expression problem

[Daniel Jin]

Hi,
   
  I have been trying to express a rat protein in bacteria. The MBP-fusion 
expressed at very high level (~ 40 mg/L) while the GST-fusion and His-tag only 
gave inclusion bodies. The problem is that all protein runs in the void volume 
on a size-exclusion column (s-200, hepes, pH 7.4, 200 mM NaCl), no matter it is 
the intact MBP-fusion or cleaved sample. There is no Cys on this protein so 
there is unlikely any disulfide bond related problem. Anything I can do before 
I throw away this construct and try insect or mammalian cells? Thanks.
   
  Best,
  Chen

   
-
Never miss a thing.   Make Yahoo your homepage.

Re: [ccp4bb] protein expression problem

[David Briggs]

Hi Chen,

You could try adding some detergent or other solubilising agent (eg
NDSBs) to your buffer.
Have you tried other pHs? If you are sat near to or on the pI of your
protein, it will be at its least soluble and more likely to aggregate.
I've had protein behave like yours at pH 7.5 but behave perfectly
(i.e. monodisperse) at pH 5.5.

As you can get you protein in inclusion bodies, have you considered
doing an inclusion body prep (using 'bugbuster' or something similar)
and then trying some refolding protocols?

Jungbauer A, Kaar W.
Current status of technical protein refolding.J Biotechnol. 2007 Feb
20;128(3):587-96.

Some people have had success with SUMO tags as well.

HTH,

Cheers,

David



On 22/01/2008, Daniel Jin [EMAIL PROTECTED] wrote:



 Hi,

 I have been trying to express a rat protein in bacteria. The MBP-fusion 
 expressed at very high level (~ 40 mg/L) while the GST-fusion and His-tag 
 only gave inclusion bodies. The problem is that all protein runs in the void 
 volume on a size-exclusion column (s-200, hepes, pH 7.4, 200 mM NaCl), no 
 matter it is the intact MBP-fusion or cleaved sample. There is no Cys on this 
 protein so there is unlikely any disulfide bond related problem. Anything I 
 can do before I throw away this construct and try insect or mammalian cells? 
 Thanks.

 Best,
 Chen

  
Never miss a thing.   Make Yahoo your homepage.





-- 

David C. Briggs PhD
Father  Crystallographer
http://www.dbriggs.talktalk.net
AIM ID: dbassophile

Re: [ccp4bb] Protein expression in Minimal media (M9)

[Eric Toth]

I had a similar situation, i.e. the cells wouldn't grow past an OD of 0.1 on
minimal media, but in my case I did get protein expression.  The way I got
around it was as follows.  I grew the cells up in minimal media plus the
amino acids that suppress methionine biosynthesis, plus L-methionine.  For
whatever reason, the cells behaved much better in not quite minimal media.
Then, when they were near 0.6 OD, I spun them down and resuspended them in
media with Selenomethionine instead of L-Met.  It worked for me (i.e. ~100%
SeMet incorporation, structure solved, etc.), but I only needed to solve a
growth problem, not an expression problem.  It might work for you, and you
could try a dry run without burning up precious SeMet.

_

 

Eric A. Toth, Ph.D. 
Assistant Professor 
Department of Biochemistry and Molecular Biology 
Marlene and Stewart Greenebaum Cancer Center 
University of Maryland School of Medicine 
108 North Greene St. 
Baltimore, MD 21201 

Email: [EMAIL PROTECTED] 
Phone: x-410-706-5345 
Fax: x-410-706-8297

http://www.umaryland.edu/bmb/faculty/toth.html

http://crystal.umaryland.edu 


-Original Message-
From: CCP4 bulletin board [mailto:[EMAIL PROTECTED] On Behalf Of
[EMAIL PROTECTED]
Sent: Wednesday, April 18, 2007 10:34 PM
To: CCP4BB@JISCMAIL.AC.UK
Subject: [ccp4bb] Protein expression in Minimal media (M9)

Hello everybody,

Sorry for an offtopic question.  I am trying to express a protein in M9
minimal media for Selenomet incorporation.  When grown in LB this protein
expressed very well and got good crystals.  Diffraction was upto 2 A. I am
having a hard time expressing the same protein in Minimal media.  It took
nearly 24 hours for the OD600 to reach  ~ 0.4 before inducing with IPTG in
minimal media and eventually got no protein expression.  It looks like the
cells are not growing or taking very long to grow.  The cell line I am
using is RossettaBlue (DE3) and the plasmid is pET19b based (Novagen).

