Re: [galaxy-dev] problems splitting
Hi Roberto, I'm happy you solved your issue, thanks for sharing the solution! I'd suggest you open a pull request with the fixes at https://github.com/galaxyproject/galaxy . Cheers, Nicola Il 25.02.2015 15:07 Roberto Alonso CIPF ha scritto: Hello again :), I have found the problem, the code that merge the files is this: galaxy/datatypes/tabular.py:484: cmd = 'egrep -v ^@ %s %s' % ( ' '.join(split_files[1:]), output_file ) This concatenates the file name into the sam file. Just adding h it is enough, so it will be like this: galaxy/datatypes/tabular.py:484: cmd = 'egrep -Hv ^@ %s %s' % ( ' '.join(split_files[1:]), output_file ) Thanks all for your help, best regards On 25 February 2015 at 12:31, Roberto Alonso CIPF wrote: Ok, I think I understand the line: beginning merge: bwa mem /home/ralonso/BiB/Galaxy/data/Cclementina_v1.0_scaffolds.fa /home/ralonso/galaxy-dist/database/files/000/dataset_8.dat /home/ralonso/galaxy-dist/database/files/000/dataset_94.dat 2 /dev/null it refers to the original command, so everything is fine with this line. The other problem still remains Regards, sorry for the confusion On 25 February 2015 at 11:40, Roberto Alonso CIPF wrote: Hello again, this is something that I consider important, when I see the log I see this output: galaxy.jobs.runners.tasks DEBUG 2015-02-25 11:33:30,989 execution finished - BEGINNING MERGE: BWA MEM /home/ralonso/BiB/Galaxy/data/Cclementina_v1.0_scaffolds.fa /home/ralonso/galaxy-dist/database/files/000/dataset_8.dat /home/ralonso/galaxy-dist/database/files/000/dataset_94.dat 2 /dev/null I think the merge should be done with samtools. I don't know how is this programmed in Galaxy, but I didn't indicate anywhere the path to samtools, is it maybe the problem related with this? Thanks a lot, Regards On 25 February 2015 at 11:13, Roberto Alonso CIPF wrote: Hello, I just changed for the CDATA format, but the problem still remains. When I split by 2, there is no problem, but when I go for 3, it happens the problem commented before. Here it is the link to the sam/bam file: https://dl.dropboxusercontent.com/u/1669701/ejemplo_split.bam [3] Best regards On 24 February 2015 at 17:49, Peter Cock wrote: On Tue, Feb 24, 2015 at 4:43 PM, Roberto Alonso CIPF wrote: Hello again, first of all thanks for your help, it is being very useful. What I have done up to now is to copy this method to the class Sequence def get_split_commands_sequential(is_compressed, input_name, output_name, start_sequence, sequence_count): ... return [cmd] get_split_commands_sequential = staticmethod(get_split_commands_sequential) This is something that you suggested. Good. When I run the tool with this configuration: map with bwa split_mode=number_of_parts bwa mem /home/ralonso/BiB/Galaxy/data/Cclementina_v1.0_scaffolds.fa $input $output 2/dev/null bwa One minor improvement would be to escape the as in your XML, or use the CDATA approach documented here: https://wiki.galaxyproject.org/Tools/BestPractices [2] Everything ends ok, but when I go to check how is the sam, I see that in the alingments it is the path of the file, i.e example_split.sam: /home/ralonso/galaxy-dist/database/job_working_directory/000/90/task_2/dataset_91.dat:SRR098409.1113446 4 * 0 0 * * 0 0 TCTGGGTGAGGGAGTAGTGGGTGAGGGTGTGTGAGGATGTGTAAGTGGATGGAAGTAGATTGAATGTT AS:i:0 XS:i:0 you know what may be going on? If i don't split the file, everything goes correctly. This sounds to me like there may be a problem with SAM merging? Could you share the entire example_split.sam file (e.g. as a gist on GitHub, or via dropbox)? Peter -- Roberto Alonso Functional Genomics Unit Bioinformatics and Genomics Department Prince Felipe Research Center (CIPF) C./Eduardo Primo Yúfera (Científic), nº 3 (junto Oceanografico) 46012 Valencia, Spain Tel: +34 963289680 Ext. 1021 Fax: +34 963289574 E-Mail: ralo...@cipf.es [5] -- Roberto Alonso Functional Genomics Unit Bioinformatics and Genomics Department Prince Felipe Research Center (CIPF) C./Eduardo Primo Yúfera (Científic), nº 3 (junto Oceanografico) 46012 Valencia, Spain Tel: +34 963289680 Ext. 1021 Fax: +34 963289574 E-Mail: ralo...@cipf.es [7] -- Roberto Alonso Functional Genomics Unit Bioinformatics and Genomics Department Prince Felipe Research Center (CIPF) C./Eduardo Primo Yúfera (Científic), nº 3 (junto Oceanografico) 46012 Valencia, Spain Tel: +34 963289680 Ext. 1021 Fax: +34 963289574 E-Mail: ralo...@cipf.es [9] -- Roberto Alonso Functional Genomics Unit Bioinformatics and Genomics Department Prince Felipe Research Center (CIPF) C./Eduardo Primo Yúfera (Científic), nº 3 (junto Oceanografico) 46012 Valencia, Spain Tel: +34 963289680 Ext. 1021
