Re: [galaxy-user] Nucleotide analysis - GC percentage
Peter and Guru; [Computing GC] I'll be working with simple sequence files (FASTA, or even FASTQ, SFF, etc) rather than BED files, but I'll keep that in mind. Emboss has some utilities that do this. infoseq and geecee, and there are also programs for exploring CpG islands: http://emboss.sourceforge.net/apps/release/6.3/emboss/apps/nucleic_cpg_islands_group.html Brad ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
Re: [galaxy-user] View Running Job from Multiple Computers?
Yes it is - where you access the cloud console or Galaxy from has no affect on running of the jobs. Enis On Thu, Apr 14, 2011 at 12:01 PM, Mike Dufault dufau...@yahoo.com wrote: Hi, I have an instance of Galaxy running on AWS. I would like to view it's progress throughout the day, but I am not always at my home computer. Is it possible to enter the public DNS from any computer to view the progress? I am hesitant to try anything which may interfere with the job that is currently running. Thanks, Mike ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
Re: [galaxy-user] Nucleotide analysis - GC percentage
Hi Brad, These tools are also in galaxy under the EMBOSS section. geecee will tell you the percentage of GC in FASTA sequences. It basically outputs the sequence name and then the GC content as below: #Sequence GC content Sequence1 0.44 Hope this helps! Tychele On Apr 14, 2011, at 12:13 PM, Brad Chapman wrote: Peter and Guru; [Computing GC] I'll be working with simple sequence files (FASTA, or even FASTQ, SFF, etc) rather than BED files, but I'll keep that in mind. Emboss has some utilities that do this. infoseq and geecee, and there are also programs for exploring CpG islands: http://emboss.sourceforge.net/apps/release/6.3/emboss/apps/nucleic_cpg_islands_group.html Brad ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
Re: [galaxy-user] Nucleotide analysis - GC percentage
Now why does a tool search on the public Galaxy instance for GC not suggest this tool? Name: geecee Description: Calculates fractional GC content of nucleic acid sequences Does this mean the description isn't searched? It would seem like a sensible idea to me to include that... Searching for geecee works, but unless you're familiar with this EMBOSS tool no-one will think of that. Peter, The tool search doesn't start until you type in three characters, so typing 'GC' does not initiate a search. Typing 'gcspace' or 'gc content' works. Perhaps a tooltip or help text is needed. J. ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
Re: [galaxy-user] too many list digests
The sys admin may need to bump up the digest size threshold for the various lists. I only get galaxy-commits in digest form, but it's not unusual for me to get three or four a day. -- Olen On Fri, Apr 8, 2011 at 11:09 PM, Jennifer Jackson j...@bx.psu.edu wrote: Hi Yury, You can manage your subscription at: http://lists.bx.psu.edu/listinfo/galaxy-dev Next week, I can also follow up with our sys admin to make sure nothing unusual is going on. Hopefully this helps, Jen Galaxy team On 4/8/11 1:39 PM, Yury Bukhman wrote: Hi, I have been receiving multiple digests of this list every day, as many as 8 on April 6! Is it possible to make the digests less frequent? One per day would really be enough for me. Thanks. Yury -- Yury V. Bukhman, Ph.D. Associate Scientist, Bioinformatics Great Lakes Bioenergy Research Center University of Wisconsin - Madison 445 Henry Mall, Rm. 513 Madison, WI 53706, USA Phone: 608-890-2680 Fax: 608-890-2427 Email: ybukh...@glbrc.wisc.edu ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ -- Jennifer Jackson http://usegalaxy.org http://galaxyproject.org ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
Re: [galaxy-user] too many list digests