It expressed poorly in BL21 (DE3) when grown in LB and thus decided to use
RosettaBlue (DE3).   It worked very well in LB, but having a hard time
while expresing the same in minimal media using Rosetta Blue. Has anybody
tried expression in minimal media using Rosetta Blue cell line?  I am
planning to try overnight induction.

Any suggestions would be greatly appreciated.

Thanks,

Manish








*
Manish B. Shah,  PhD.
Postdoctoral Fellow
Hauptman-Woodward Medical Research Institute
700 Ellicott Street
Buffalo,  NY 14203.
*

Re: [ccp4bb] Protein expression in Minimal media (M9)

[jwallen]

Manish,

I also had a similar problem getting cells (C41 (DE3) in my case) to grow
in minimal media. To get around this problem, I took cells from an agar
plate and grew them in a small volume (5 mL) of the minimal media. Once
that culture got thick, I then inoculated 200 mL of minimal media with 0.5
mL of the 5 mL culture. I would let this grow, and I used this as my
overnight culture to inoculate my large flasks. Long story short, the
cells seemed happier adjusting to the minimal media in a smaller volume
first.

Cheers,

Jamie Wallen

 Hello everybody,

 Sorry for an offtopic question.  I am trying to express a protein in M9
 minimal media for Selenomet incorporation.  When grown in LB this protein
 expressed very well and got good crystals.  Diffraction was upto 2 A. I am
 having a hard time expressing the same protein in Minimal media.  It took
 nearly 24 hours for the OD600 to reach  ~ 0.4 before inducing with IPTG in
 minimal media and eventually got no protein expression.  It looks like the
 cells are not growing or taking very long to grow.  The cell line I am
 using is RossettaBlue (DE3) and the plasmid is pET19b based (Novagen).

 It expressed poorly in BL21 (DE3) when grown in LB and thus decided to use
 RosettaBlue (DE3).   It worked very well in LB, but having a hard time
 while expresing the same in minimal media using Rosetta Blue. Has anybody
 tried expression in minimal media using Rosetta Blue cell line?  I am
 planning to try overnight induction.

 Any suggestions would be greatly appreciated.

 Thanks,

 Manish








 *
 Manish B. Shah,  PhD.
 Postdoctoral Fellow
 Hauptman-Woodward Medical Research Institute
 700 Ellicott Street
 Buffalo,  NY 14203.
 *

Re: [ccp4bb] Protein expression in Minimal media (M9)

[Cynthia Kinsland]

Are you adding vitamins to your M9 minimal?  RosettaBlue is thiamin  
requiring and can not grow in the absence of thiamin.  The thiamin  
requirement is so low that you can often get slow growth to a low OD  
based on residual thiamin in the cells, but you will not get robust  
growth.


Also, minimal recipes vary pretty drastically from one another, your  
system may prefer one of the other recipes out there.  Personally, I  
have never really liked the standard M9 minimal recipe.


Contrary to another poster, I found that my cells tended to grow  
better in minimal medium if I pre-adapted them to minimal by growing  
my starters in the same minimal that I intended to use (with Met  
instead of SeMet).  However, I prefer to stick with high dilutions  
(1:1000-1:100) so that may be the difference.


For years I used the MM/CA recipe from Pryor and Leiting, Protein  
Expression and Purification, 1997 v10 pg 309.  This recipe works well  
and can be adapted for SeMet growth by subbing out the casamino acids  
for a mixture of amino acids.


For the past few years I've been using the autoinduction recipes from  
Studier, Protein Expression and Purification, v41 pg 207.  I have  
found that these work fantastically well (as long as you don't need  
to express at really reduced temperature...I only use them down to 20° 
C).  There are recipes for SeMet incorporation in there as well.