Re: [galaxy-dev] problems splitting
Hello again, this is something that I consider important, when I see the log I see this output: galaxy.jobs.runners.tasks DEBUG 2015-02-25 11:33:30,989 execution finished -* beginning merge: bwa mem* /home/ralonso/BiB/Galaxy/data/Cclementina_v1.0_scaffolds.fa /home/ralonso/galaxy-dist/database/files/000/dataset_8.dat /home/ralonso/galaxy-dist/database/files/000/dataset_94.dat 2 /dev/null I think the merge should be done with samtools. I don't know how is this programmed in Galaxy, but I didn't indicate anywhere the path to samtools, is it maybe the problem related with this? Thanks a lot, Regards On 25 February 2015 at 11:13, Roberto Alonso CIPF ralo...@cipf.es wrote: Hello, I just changed for the CDATA format, but the problem still remains. When I split by 2, there is no problem, but when I go for 3, it happens the problem commented before. Here it is the link to the sam/bam file: https://dl.dropboxusercontent.com/u/1669701/ejemplo_split.bam Best regards On 24 February 2015 at 17:49, Peter Cock p.j.a.c...@googlemail.com wrote: On Tue, Feb 24, 2015 at 4:43 PM, Roberto Alonso CIPF ralo...@cipf.es wrote: Hello again, first of all thanks for your help, it is being very useful. What I have done up to now is to copy this method to the class Sequence def get_split_commands_sequential(is_compressed, input_name, output_name, start_sequence, sequence_count): ... return [cmd] get_split_commands_sequential = staticmethod(get_split_commands_sequential) This is something that you suggested. Good. When I run the tool with this configuration: tool id=bwa_mio name=map with bwa descriptionmap with bwa/description parallelism method=basic split_size=3 split_mode=number_of_parts/parallelism command bwa mem /home/ralonso/BiB/Galaxy/data/Cclementina_v1.0_scaffolds.fa $input $output 2/dev/null/command inputs param format=fastqsanger name=input type=data label=fastq/ /inputs outputs data format=sam name=output / /outputs help bwa /help /tool One minor improvement would be to escape the as gt; in your XML, or use the CDATA approach documented here: https://wiki.galaxyproject.org/Tools/BestPractices Everything ends ok, but when I go to check how is the sam, I see that in the alingments it is the path of the file, i.e example_split.sam: /home/ralonso/galaxy-dist/database/job_working_directory/000/90/task_2/dataset_91.dat:SRR098409.1113446 4 * 0 0 * * 0 0 TCTGGGTGAGGGAGTAGTGGGTGAGGGTGTGTGAGGATGTGTAAGTGGATGGAAGTAGATTGAATGTT AS:i:0 XS:i:0 you know what may be going on? If i don't split the file, everything goes correctly. This sounds to me like there may be a problem with SAM merging? Could you share the entire example_split.sam file (e.g. as a gist on GitHub, or via dropbox)? Peter -- Roberto Alonso Functional Genomics Unit Bioinformatics and Genomics Department Prince Felipe Research Center (CIPF) C./Eduardo Primo Yúfera (Científic), nº 3 (junto Oceanografico) 46012 Valencia, Spain Tel: +34 963289680 Ext. 1021 Fax: +34 963289574 E-Mail: ralo...@cipf.es -- Roberto Alonso Functional Genomics Unit Bioinformatics and Genomics Department Prince Felipe Research Center (CIPF) C./Eduardo Primo Yúfera (Científic), nº 3 (junto Oceanografico) 46012 Valencia, Spain Tel: +34 963289680 Ext. 1021 Fax: +34 963289574 E-Mail: ralo...@cipf.es ___ Please keep all replies on the list by using reply all in your mail client. To manage your subscriptions to this and other Galaxy lists, please use the interface at: https://lists.galaxyproject.org/ To search Galaxy mailing lists use the unified search at: http://galaxyproject.org/search/mailinglists/
