Bug#889623: kraken: failing autopkgtest, possibly broken package
Hi again, the issue is most probably caused by a broken fasta parser. With the following simplification of the header $ git diff diff --git a/debian/tests/test_data/Acartia_tonsa.fasta b/debian/tests/test_data/Acartia_tonsa.fasta index abcda65..011076b 100644 --- a/debian/tests/test_data/Acartia_tonsa.fasta +++ b/debian/tests/test_data/Acartia_tonsa.fasta @@ -1,4 +1,4 @@ ->gi|441431932| Acartia tonsa copepod circovirus isolate 154_D11, complete genome +>441431932 ACCTCGGCAACATCCGATCATCATATGATCAATTATGACTCATCCCGCGTGGAATTATGTAGCCAATGAA ATCGCTCCATATTTCATTGAGCACAGTGGCCGCAATCTATAAAGCCGCGAGCGAAGCGAGCG GTAGGCACAGTTTGACCTGCCTAGCAACGCAACAACCAACCGAGCCCGTGGGTGGTGCTTCA diff --git a/debian/tests/test_data/Acinetobacter_phage.fasta b/debian/tests/test_data/Acinetobacter_phage.fasta index 317a94c..591f2e0 100644 --- a/debian/tests/test_data/Acinetobacter_phage.fasta +++ b/debian/tests/test_data/Acinetobacter_phage.fasta @@ -1,4 +1,4 @@ ->gi|28173057| Acinetobacter phage AP205, complete genome +>28173057 GGAGTGAAGGAGTTCGCTGAAAGCCGAATCGAATTCGACTTTGCGTGATTCACATCACGTCT TACTCACGATACTAGTACCGCGAGTTATCTTGTGGTAATTACTACCAGGAGATAACTTTATGAAGA AAAGGACGCCTTGCTTCCCTATGCGGCATCATACTCAGCTTTCAACTAACATTGTTGACTGC the test works again as expected $ sh /usr/share/doc/kraken/run-unit-test Added "Acartia_tonsa.fasta" to library (test_db) Added "Acinetobacter_phage.fasta" to library (test_db) Kraken build set to minimize disk writes. Creating k-mer set (step 1 of 6)... Found jellyfish v1.1.11 Hash size not specified, using '5120' K-mer set created. [0.029s] Skipping step 2, no database reduction requested. Sorting k-mer set (step 3 of 6)... K-mer set sorted. [0.030s] Skipping step 4, GI number to seqID map now obsolete. Creating seqID to taxID map (step 5 of 6)... 3 sequences mapped to taxa. [0.009s] Setting LCAs in database (step 6 of 6)... Finished processing 3 sequences Database LCAs set. [0.020s] Database construction complete. [Total: 0.105s] 2 sequences (0.00 Mbp) processed in 0.000s (983.6 Kseq/m, 94.43 Mbp/m). 2 sequences classified (100.00%) 0 sequences unclassified (0.00%) 0.00 0 0 U 0 unclassified Since we want to make sure our users will be able to work with usual fasta files I'll open an issue upstream and leave the bug open. Kind regards Andreas. -- http://fam-tille.de
Bug#889623: kraken: failing autopkgtest, possibly broken package
Hi,
since upstream claimed to have fixed a bug unrelated to this test case I
meanwhile uploaded kraken 1.1. To simplify fixing the issue here is the
output of the autopkgtest script on a local machine:
$ sh /usr/share/doc/kraken/run-unit-test
scan_fasta_file.pl: unable to determine taxonomy ID for sequence gi|441431932|
scan_fasta_file.pl: unable to determine taxonomy ID for sequence gi|28173057|
Kraken build set to minimize disk writes.
Creating k-mer set (step 1 of 6)...
Found jellyfish v1.1.11
kmer_estimator: malformed fasta file - expected header char > not found
Hash size not specified, using '2560'
terminate called after throwing an instance of
'jellyfish::file_parser::FileParserError'
what(): Empty input file '/dev/fd/0': Success
/usr/lib/kraken/build_kraken_db.sh: Zeile 96: 4909 Fertig
find library/ -name '*.fna' -print0
4910 | xargs -0 cat
4911 Abgebrochen | jellyfish1 count -m $KRAKEN_KMER_LEN -s
$KRAKEN_HASH_SIZE -C -t $KRAKEN_THREAD_CT -o database /dev/fd/0
kraken: database ("./test_db") does not contain necessary file database.kdb
kraken-report: database ("./test_db") does not contain necessary file
database.kdb
It would be really great if somebody could have a look
Andreas.
--
http://fam-tille.de
Bug#889623: Please fix autopkgtest (Was: Bug#889623: kraken: failing autopkgtest, possibly broken package)
Hi, On Sun, Feb 04, 2018 at 08:13:48PM -0800, Steve Langasek wrote: > Since the upload of kraken 1.0-1, the autopkgtests for this package > have been consistently failing in both Debian and Ubuntu. I confirm that the test is failing. I commited version 1.1 of kraken to Git and it keeps on failing. I assume that upstream might have changed the interface. Nadiya (or anybody else who has some background with biological applications) could you please have a look? Kind regards Andreas. -- http://fam-tille.de
Bug#889623: kraken: failing autopkgtest, possibly broken package
Source: kraken Version: 1.0-1 Severity: important User: ubuntu-de...@lists.ubuntu.com Usertags: origin-ubuntu bionic autopkgtest Dear Andreas, Since the upload of kraken 1.0-1, the autopkgtests for this package have been consistently failing in both Debian and Ubuntu. While the test failure is (unfortunately) not considered a blocker for Debian testing, autopkgtest regressions are blockers for Ubuntu releases. autopkgtest [18:36:18]: test run-unit-test: [--- scan_fasta_file.pl: unable to determine taxonomy ID for sequence gi|441431932| autopkgtest [18:36:19]: test run-unit-test: ---] autopkgtest [18:36:19]: test run-unit-test: - - - - - - - - - - results - - - - - - - - - - run-unit-testFAIL non-zero exit status 25 https://ci.debian.net/packages/k/kraken/unstable/amd64/ There is very little output from the test, so I'm unsure whether this represents serious breakage in the package; but I do see that the tests themselves have not changed from the previous version of the package where the test did pass, so it does seem likely to me that this is a bug in the package rather than in the test. -- Steve Langasek Give me a lever long enough and a Free OS Debian Developer to set it on, and I can move the world. Ubuntu Developerhttp://www.debian.org/ slanga...@ubuntu.com vor...@debian.org signature.asc Description: PGP signature