Best of luck,

Cynthia

On Apr 18, 2007, at 10:34 PM, [EMAIL PROTECTED] wrote:


Hello everybody,

Sorry for an offtopic question.  I am trying to express a protein  
in M9
minimal media for Selenomet incorporation.  When grown in LB this  
protein
expressed very well and got good crystals.  Diffraction was upto 2  
A. I am
having a hard time expressing the same protein in Minimal media.   
It took
nearly 24 hours for the OD600 to reach  ~ 0.4 before inducing with  
IPTG in
minimal media and eventually got no protein expression.  It looks  
like the

cells are not growing or taking very long to grow.  The cell line I am
using is RossettaBlue (DE3) and the plasmid is pET19b based (Novagen).

It expressed poorly in BL21 (DE3) when grown in LB and thus decided  
to use

RosettaBlue (DE3).   It worked very well in LB, but having a hard time
while expresing the same in minimal media using Rosetta Blue. Has  
anybody

tried expression in minimal media using Rosetta Blue cell line?  I am
planning to try overnight induction.

Any suggestions would be greatly appreciated.

Thanks,

Manish








*
Manish B. Shah,  PhD.
Postdoctoral Fellow
Hauptman-Woodward Medical Research Institute
700 Ellicott Street
Buffalo,  NY 14203.
*



Cynthia Kinsland, Ph.D.
Cornell University
Protein Facility Director
607-255-8844

Re: [ccp4bb] Protein expression in Minimal media (M9)

[artem]

Manish,

Assuming that you need the minimal medium for Se, have you tried the
regular heavy atom derivatives? You already have diffracting crystals...

M9 medium can be slightly difficult. However, no one says that you *have*
to use minimal medium such as M9 (again, assuming that you're doing
Se-Met). There are numbers of defined media compositions out there, many
with very good growth characteristics.

Finally, you can spike the M9 with a small quantity of yeast extract. This
will give your culture a decent initial boost and the amount of normal
methionine in the extract should be relatively small so it will all get
eaten up while the cells are still in early log phase.

Regards,

Artem

 Hello everybody,

 Sorry for an offtopic question.  I am trying to express a protein in M9
 minimal media for Selenomet incorporation.  When grown in LB this protein
 expressed very well and got good crystals.  Diffraction was upto 2 A. I am
 having a hard time expressing the same protein in Minimal media.  It took
 nearly 24 hours for the OD600 to reach  ~ 0.4 before inducing with IPTG in
 minimal media and eventually got no protein expression.  It looks like the
 cells are not growing or taking very long to grow.  The cell line I am
 using is RossettaBlue (DE3) and the plasmid is pET19b based (Novagen).

 It expressed poorly in BL21 (DE3) when grown in LB and thus decided to use
 RosettaBlue (DE3).   It worked very well in LB, but having a hard time
 while expresing the same in minimal media using Rosetta Blue. Has anybody
 tried expression in minimal media using Rosetta Blue cell line?  I am
 planning to try overnight induction.

 Any suggestions would be greatly appreciated.

 Thanks,

 Manish








 *
 Manish B. Shah,  PhD.
 Postdoctoral Fellow
 Hauptman-Woodward Medical Research Institute
 700 Ellicott Street
 Buffalo,  NY 14203.
 *

Re: [ccp4bb] Protein expression in Minimal media (M9)

[Roger Rowlett]

Manish,

In practice, we have found that it is very helpful to grow up an
overnight starter culture in minimal media to acclimatize the cells for
growth under minimal conditions. (Cells transferred from LB to M9 do not
perform well for overexpression).  We inoculate 1 L of modified M9 (see
below) with 10 mL of an overnight culture (centrigued, washed, and
ressuspended in M9) in the same medium.

In addition--and even though it should not be required for many strains
of E. coli--we have found that he inclusion of thiamin, 5-10 ug/L,
greatly enhances the rate of cell growth, but it may still takeup to 8
hr for cells to grow to OD600 = 0.6 for induction. Overexpression
overnight (12-18 hr) may be required to get optimal cell density and
overexpression yield. Using this protocol we get excellent
overexpression yields of protein.