Re: [galaxy-dev] problems splitting
Hello, I just changed for the CDATA format, but the problem still remains. When I split by 2, there is no problem, but when I go for 3, it happens the problem commented before. Here it is the link to the sam/bam file: https://dl.dropboxusercontent.com/u/1669701/ejemplo_split.bam Best regards On 24 February 2015 at 17:49, Peter Cock p.j.a.c...@googlemail.com wrote: On Tue, Feb 24, 2015 at 4:43 PM, Roberto Alonso CIPF ralo...@cipf.es wrote: Hello again, first of all thanks for your help, it is being very useful. What I have done up to now is to copy this method to the class Sequence def get_split_commands_sequential(is_compressed, input_name, output_name, start_sequence, sequence_count): ... return [cmd] get_split_commands_sequential = staticmethod(get_split_commands_sequential) This is something that you suggested. Good. When I run the tool with this configuration: tool id=bwa_mio name=map with bwa descriptionmap with bwa/description parallelism method=basic split_size=3 split_mode=number_of_parts/parallelism command bwa mem /home/ralonso/BiB/Galaxy/data/Cclementina_v1.0_scaffolds.fa $input $output 2/dev/null/command inputs param format=fastqsanger name=input type=data label=fastq/ /inputs outputs data format=sam name=output / /outputs help bwa /help /tool One minor improvement would be to escape the as gt; in your XML, or use the CDATA approach documented here: https://wiki.galaxyproject.org/Tools/BestPractices Everything ends ok, but when I go to check how is the sam, I see that in the alingments it is the path of the file, i.e example_split.sam: /home/ralonso/galaxy-dist/database/job_working_directory/000/90/task_2/dataset_91.dat:SRR098409.1113446 4 * 0 0 * * 0 0 TCTGGGTGAGGGAGTAGTGGGTGAGGGTGTGTGAGGATGTGTAAGTGGATGGAAGTAGATTGAATGTT AS:i:0 XS:i:0 you know what may be going on? If i don't split the file, everything goes correctly. This sounds to me like there may be a problem with SAM merging? Could you share the entire example_split.sam file (e.g. as a gist on GitHub, or via dropbox)? Peter -- Roberto Alonso Functional Genomics Unit Bioinformatics and Genomics Department Prince Felipe Research Center (CIPF) C./Eduardo Primo Yúfera (Científic), nº 3 (junto Oceanografico) 46012 Valencia, Spain Tel: +34 963289680 Ext. 1021 Fax: +34 963289574 E-Mail: ralo...@cipf.es ___ Please keep all replies on the list by using reply all in your mail client. To manage your subscriptions to this and other Galaxy lists, please use the interface at: https://lists.galaxyproject.org/ To search Galaxy mailing lists use the unified search at: http://galaxyproject.org/search/mailinglists/
Re: [galaxy-dev] problems splitting
Ok, I think I understand the line: beginning merge: bwa mem /home/ralonso/BiB/Galaxy/data/Cclementina_v1.0_scaffolds.fa /home/ralonso/galaxy-dist/database/files/000/dataset_8.dat /home/ralonso/galaxy-dist/database/files/000/dataset_94.dat 2 /dev/null it refers to the original command, so everything is fine with this line. The other problem still remains Regards, sorry for the confusion On 25 February 2015 at 11:40, Roberto Alonso CIPF ralo...@cipf.es wrote: Hello again, this is something that I consider important, when I see the log I see this output: galaxy.jobs.runners.tasks DEBUG 2015-02-25 11:33:30,989 execution finished -* beginning merge: bwa mem* /home/ralonso/BiB/Galaxy/data/Cclementina_v1.0_scaffolds.fa /home/ralonso/galaxy-dist/database/files/000/dataset_8.dat /home/ralonso/galaxy-dist/database/files/000/dataset_94.dat 2 /dev/null I think the merge should be done with samtools. I don't know how is this programmed in Galaxy, but I didn't indicate anywhere the path to samtools, is it maybe the problem related with this? Thanks a lot, Regards On 25 February 2015 at 11:13, Roberto Alonso CIPF ralo...