Hello Davide,
If the data does represent alignments (not just sequence), then there is
one more item to check for. Another team member reminded me that
Cufflinks requires an XS custom tag in an input SAM file (or any
compressed BAM file that represents it). Details are here from the
Cufflinks manual:
http://cufflinks.cbcb.umd.edu/manual.html#cufflinks_input :
--
Cufflinks takes a text file of SAM alignments, or a binary SAM (BAM)
file as input. For more details on the SAM format, see the specification
http://samtools.sourceforge.net/SAM1.pdf. The RNA-Seq read mapper
TopHat http://tophat.cbcb.umd.edu/ produces output in this format, and
is recommended for use with Cufflinks. However Cufflinks will accept SAM
alignments generated by any read mapper. Here's an example of an
alignment Cufflinks will accept:
s6.25mer.txt-913508 16 chr1 4482736 255 14M431N11M * 0 0 \
CAAGATGCTAGGCAAGTCTTGGAAG I NM:i:0 XS:A:-
Note the use of the custom tag XS. This attribute, which must have a
value of + or -, indicates which strand the RNA that produced this
read came from. While this tag can be applied to any alignment,
including unspliced ones, it *must* be present for all spliced alignment
records (those with a 'N' operation in the CIGAR string).
This should be fairly easy to check for now that the data is in
uncompressed SAM format. Running the pipeline starting with Tophat may
be the best choice. If you using the public Main server and have
continued problems not covered in our tutorial/FAQ, a bug report can be
submitted from error datasets:
http://wiki.galaxyproject.org/Support#Reporting_tool_errors
Hopefully this helps,
Jen
Galaxy team
On 12/17/12 11:46 PM, Davide Degli Esposti wrote:
Dear Jen,
Thank you very much for your help. As you mentioned, it seems likely a
problem of the input. I tried to transform the bam file in sam at your
Galaxy site and then to run cufflinks and I have got the three output
files. Do you think it is an acceptable way to avoid the obstacle? I
am going to perform some controls checking for the results obtained
from other methods.
Thank you again for your help
Best,
davide
---
Davide Degli Esposti, PhD
Epigenetic (EGE) Group
International Agency for Research on Cancer
Tel. +33 4 72738036
Fax. +33 4 72738322
150, cours Albert Thomas
69372 Lyon Cedex 08
France
*From:* Jennifer Jackson [j...@bx.psu.edu]
*Sent:* Tuesday, December 18, 2012 2:53 AM
*To:* Davide Degli Esposti
*Cc:* galaxy-user@lists.bx.psu.edu
*Subject:* Re: [galaxy-user] cufflinks analysis using .bam files
generated by LifeScope (ABI 5500 Sequencer)
Hello Davide,
The fact that you are not getting any error points to some problem
with the input. Perhaps you are sending just sequence data in BAM
format to Cufflinks, without any alignment performed first? Some sort
of error would be expected for most other cases, but this is not the
Galaxy server our team hosts, it is difficult to state exactly what
the issue may be, just offer suggestions.
Tophat will require fastq files as input, unless this alternate Galaxy
site has a modified wrapper. Then the alignments generated by Tophat
(or another alignment tool, sometimes Bowtie is used) in BAM format
are the input to Cuffinks (along with other optional data).
If your data are aligned BAM, and you continue to have problems with
this alternate Galaxy site, it would be best to contact the group that
runs it - the information is on their home page (middle panel) when
you follow the url.
You could also decide to use the public Galaxy instance run by our
core project team at http://usegalaxy.org, if we have the tool set you
wish to use. A generalized tutorial for RNA-seq analysis is available
here:
http://main.g2.bx.psu.edu/u/jeremy/p/galaxy-rna-seq-analysis-exercise
And some troubleshooting help here:
http://wiki.galaxyproject.org/Support#Tools_on_the_Main_server
The tool author's original documentation would be good to review as well:
http://tophat.cbcb.umd.edu
http://cufflinks.cbcb.umd.edu
Best,
Jen
Galaxy team
On 12/13/12 11:47 AM, Davide Degli Esposti wrote:
Hello,
I am new in using Galaxy and I am working on .bam files generated by
our sequencing platform, using the LifeScope software associated to
ABI 5500 sequencer. I uploaded my files on a galaxy browser (
http://galaxy.raetschlab.org) and I tried to run cufflink assemble
and quantify reads expression levels for each file. However, when I
run cufflinks (using default parameters) the output is an empty file.
What is going wrong? Should I use special parameters? Are the .bam
files generated by LifeScope suitable for cufflink analysis or should
I transform the xsq ABI output in a fastq and then apply TopHat?
I thank you very much for your help
Davide
---
Davide Degli Esposti, PhD
Epigenetic (EGE) Group
International Agency for Research on