Cheers,

___
Roger S. Rowlett
Professor
Department of Chemistry
Colgate University
13 Oak Drive
Hamilton, NY 13346

tel: (315)-228-7245
ofc: (315)-228-7395
fax: (315)-228-7935
email: [EMAIL PROTECTED]


-Original Message-
From: CCP4 bulletin board [mailto:[EMAIL PROTECTED] On Behalf Of
[EMAIL PROTECTED]
Sent: Thursday, April 19, 2007 10:31 AM
To: CCP4BB@JISCMAIL.AC.UK
Subject: Re: [ccp4bb] Protein expression in Minimal media (M9)


Manish,

Assuming that you need the minimal medium for Se, have you tried the
regular heavy atom derivatives? You already have diffracting crystals...

M9 medium can be slightly difficult. However, no one says that you
*have* to use minimal medium such as M9 (again, assuming that you're
doing Se-Met). There are numbers of defined media compositions out
there, many with very good growth characteristics.

Finally, you can spike the M9 with a small quantity of yeast extract.
This will give your culture a decent initial boost and the amount of
normal methionine in the extract should be relatively small so it will
all get eaten up while the cells are still in early log phase.

Regards,

Artem

 Hello everybody,

 Sorry for an offtopic question.  I am trying to express a protein in 
 M9 minimal media for Selenomet incorporation.  When grown in LB this 
 protein expressed very well and got good crystals.  Diffraction was 
 upto 2 A. I am having a hard time expressing the same protein in 
 Minimal media.  It took nearly 24 hours for the OD600 to reach  ~ 0.4 
 before inducing with IPTG in minimal media and eventually got no 
 protein expression.  It looks like the cells are not growing or taking

 very long to grow.  The cell line I am using is RossettaBlue (DE3) and

 the plasmid is pET19b based (Novagen).

 It expressed poorly in BL21 (DE3) when grown in LB and thus decided to
use
 RosettaBlue (DE3).   It worked very well in LB, but having a hard time
 while expresing the same in minimal media using Rosetta Blue. Has 
 anybody tried expression in minimal media using Rosetta Blue cell 
 line?  I am planning to try overnight induction.

 Any suggestions would be greatly appreciated.

 Thanks,

 Manish








 *
 Manish B. Shah,  PhD.
 Postdoctoral Fellow
 Hauptman-Woodward Medical Research Institute
 700 Ellicott Street
 Buffalo,  NY 14203.
 *

[ccp4bb] Protein Expression Research Technologist

[James Stevens]

The original e-mail was sent with the wrong subject heading. This is  
NOT a Post-Doctoral position, and a PhD will not be required.


Protein Expression Research Technologist

The newly established structural virology lab within the Molecular  
Virology and Vaccines Branch of the Influenza Division at the CDC,  
Atlanta is seeking applications for a Research Technologist to work  
on the crystallographic structure determination of viral and  
interacting host proteins to elucidate the molecular mechanisms of  
replication, host cell response and viral evolution through a  
structural approach.


Candidates should have experience in bacterial, insect, or mammalian  
cell culture protein expression, and purification as well as  
biophysical characterization techniques.  Excellent team interaction  
and communication skills; basic molecular biology experience will be  
an advantage.


Job duties will include baculovirus expression and purification of  
viral and eukaryotic proteins, including complexes for structural and  
functional analysis; DNA cloning; maintenance of insect cell lines  
and stocks of recombinant baculovirus; developing and validating  
protein production protocols for multiple proteins and complexes  
using a variety of purification methods; working with team members on  
project priorities; responsible for maintaining lab equipment and  
reagents. The successful candidate should be able to integrate well  
within a team utilizing a number of diverse genetic and biochemical  
approaches and there will be opportunity to overlap with other  
ongoing projects within the branch.


The position is available May 2007 and salary will be commensurate  
with experience.  Applicants should send curriculum vitae, a brief  
summary of previous research experience and the contact details of  
three references to:


Ms. Lisa Ezell
Influenza Division, NCIRD, CCID
Centers for Disease Control and Prevention
1600 Clifton Road, N.E. - Mail Stop G-16
Atlanta, GA 30333
Fax: (404) 639-2350


Applications received by April 1, 2007, will be considered.
CDC is an Equal Opportunity Employer.