On 8/28/17 10:08 AM, biocyberman wrote:
@Steve: Yes we talked at dconf 2017. I had to other things so D learning
got slow down. I am trying with Fasta format before jumping to Fastq
again. The jsoniopipe is full feature, and relatively small project,
which can be used to study case. However th
On Wednesday, 23 August 2017 at 13:06:36 UTC, Steven
Schveighoffer wrote:
On 8/23/17 5:53 AM, biocyberman wrote:
[...]
I'll respond to all your questions with what I would do,
instead of answering each one.
I would suggest an approach similar to how I approached parsing
JSON data. In your
On 8/23/17 5:53 AM, biocyberman wrote:
I lost my momentum to learn D and want to gain it up again. Therefore I
need some help with this seemingly simple task:
# Fasta sequence
\>Entry1_ID header field1|header field2|...
CAGATATCTTTGATGTCCTGATTGGAAGGACCGTTGGCCACCCTTAGGCAG
TGTATACTCTTCCATA
On Wednesday, 23 August 2017 at 09:53:49 UTC, biocyberman wrote:
I lost my momentum to learn D and want to gain it up again.
Therefore I need some help with this seemingly simple task:
# Fasta sequence
\>Entry1_ID header field1|header field2|...
CAGATATCTTTGATGTCCTGATTGGAAGGACCGTTGGCCACC
I lost my momentum to learn D and want to gain it up again.
Therefore I need some help with this seemingly simple task:
# Fasta sequence
\>Entry1_ID header field1|header field2|...
CAGATATCTTTGATGTCCTGATTGGAAGGACCGTTGGCCACCCTTAGGCAG
TGTATACTCTTCCATAAACGAGCTATTAGTTATGAGGTCCGTAGATTGGGG
Le dimanche 11 novembre 2012 à 18:34 +0100, bioinfornatics a écrit :
> Hi,
> I wrote a fasta parser for biology computing
> http://pastebin.geany.org/yheQN/
>
> I would like to get your experience to know if the writer could be
> better. The given parser use MmFile and Phobos
11/12/2012 2:14 PM, Tobias Pankrath пишет:
On Monday, 12 November 2012 at 09:16:54 UTC, Dmitry Olshansky wrote:
11/11/2012 9:34 PM, bioinfornatics пишет:
Hi,
I wrote a fasta parser for biology computing
http://pastebin.geany.org/yheQN/
I would like to get your experience to know if the writer
On Monday, 12 November 2012 at 09:16:54 UTC, Dmitry Olshansky
wrote:
11/11/2012 9:34 PM, bioinfornatics пишет:
Hi,
I wrote a fasta parser for biology computing
http://pastebin.geany.org/yheQN/
I would like to get your experience to know if the writer
could be
better. The given parser use
11/11/2012 9:34 PM, bioinfornatics пишет:
Hi,
I wrote a fasta parser for biology computing
http://pastebin.geany.org/yheQN/
I would like to get your experience to know if the writer could be
better. The given parser use MmFile and Phobos range.
fasta specification format => h
On 11/11/2012 03:55 PM, bioinfornatics wrote:
Le dimanche 11 novembre 2012 à 18:34 +0100, bioinfornatics a écrit :
Hi,
I wrote a fasta parser for biology computing
http://pastebin.geany.org/yheQN/
I would like to get your experience to know if the writer could be
better. The given parser use
Le dimanche 11 novembre 2012 à 18:34 +0100, bioinfornatics a écrit :
> Hi,
> I wrote a fasta parser for biology computing
> http://pastebin.geany.org/yheQN/
>
> I would like to get your experience to know if the writer could be
> better. The given parser use MmFile and Phobos
Le dimanche 11 novembre 2012 à 19:58 +0100, Simen Kjaeraas a écrit :
> On 2012-34-11 18:11, bioinfornatics
> wrote:
>
> > Hi,
> > I wrote a fasta parser for biology computing
> > http://pastebin.geany.org/yheQN/
> >
> > I would like to get your ex
On 2012-34-11 18:11, bioinfornatics
wrote:
Hi,
I wrote a fasta parser for biology computing
http://pastebin.geany.org/yheQN/
I would like to get your experience to know if the writer could be
better. The given parser use MmFile and Phobos range.
fasta specification format => h
Le dimanche 11 novembre 2012 à 18:34 +0100, bioinfornatics a écrit :
> Hi,
> I wrote a fasta parser for biology computing
> http://pastebin.geany.org/yheQN/
>
> I would like to get your experience to know if the writer could be
> better. The given parser use MmFile and Phobos
14 matches
Mail list logo