Re: [galaxy-user] cufflinks FPKM problem
Cufflinks requires an 'xs' tag on each read in the bam file. Only tophat does this. You can write a script to add this or remap with tophat. How much of a difference do you see between tophat and bioscope? Please excuse any typos -- Sent from my iPhone On Apr 11, 2011, at 9:46 AM, lishiyong lishiy...@genomics.org.cn wrote: Hi： I use the solid PE sequencing data and mapped with the bioscope tools(AB company supported) ，which is better for solid data mapping ,so I don't use the bowtie to map . Ｉgain the BAM file! Now ,I want use the cufflinks to calculate the gene expression. But there is a error. [15:08:06] Inspecting reads and determining fragment length distribution. BAM record error: found spliced alignment without XS attribute BAM record error: found spliced alignment without XS attribute the BAM file : 323_358_201073 chr1343 0 45M5H * 0 0 CCCTAACCCTACCCTAACCCTAACCCTAACCCTAACCCTAACCCT III))C/1DE''@DAHD379AID1;7BI+'7))I?3 RG:Z:20110328192522421 NH:i:0 CM:i:4 SM:i:2 CQ:Z:A=ABA@?4)='))415'-4118-'1)9'+1'6+'1)85+)-+6- CS:Z:T200230100231102301000301002301002301000320 423_236_195581 chr1550 0 8H42M = 699451 698945 GTGCAGAGGAGAACGCAGCTCCGCCCTCGCGGTGCTCTCCGG GF%%III))8?%% RG:Z:20110328192522421 NH:i:2 CM:i:5 SM:i:3 CQ:Z:9BAAAB;?AB:55;A%9?AB,4:@@*/)72%5@:3,;-.%8.*;5 CS:Z:T2030311033322303302232133302223222131122330223 298_1884_1495 113 chr1562 0 7H43M chr3199392032 0 ACGCAGCTCCGCCCTCGCGGTGCTCTCCGGGTCTGTGCTGAGG 5AI;6:A?I7FIE RG:Z:20110328192522421 NH:i:2 CM:i:0 SM:i:3 CQ:Z:BB@7AB8@ABA=2;=82:?A388.A28(77;64.1*-/0:9/%3? CS:Z:T202212311122100303110333220033022321331022 62_1428_195489 chr1562 1 50M * 0 0 ACGCAGCTCCGCCCTCGCGGTGCTCTCCGGGTCTGTGCTGAGGAGAATGC *=AIII4/CII=%%I((=EIII RG:Z:20110328192522421 NH:i:0 CM:i:4 SM:i:0 CQ:Z:@B@BABB=ABBB?@A=B@@?;?B=??'7(;A%849+%0:@.4* CS:Z:T1313022202212311122100303110331222033022321331 I have sorted the bam file and the gtf file. cufflinks -G refGene_hg18.gtf -p 3 -r human_hg18.fa -o test test.pe.bam (the version of cufflinks is v0.9.2 ) Who know the reason ,and what shoud I do! best wishes! Shiyong Li 2011-04-11 lishiyong ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
Re: [galaxy-user] Convert SOLiD data
Lishiyong, You should not convert colorspace to base space prior to aligning reads. The reason for this is that if there is an error in one of the color calls, it will effect all the downstream color calls. Instead, you should use an aligner that will do the assembly in color-space instead. I know there are a few out there, but don't know them off the top of my head. Ryan On 3/27/11 11:35 PM, lishiyong wrote: Hello! I convert SOLiD csfasta- and qual-files to fastq-files ,I want to use the fastq-files to do denovo with *SOAPdenovo*.because the SOLiD de novo accessory tools Require large memory .But ,I find that there're some question for the converting . for example: T0202322110210103200200203001123212113333311200 —— AGAGTGGCCAGCACATGAAGAAGATAACCGTGCGCCTTTTTCCGAA But I think it should to be TCCTAGACAAGTTGGCTTTCCCTTAAACAGCTGACATAGAGATATGTCCC Who knows the reason about this. 2011-03-28 lishiyong ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ -- CONFIDENTIALITY NOTICE: This email communication may contain private, confidential, or legally privileged information intended for the sole use of the designated and/or duly authorized recipient(s). If you are not the intended recipient or have received this email in error, please notify the sender immediately by email and permanently delete all copies of this email including all attachments without reading them. If you are the intended recipient, secure the contents in a manner that conforms to all applicable state and/or federal requirements related to privacy and confidentiality of such information. attachment: golharam.vcf___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
Re: [galaxy-user] Sort index SAM-files automatically
Jo, Use the SAM Tools SAM-TO-BAM tool in Galaxy to convert your SAM file to a BAM file. Ryan On 3/25/11 10:35 AM, Jochen Seggewiß wrote: Hi! Thank you for your reply. So that means, I should convert the csfasta qual to fastq, map it with Bowtie, get an SAM, convert it to BAM and then index that BAM? How can I index BAM using GALAXY? I haven´t found a way to get a BAM directly from GALAXY using csfasta qual as input files. Best regards Jo Am 3/25/2011 3:13 PM, schrieb Jim Robinson: Hi Jo, To short-circuit confusion I'll jump in here. I'm the developer of IGV and igvtools, the sorting and indexing for SAM files was added long ago, even before indexed BAM files were possible from Java programs. The recommendation now is to convert to BAM and index that, although SAM files still work. If the galaxy community would like the SAM option I'm happy to have igvtools wrapped as a module, and will help with that. BTW, I also have some code (xml) to wrap IGV itself as a Galaxy visualizer, contributed to me by a user. As I don't have a private Galaxy installation I'm unable to test it myself, but can make it available if anyone is interested. Jim Hello! I convert SOLiD csfasta- and qual-files to fastq-files and map those against Hg19 (Bowtie). I would like to use the resulting sam-files in the IGV browser (Broad Institute). Therefore, the sam-file need to be sorted an indexed. This could be done using the “igvtools”. However, it would be nicer if this sorting and indexing could be done automatically using GALAXY. I guess that it is certainly possible – but I do not know how. Could anybody let me know how it works and what function I have to use, respectively? How can I sort the sam-file the correct way? Thank you in advance. Best regards Jo ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ -- CONFIDENTIALITY NOTICE: This email communication may contain private, confidential, or legally privileged information intended for the sole use of the designated and/or duly authorized recipient(s). If you are not the intended recipient or have received this email in error, please notify the sender immediately by email and permanently delete all copies of this email including all attachments without reading them. If you are the intended recipient, secure the contents in a manner that conforms to all applicable state and/or federal requirements related to privacy and confidentiality of such information. attachment: golharam.vcf___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