@cipf.es wrote: Hello, I just changed for the CDATA format, but the problem still remains. When I split by 2, there is no problem, but when I go for 3, it happens the problem commented before. Here it is the link to the sam/bam file: https://dl.dropboxusercontent.com/u/1669701/ejemplo_split.bam Best regards On 24 February 2015 at 17:49, Peter Cock p.j.a.c...@googlemail.com wrote: On Tue, Feb 24, 2015 at 4:43 PM, Roberto Alonso CIPF ralo...@cipf.es wrote: Hello again, first of all thanks for your help, it is being very useful. What I have done up to now is to copy this method to the class Sequence def get_split_commands_sequential(is_compressed, input_name, output_name, start_sequence, sequence_count): ... return [cmd] get_split_commands_sequential = staticmethod(get_split_commands_sequential) This is something that you suggested. Good. When I run the tool with this configuration: tool id=bwa_mio name=map with bwa descriptionmap with bwa/description parallelism method=basic split_size=3 split_mode=number_of_parts/parallelism command bwa mem /home/ralonso/BiB/Galaxy/data/Cclementina_v1.0_scaffolds.fa $input $output 2/dev/null/command inputs param format=fastqsanger name=input type=data label=fastq/ /inputs outputs data format=sam name=output / /outputs help bwa /help /tool One minor improvement would be to escape the as gt; in your XML, or use the CDATA approach documented here: https://wiki.galaxyproject.org/Tools/BestPractices Everything ends ok, but when I go to check how is the sam, I see that in the alingments it is the path of the file, i.e example_split.sam: /home/ralonso/galaxy-dist/database/job_working_directory/000/90/task_2/dataset_91.dat:SRR098409.1113446 4 * 0 0 * * 0 0 TCTGGGTGAGGGAGTAGTGGGTGAGGGTGTGTGAGGATGTGTAAGTGGATGGAAGTAGATTGAATGTT AS:i:0 XS:i:0 you know what may be going on? If i don't split the file, everything goes correctly. This sounds to me like there may be a problem with SAM merging? Could you share the entire example_split.sam file (e.g. as a gist on GitHub, or via dropbox)? Peter -- Roberto Alonso Functional Genomics Unit Bioinformatics and Genomics Department Prince Felipe Research Center (CIPF) C./Eduardo Primo Yúfera (Científic), nº 3 (junto Oceanografico) 46012 Valencia, Spain Tel: +34 963289680 Ext. 1021 Fax: +34 963289574 E-Mail: ralo...@cipf.es -- Roberto Alonso Functional Genomics Unit Bioinformatics and Genomics Department Prince Felipe Research Center (CIPF) C./Eduardo Primo Yúfera (Científic), nº 3 (junto Oceanografico) 46012 Valencia, Spain Tel: +34 963289680 Ext. 1021 Fax: +34 963289574 E-Mail: ralo...@cipf.es -- Roberto Alonso Functional Genomics Unit Bioinformatics and Genomics Department Prince Felipe Research Center (CIPF) C./Eduardo Primo Yúfera (Científic), nº 3 (junto Oceanografico) 46012 Valencia, Spain Tel: +34 963289680 Ext. 1021 Fax: +34 963289574 E-Mail: ralo...@cipf.es ___ Please keep all replies on the list by using reply all in your mail client. To manage your subscriptions to this and other Galaxy lists, please use the interface at: https://lists.galaxyproject.org/ To search Galaxy mailing lists use the unified search at: http://galaxyproject.org/search/mailinglists/
Re: [galaxy-dev] problems splitting
Hello again, first of all thanks for your help, it is being very useful. What I have done up to now is to copy this method to the class Sequence def get_split_commands_sequential(is_compressed, input_name, output_name, start_sequence, sequence_count): Does a brain-dead sequential scan extract of certain sequences Sequence.get_split_commands_sequential(True, './input.gz', './output.gz', start_sequence=0, sequence_count=10) ['zcat ./input.gz | ( tail -n +1 2 /dev/null) | head -40 | gzip -c ./output.gz'] Sequence.get_split_commands_sequential(False, './input.fastq', './output.fastq', start_sequence=10, sequence_count=10) ['tail -n +41 ./input.fastq 2 /dev/null | head -40 ./output.fastq'] start_line = start_sequence * 4 line_count = sequence_count * 4 # TODO: verify that tail can handle 64-bit numbers if is_compressed: cmd = 'zcat %s | ( tail -n +%s 2 /dev/null) | head -%s | gzip -c' % (input_name, start_line+1, line_count) else: cmd = 'tail -n +%s %s 2 /dev/null | head -%s' % (start_line+1, input_name, line_count) cmd += ' %s' % output_name return [cmd] get_split_commands_sequential = staticmethod(get_split_commands_sequential) This is something that you suggested. When I run the tool with this configuration: tool id=bwa_mio name=map with bwa descriptionmap with bwa/description parallelism method=basic split_size=3 split_mode=number_of_parts/parallelism command bwa mem /home/ralonso/BiB/Galaxy/data/Cclementina_v1.0_scaffolds.fa $input $output 2/dev/null/command inputs param format=fastqsanger name=input type=data label=fastq/ /inputs outputs data format=sam name=output / /outputs help bwa /help /tool Everything ends ok, but when I go to check how is the sam, I see that in the alingments it is the path of the file, i.e example_split.sam: /home/ralonso/galaxy-dist/database/job_working_directory/000/90/task_2/dataset_91.dat:SRR098409.1113446 4 * 0 0 * * 0 0 TCTGGGTGAGGGAGTAGTGGGTGAGGGTGTGTGAGGATGTGTAAGTGGATGGAAGTAGATTGAATGTT AS:i:0 XS:i:0 you know what may be going on? If i don't split the file, everything goes correctly. Best regards On 13 February 2015 at 13:39, Peter Cock p.j.a.c...@googlemail.com wrote: On Fri, Feb 13, 2015 at 11:38 AM, Nicola Soranzo nsora...@tiscali.it wrote: Il 13.02.2015 03:17 Peter Cock ha scritto: Hi Roberto, It looks like this is a known issue with FASTQ splitting, https://trello.com/c/qRHLFSzd/1522-issues-with-tasked-jobs-parallelism I originally broke it during a refactor, but it looks like the discussion died about that that method was meant to do (e.g. FQTOC = FASTQ table of contents?): https://bitbucket.org/galaxy/galaxy-central/commits/76277761807306ec2be3f1e4059dd7cde6fd2dc6#comment-820648 I'm away from the office so can't try this, but probably all that is needed is to copy and paste the old method get_split_commands_sequential and the old method get_split_commands_with_toc (removed from the base Sequence class in the above commit) into the base Fastq class instead. Nicola - did you fix this locally after noticing the problem last year? No, sorry, we disabled Galaxy parallelism because it was using too many cluster nodes. Nicola I had similar comments from some of the cluster users after getting it working here - but on balance a well used cluster helps justify future investment in maintaining it. Sorry about not following up on this - I think I might have assumed you would take care of it. Unfortunately I won't be able to test the obvious fix until at least a week later... Peter -- Roberto Alonso Functional Genomics Unit Bioinformatics and Genomics Department Prince Felipe Research Center (CIPF) C./Eduardo Primo Yúfera (Científic), nº 3 (junto Oceanografico) 46012 Valencia, Spain Tel: +34 963289680 Ext. 1021 Fax: +34 963289574 E-Mail: ralo...@cipf.es ___ Please keep all replies on the list by using reply all in your mail client. To manage your subscriptions to this and other Galaxy lists, please use the interface at: https://lists.galaxyproject.org/ To search Galaxy mailing lists use the unified search at: http://galaxyproject.org/search/mailinglists/
Re: [galaxy-dev] problems splitting
On Tue, Feb 24, 2015 at 4:43 PM, Roberto Alonso CIPF ralo...@cipf.es wrote: Hello again, first of all thanks for your help, it is being very useful. What I have done up to now is to copy this method to the class Sequence def get_split_commands_sequential(is_compressed, input_name, output_name, start_sequence, sequence_count): ... return [cmd] get_split_commands_sequential = staticmethod(get_split_commands_sequential) This is something that you suggested. Good. When I run the tool with this configuration: tool id=bwa_mio name=map with bwa descriptionmap with bwa/description parallelism method=basic split_size=3 split_mode=number_of_parts/parallelism command bwa mem /home/ralonso/BiB/Galaxy/data/Cclementina_v1.0_scaffolds.fa $input $output 2/dev/null/command inputs param format=fastqsanger name=input type=data label=fastq/ /inputs outputs data format=sam name=output / /outputs help bwa /help /tool One minor improvement would be to escape the as