Hi Olen, Yury, and all other digesters, I've bounced the threshold for new digests up from 30KB to 300KB. Mailman will still send out a digest at the end of the day, even if that threshold is not hit. Thanks for pointing this out. Dave C. On Thu, Apr 14, 2011 at 2:08 PM, Olen Vance Sluder Jr o...@acm.org wrote: The sys admin may need to bump up the digest size threshold for the various lists. I only get galaxy-commits in digest form, but it's not unusual for me to get three or four a day. -- Olen On Fri, Apr 8, 2011 at 11:09 PM, Jennifer Jackson j...@bx.psu.edu wrote: Hi Yury, You can manage your subscription at: http://lists.bx.psu.edu/listinfo/galaxy-dev Next week, I can also follow up with our sys admin to make sure nothing unusual is going on. Hopefully this helps, Jen Galaxy team On 4/8/11 1:39 PM, Yury Bukhman wrote: Hi, I have been receiving multiple digests of this list every day, as many as 8 on April 6! Is it possible to make the digests less frequent? One per day would really be enough for me. Thanks. Yury -- Yury V. Bukhman, Ph.D. Associate Scientist, Bioinformatics Great Lakes Bioenergy Research Center University of Wisconsin - Madison 445 Henry Mall, Rm. 513 Madison, WI 53706, USA Phone: 608-890-2680 Fax: 608-890-2427 Email: ybukh...@glbrc.wisc.edu ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ -- Jennifer Jackson http://usegalaxy.org http://galaxyproject.org ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ -- http://galaxy.psu.edu/gcc2011/ http://getgalaxy.org http://usegalaxy.org/ ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
[galaxy-user] Read count issue with clipper/collapser
Could someone take a look at this history in Galaxy? http://main.g2.bx.psu.edu/u/kenaka/h/count-issue collapser is not reporting the correct counts in the output for one of my files. seqdata1 and seqdata2 should both have 50 reads. Yet it is reporting more reads for seqdata1 in both the verbose reporting and the output. I have the same issue with the fastx_toolkit, as per below. What could be the cause? Thanks.Ken From: kenec...@hotmail.com To: galaxy-u...@bx.psu.edu Date: Thu, 14 Apr 2011 03:12:14 + Subject: Re: [galaxy-user] regarding read counts from fastx_clipper Apologies for the long content.. I seem to be having a discrepancy with fastx_collapser as well. I have converted from s_8_sequence_clipped.fa to s_8_sequence_collapsed.fa fastx_collapser -v -i s8_sequence_clipped.fa -o s8_sequence_collapsed.faInput: 26580941 sequences (representing 212647528 reads)--- what the..?Output: 3177400 sequences (representing 212647528 reads) In my collapsed file, my top read is: 1-35820208TACCTGGTTGATCCTGCCAGTAG (this is already over my original read count) When I grep -e TACCTGGTTGATCCTGCCAGTAG -c s_8_sequence_clipped.fa 4,503,566 Ok, I've reanalyzed a previous dataset and the output is consistent with my previous numbers: fastx_collapser -v -i s3-sequence.fa -o s4-sequence-RETEST.faInput: 36008043 sequences (representing 36008043 reads)Output: 3886503 sequences (representing 36008043 reads) so it doesn't appear to be the toolkit. How are the tools counting reads and sequences ?Could the format of the headers affect it? hyphens vs underscores? This data set:ILLUMINA-08A740_:8:1:1736:1055#0/1GCGAGCGTAGTTCAATGGTCATCTCCTTGCCAAGGA Previous data set:GAPC_0034_FC:1:1:1548:1028#0/1AAACTTCATCGTTATCGAGCGA Thanks From: kenec...@hotmail.com To: galaxy-u...@bx.psu.edu Date: Thu, 14 Apr 2011 00:54:05 + Subject: [galaxy-user] regarding read counts from fastx_clipper Hi, I'm using the fastx_toolkit (v0.0.13) command line scripts. When using fastx_clipper, I get: fastx_clipper -a TCGTATGCCGTCTTCTGCTTG -v -c -l 15 -M 5 -i s_8_sequence.fa -o s_8_sequence_clipped.faClipping Adapter: TCGTATGCCGTCTTCTGCTTGMin. Length: 15Non-Clipped reads - discarded.Input: 227673720 reads.Output: 212647528 reads.discarded 3527200 too-short reads.discarded 725608 adapter-only reads.discarded 10773384 non-clipped reads.discarded 0 N reads. The s_8_sequence.fa file is 2.2Gb, s_8_sequence_clipped.fa file is 1.7Gb seems like fastx_clipper is reporting way too many reads in this instance. I also tried without the -M option but same thing. I checked with: wc -l s_8_sequence.fa56918430(divide this by 2 gives 28,459,215 reads) wc -l s_8_sequence_clipped.fa53161882(divided by 2 gives 26,580,941 reads) There has never been such a discrepancy with this tool. I'm not sure if I'm doing something silly this time round, or somethings changed in my system that's affecting fastx_clipper counting. Heres a couple of lines from input and output: head -n 6 s_8_sequence.faILLUMINA-08A740_:8:1:1736:1055#0/1GCGAGCGTAGTTCAATGGTCATCTCCTTGCCAAGGAILLUMINA-08A740_:8:1:2219:1057#0/1CAAGCGTCGGAGGTTTAGTCTTTCGTATGCCGTCTTCTGCILLUMINA-08A740_:8:1:2316:1056#0/1TACCTGGTTGATCCTGCCAGTAGTCGTATGCCGTCTTCTG head -n 6 s_8_sequence_clipped.faILLUMINA-08A740_:8:1:2219:1057#0/1CAAGCGTCGGAGGTTTAGTCTTILLUMINA-08A740_:8:1:2316:1056#0/1TACCTGGTTGATCCTGCCAGTAGILLUMINA-08A740_:8:1:3041:1059#0/1GAAGCTGCGGGTTCGAGGTCAGTCCCGCCA Any ideas? Thanks, Ken ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your