gt; in your XML, or use the CDATA approach documented here: https://wiki.galaxyproject.org/Tools/BestPractices Everything ends ok, but when I go to check how is the sam, I see that in the alingments it is the path of the file, i.e example_split.sam: /home/ralonso/galaxy-dist/database/job_working_directory/000/90/task_2/dataset_91.dat:SRR098409.1113446 4 * 0 0 * * 0 0 TCTGGGTGAGGGAGTAGTGGGTGAGGGTGTGTGAGGATGTGTAAGTGGATGGAAGTAGATTGAATGTT AS:i:0 XS:i:0 you know what may be going on? If i don't split the file, everything goes correctly. This sounds to me like there may be a problem with SAM merging? Could you share the entire example_split.sam file (e.g. as a gist on GitHub, or via dropbox)? Peter ___ Please keep all replies on the list by using reply all in your mail client. To manage your subscriptions to this and other Galaxy lists, please use the interface at: https://lists.galaxyproject.org/ To search Galaxy mailing lists use the unified search at: http://galaxyproject.org/search/mailinglists/
Re: [galaxy-dev] problems splitting
Hi Roberto, It looks like this is a known issue with FASTQ splitting, https://trello.com/c/qRHLFSzd/1522-issues-with-tasked-jobs-parallelism I originally broke it during a refactor, but it looks like the discussion died about that that method was meant to do (e.g. FQTOC = FASTQ table of contents?): https://bitbucket.org/galaxy/galaxy-central/commits/76277761807306ec2be3f1e4059dd7cde6fd2dc6#comment-820648 I'm away from the office so can't try this, but probably all that is needed is to copy and paste the old method get_split_commands_sequential and the old method get_split_commands_with_toc (removed from the base Sequence class in the above commit) into the base Fastq class instead. Nicola - did you fix this locally after noticing the problem last year? Peter On Wed, Feb 11, 2015 at 3:45 PM, Roberto Alonso CIPF ralo...@cipf.es wrote: Hello, I am trying to map a a fastqsacer file and map it with bwa, my bwa tool config file is this: tool id=bwa_mio name=map with bwa descriptionmap with bwa/description parallelism method=basic split_size=2 split_mode=number_of_parts/parallelism command bwa mem /home/ralonso/BiB/Galaxy/data/Cclementina_v1.0_scaffolds.fa $input $output 2xx/command inputs param format=fastqsanger name=input type=data label=fastq/ /inputs outputs data format=sam name=output / /outputs help bwa /help /tool And when I see the stderr I see this error: type object 'Sequence' has no attribute 'get_split_commands_sequential' It seems that this command that I see in the log is not working galaxy.jobs.runners DEBUG 2015-02-11 16:33:48,738 (74) command is: /home/ralonso/galaxy-dist/extract_dataset_parts.sh /home/ralonso/galaxy-dist/database/job_working_directory/000/74/task_0; bwa mem /home/ralonso/BiB/Galaxy/data/Cclementina_v1.0_scaffolds.fa /home/ralonso/galaxy-dist/database/job_working_directory/000/74/task_0/dataset_8.dat /home/ralonso/galaxy-dist/database/job_working_directory/000/74/task_0/dataset_75.dat When I go directly to the code, around line 559 of class galaxy.datatypes.sequence I can't find this function get_split_commands_sequential anywhere. Any idea? Thank you very much Regards -- Roberto Alonso Functional Genomics Unit Bioinformatics and Genomics Department Prince Felipe Research Center (CIPF) C./Eduardo Primo Yúfera (Científic), nº 3 (junto Oceanografico) 46012 Valencia, Spain Tel: +34 963289680 Ext. 1021 Fax: +34 963289574 E-Mail: ralo...@cipf.es ___ Please keep all replies on the list by using reply all in your mail client. To manage your subscriptions to this and other Galaxy lists, please use the interface at: https://lists.galaxyproject.org/ To search Galaxy mailing lists use the unified search at: http://galaxyproject.org/search/mailinglists/ ___ Please keep all replies on the list by using reply all in your mail client. To manage your subscriptions to this and other Galaxy lists, please use the interface at: https://lists.galaxyproject.org/ To search Galaxy mailing lists use the unified search at: http://galaxyproject.org/search/mailinglists/
